Shuttle vector system based on blue-green algae endogenous plasmids

Abstract

The invention discloses a shuttle vector system based on blue-green algae endogenous plasmids, and belongs to the technical field of genetic engineering. The shuttle vector system comprises a ternary replication element, and the ternary replication element is a replication part of a synechococcus plasmid pANS or a replication part of a synechococcus plasmid pANL, a replication part of an escherichia coli plasmid pUC19 and a replication part of a saccharomyces cerevisiae plasmid pRS416 or a replication part of a saccharomyces cerevisiae plasmid pRS415. The shuttle vector system can shuttle and copy among three different hosts, namely synechococcus, escherichia coli and saccharomyces cerevisiae, and simultaneous expression of heterologous genes is realized by utilizing expression advantages of different hosts. The shuttle vector system has the advantages of being easy to operate, short in preparation period and convenient for large-scale preparation, and more possibilities are provided for available genetic tools of blue-green algae genetic engineering.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a ternary shuttle expression vector system of Synechococcus-Escherichia coli-Saccharomyces cerevisiae based on endogenous plasmids of cyanobacteria and an application thereof. Background Art

[0002] In recent years, the role of cyanobacteria in food, environment, health and energy has attracted more and more attention and has great development prospects. The reason is often due to the inherent advantages of cyanobacteria. The growth of cyanobacteria only requires light, air and inorganic salts, and does not contain toxic proteins. Once the exogenous target gene can be normally expressed in the cyanobacterial receptor cells, the target gene product can be produced under light. In addition, compared with commonly used expression hosts such as Escherichia coli, yeast or mammalian cell hosts, cyanobacteria have strong environmental adaptability, low culture cost, no inclusion bodies and endotoxins, and cyanobacteria themselves contain nutrients that are beneficial to humans.

[0003] The main research contents reported in the field of cyanobacterial genetic engineering include: cloning of cyanobacterial target genes; transfer of foreign genes into cyanobacteria; construction of the required vector platform in cyanobacterial cells; establishment of gene transfer methods and detection methods, etc. Among them, the construction of the vector is the key to algae genetic engineering, and it is also an important factor affecting the stability and expression effect of foreign gene expression. However, the plasmid expression system in cyanobacterial genetic engineering still has defects such as low expression efficiency, low expression stability and single expression host, and the expression of the host is usually concentrated in cyanobacteria, and it is impossible to take advantage of the expression advantages of other hosts.

[0004] The E. coli-cyanobacteria binary vectors currently in use include the pSOMA series, pAM, pCVD, etc. These binary vectors generally contain DNA replicons and bacterial selection markers (such as Amp, Kan and other resistance genes) of E. coli, and also contain DNA replicons of algae (such as pANS_origin, pCA2.4-origin, pCB2.4-origin, etc.). Therefore, these binary vectors can replicate and proliferate in E. coli and cyanobacteria. However, all these binary vectors cannot replicate and proliferate in yeast cells.

[0005] The DNA used to transform cyanobacteria is usually first constructed by passing these small DNA fragments through a binary vector in Escherichia coli, and then extracting the recombinant vector DNA from Escherichia coli and transforming it into cyanobacteria (such as Synechococcus PCC7942). The above vector construction method has the disadvantages of low efficiency, long time consumption, and is not suitable for high-throughput DNA transformation and gene knock-in and knock-out operations.

[0006] Yeast homologous recombination is an efficient, rapid, and suitable vector construction method for high-throughput DNA transformation. DNA vectors with yeast replicons and yeast selection markers can be used for DNA homologous recombination. These vectors include pRS415, pYIP5, pPICZ, pRS426, etc., which are characterized by containing a yeast DNA replicon (such as CEN6 / ARSH4_origin), yeast selection marker genes (such as URA3, LEU2, HIS3, etc.), and these vectors generally also contain Escherichia coli DNA replicons and bacterial selection markers (such as Amp, Kan and other resistance genes). Therefore, these yeast plasmids are E. coli-yeast shuttle expression vectors that can replicate and proliferate in yeast and E. coli cells.

[0007] However, all of these E. coli-yeast shuttle expression vectors cannot replicate and proliferate in cyanobacterial cells, so they cannot be directly used in the DNA transformation process of cyanobacteria. However, the Synechococcus-E. coli-Saccharomyces cerevisiae ternary shuttle vector can use the yeast homologous recombination method to construct DNA fusion fragments (gene expression sequences, gene knock-in and knock-out structures, etc.), extract plasmids from yeast, and then transfer them into E. coli to obtain high-copy DNA for DNA transformation of cyanobacteria, achieving high-throughput genetic operations, which makes the genetic transformation of cyanobacteria have the opportunity to become more efficient. Summary of the invention

[0008] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a shuttle vector system based on endogenous plasmids of cyanobacteria.

[0009] According to one aspect of the present invention, a shuttle vector system based on endogenous plasmids of cyanobacteria is proposed, wherein the shuttle vector system comprises a ternary replication element, wherein the ternary replication element is a replication portion of a Synechococcus plasmid pANS or a replication portion of a Synechococcus plasmid pANL, a replication portion of an Escherichia coli plasmid pUC19, and a replication portion of a Saccharomyces cerevisiae plasmid pRS416 or a replication portion of a Saccharomyces cerevisiae plasmid pRS415.

[0010] Furthermore, the replication part of the Synechococcus plasmid pANS is the replication origin pANS-ori-repA region, and the replication part of the Synechococcus plasmid pANL is the replication origin pANL-ori region and the maintenance region; the sequences of the replication part of the Synechococcus plasmid pANS and the replication part of the Synechococcus plasmid pANL are shown in SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence table, respectively.

[0011] Furthermore, the replication part of the E. coli plasmid pUC19 is the replication origin pUCori region.

[0012] Furthermore, the replication part of the Saccharomyces cerevisiae plasmid pRS416 and the replication part of the Saccharomyces cerevisiae plasmid pRS415 are both the replication origin CEN6 / ARSH4 region.

[0013] Furthermore, the shuttle vector pYES1 is constructed based on the ternary replication elements, which are the replication part of Synechococcus plasmid pANS, the replication part of Escherichia coli plasmid pUC19 and the replication part of Saccharomyces cerevisiae plasmid pRS416. The average copy number of the shuttle vector pYES1 is 10-100.

[0014] Furthermore, the selection marker genes of the shuttle vector pYES1 include ampicillin Amp and orotidine-5'-phosphate decarboxylase encoding gene URA3.

[0015] Furthermore, the shuttle vector pYES2 is constructed based on the ternary replication elements, which are the replication part of Synechococcus plasmid pANL, the replication part of Escherichia coli plasmid pUC19 and the replication part of Saccharomyces cerevisiae plasmid pRS415. The average copy number of the shuttle vector pYES2 is 3-30.

[0016] Furthermore, the selection marker genes of the shuttle vector pYES2 include kanamycin Kan and β-isopropylmalate dehydrogenase encoding gene LEU2.

[0017] Different selection genes can be used to achieve heterologous expression of the Synechococcus-Escherichia coli-Saccharomyces cerevisiae ternary shuttle vectors pYES1 and pYES2.

[0018] According to a second aspect of the present invention, a method for constructing a shuttle vector system is proposed, comprising the following steps:

[0019] S1, using Synechococcus plasmid, Escherichia coli plasmid and Saccharomyces cerevisiae plasmid as templates, respectively amplifying the required replication parts by PCR method;

[0020] S2, the desired replication part is connected by slow annealing to obtain a connection product, the connection product is introduced into an Escherichia coli recipient cell, and the transformant is screened on a plate to obtain a shuttle vector;

[0021] S3. The obtained shuttle vector was transformed into Synechococcus and Saccharomyces cerevisiae to verify the shuttle replication and expression capabilities.

[0022] The Synechococcus-Escherichia coli-Saccharomyces cerevisiae ternary shuttle vector can use yeast homologous recombination to construct DNA fusion fragments (gene expression sequences, gene knock-in and knock-out structures, etc.), extract plasmids from yeast, and then transfer them into Escherichia coli to obtain high-copy DNA for DNA transformation of cyanobacteria, thereby achieving high-throughput genetic operations.

[0023] According to the third aspect of the present invention, an application of the shuttle vector system in the field of genetic manipulation of algae, bacteria and fungal cells is proposed, and the application includes:

[0024] A1, introducing the target gene into the shuttle vector and transforming yeast or E. coli cells together to obtain a recombinant expression vector;

[0025] A2. The recombinant expression vector is transformed into algae cells by electroporation or natural transformation, and transformants are picked on a selective culture medium.

[0026] Beneficial effects of the present invention:

[0027] The shuttle vector system based on the endogenous plasmid of cyanobacteria disclosed in the present invention can realize expression in three different hosts, namely, Synechococcus, Escherichia coli and Saccharomyces cerevisiae, making full use of the advantages of fast replication speed, easy operation and convenience for large-scale preparation of Escherichia coli, and also making full use of the advantages of large-fragment homologous recombination in yeast and light energy conversion in cyanobacteria. The shuttle vector system can also realize simultaneous and stable expression of genes in cyanobacteria, and is not affected by plasmid incompatibility. In addition, the expression process of the shuttle vector system is simple to operate, the experimental cycle is short, and the stable expression of exogenous genes in cyanobacteria can be realized efficiently, which has good application prospects and can open up a new way for the industrial development of transgenic cyanobacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The expression elements and construction schematic diagram of the shuttle vector pYES1 and the shuttle vector pYES2 provided by the present invention;

[0029] Figure 2 The electrophoresis diagram of plasmid extraction and ApaLI enzyme digestion identification of the shuttle vector pYES1 and the shuttle vector pYES2 provided by the present invention;

[0030] Figure 3 This is an identification diagram of the expression of the shuttle vector pYES1 and the shuttle vector pYES2 provided by the present invention in three different hosts: Synechococcus, Escherichia coli and Saccharomyces cerevisiae. DETAILED DESCRIPTION

[0031] The present application will be further described in detail below in conjunction with the accompanying drawings and embodiments. It is to be understood that the specific embodiments described herein are only used to explain the relevant invention, rather than to limit the invention. It should also be noted that, for ease of description, only the parts related to the relevant invention are shown in the accompanying drawings.

[0032] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present application will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0033] In view of the fact that the host expression of the plasmid expression system in the existing cyanobacteria genetic engineering is usually concentrated in cyanobacteria, it is impossible to take advantage of the expression advantages of other hosts. Therefore, the first object of the present invention is to propose a shuttle vector system based on cyanobacteria endogenous plasmids to achieve the expression of cyanobacteria genes in three different hosts: Synechococcus, Escherichia coli and Saccharomyces cerevisiae.

[0034] The second object of the present invention is to propose a method for constructing a shuttle vector system, so as to achieve simultaneous and stable gene expression in cyanobacteria without being affected by plasmid incompatibility. In addition, the expression process of the shuttle vector system is simple to operate and has a short experimental cycle, and can efficiently achieve stable expression of exogenous genes in cyanobacteria.

[0035] The third object of the present invention is to propose an application of a shuttle vector system in the field of genetic manipulation of algae, bacteria and fungal cells, providing more possibilities for available genetic tools for cyanobacteria genetic engineering.

[0036] Example 1: Construction of shuttle vector pYES1 and shuttle vector pYES2

[0037] The shuttle vector constructed based on the ternary replication elements, which are the replication part of Synechococcus plasmid pANS, the replication part of Escherichia coli plasmid pUC19 and the replication part of Saccharomyces cerevisiae plasmid pRS416, is pYES1, and the average copy number of the shuttle vector pYES1 is 10-100. The shuttle vector constructed based on the ternary replication elements, which are the replication part of Synechococcus plasmid pANL, the replication part of Escherichia coli plasmid pUC19 and the replication part of Saccharomyces cerevisiae plasmid pRS415, is pYES2, and the average copy number of the shuttle vector pYES2 is 3-30. The sequences of the replication part of Synechococcus plasmid pANS and the replication part of Synechococcus plasmid pANL are shown in SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence table, respectively.

[0038] Among them, the replication part of the Synechococcus plasmid pANS is the replication origin pANS-ori-repA region, the replication part of the Synechococcus plasmid pANL is the replication origin pANL-ori region and the maintenance region, the replication part of the Escherichia coli plasmid pUC19 is the replication origin pUCori region, and the replication part of the Saccharomyces cerevisiae plasmid pRS416 and the replication part of the Saccharomyces cerevisiae plasmid pRS415 are both the replication origin CEN6 / ARSH4 region.

[0039] The expression elements and construction diagram of shuttle vector pYES1 and shuttle vector pYES2 are shown in Figure 1As shown, the shuttle vector pYES1 and the shuttle vector pYES2 were constructed by circular polymerase extension cloning, and each fragment was connected by the overlap region. The selection marker genes of the shuttle vector pYES1 include ampicillin Amp and orotidine-5'-phosphate decarboxylase encoding gene URA3, and the selection marker genes of the shuttle vector pYES2 include kanamycin Kan and β-isopropylmalate dehydrogenase encoding gene LEU2. The use of different selection marker genes can realize the heterologous expression of the shuttle vector pYES1 and the shuttle vector pYES2 in the Synechococcus-Escherichia coli-Saccharomyces cerevisiae ternary shuttle vector.

[0040] The specific construction method and steps of the shuttle vector pYES1 are as follows:

[0041] (1) Using the genomic DNA of Synechococcus PCC 7942 as a template, PCR amplification was performed with primers 1 and 2 to obtain the replication portion of the Synechococcus plasmid pANS, namely the F1 fragment, which is 3546 bp in size.

[0042] (2) Using the standard plasmid pRS416 as a template, PCR amplification was performed with primers 3 and 4 to obtain the F3 fragment with a size of 3705 bp.

[0043] (3) Circular polymerase extension cloning is used to carry out slow annealing ligation in vitro, and the ligation product is then introduced into Escherichia coli recipient cells. Transformants are screened on ampicillin-resistant plates to obtain the recombinant plasmid pYES1.

[0044] The specific sequences of primers 1 to 4 are as follows:

[0045] Primer 1: CACAGATGAGCTCGTCTAAGTCTCATCACAGCCAGG

[0046] Primer 2: GCTGGCCGCGGCCGCTTCTAGACTAAGCATTTCTAC TTAGCCATCCGTC

[0047] Primer 3: CTAGAAGCGGCCGCGGCCAGCAAAAGGCCAGGA

[0048] Primer 4: GATGAGACTTAGACGAGCTCATCTGTGCGGTATTTC ACACCGCATAG

[0049] The specific construction method and steps of the shuttle vector pYES2 are as follows:

[0050] (1) Using the genomic DNA of Synechococcus PCC 7942 as a template, PCR amplification was performed with primers 5 and 6 to obtain the replication portion of the Synechococcus plasmid pANL, namely the F2 fragment, which is 1550 bp in size.

[0051] (2) Using the standard plasmid pRS415 as a template, primers 7 and 8 were used for PCR amplification to obtain the F4 fragment with a size of 2771 bp.

[0052] (3) Using the standard plasmid NS3-COBB as a template, primers 9 and 10 were used to perform PCR amplification to obtain the kanamycin resistance fragment F5 with a size of 994 bp.

[0053] (4) Using the standard plasmid pRS416 as a template, PCR amplification was performed with primers 11 and 12 to obtain the E. coli replication element F6, which was 703 bp in size.

[0054] (5) Using the genomic DNA of Synechococcus PCC 7942 as a template, PCR amplification was performed with primers 13 and 14 to obtain the plasmid maintenance region gene fragment F7, which is 4311 bp in size and maintains the stable existence of the shuttle vector pYES2.

[0055] (6) Circular polymerase extension cloning is used to carry out slow annealing ligation in vitro, and the ligation product is then introduced into Escherichia coli recipient cells. Transformants are selected on kanamycin-resistant plates to obtain the recombinant plasmid pYES2.

[0056] Wherein, the sequences of primers 5 to 14 are as follows:

[0057] Primer 5: CGTTGCGGCCGCAGTTCATCCGCATGATCTCGC

[0058] Primer 6: CTACTGGGGTGATAGCAGATCACTTAGGTGCTCCTT G

[0059] Primer 7: CCGAACTAGAACTGTGGGAATACTCAGGTATCGTAAG

[0060] Primer 8: GGTTCGCATCGTCTCACATTTCCCCGAAAAGTGCCA C

[0061] Primer 9: GGAAATGTGAGACGATGCGAACCTTCTCCAG

[0062] Primer 10: GCTCAGTGGAACGAATTAGAAAAACTCATCGAGCA TCAAATGAAACTG

[0063] Primer 11: GAGTTTTTCTAATTCGTTCCACTGAGCGTCAGAC

[0064] Primer 12: GATGAACTGCGGCCGCAACGCAGGAAAGAACATGTGAGC

[0065] Primer 13: GTATTCCCACAGTTCTAGTTCGGTTGAAAGGGGTTAATCAG

[0066] Primer 14: GTGATCTGCTATCACCCCAGTAGCTTGGCTAG

[0067] Figure 2 This is the electrophoresis diagram for the extraction of shuttle vector pYES1 and shuttle vector pYES2 plasmids and ApaLI enzyme digestion identification. The shuttle vector pYES1 and shuttle vector pYES2 plasmids were obtained by agarose gel electrophoresis detection.

[0068] Example 2: Transformation of shuttle vector pYES1 and shuttle vector pYES2 plasmids into Synechococcus and Saccharomyces cerevisiae

[0069] The specific experimental steps for transforming the shuttle vector pYES1 and the shuttle vector pYES2 plasmids constructed in Example 1 into Synechococcus PCC7942 are as follows:

[0070] (1) Take 4 ml of PCC7942 bacterial suspension with OD750 nm of 0.7 in a sterile EP tube and centrifuge at 5000 rpm at 4°C for 5 min.

[0071] (2) Remove the supernatant and wash three times with 1 mL of 1 mM / L HEPES.

[0072] (3) Remove the supernatant and resuspend in 100 μL 1 mm / L HEPES.

[0073] (4) Take the electroporation cup out of the alcohol tank, blow dry it in a clean bench, open the lid, put a piece of paper at the bottom, blow dry the electroporation cup at level 3 wind, irradiate with UV for 15 min, and precool the BG-11 medium in a 4℃ refrigerator. Perform subsequent operations without touching the EP tube wall.

[0074] (5) Add 2 μg of plasmid to the cyanobacterial cells, use a gun to gently blow and mix the plasmid and bacterial solution in the EP tube, and place it on ice for 30 min.

[0075] (6) Transfer all bacterial liquid to an electroporation cup, wipe off the external moisture, and electroporate the cyanobacteria at EC 2, 2Kv, and 6ms. After electroporation, quickly add 1mL of pre-cooled BG-11, mix well, and place in a 2mL EP tube.

[0076] (7) Wrap with tin foil and culture in a constant temperature shaker at 30°C and 220 rpm for 24 h.

[0077] (8) After centrifugation, resuspend the culture medium in 100 μL of BG-11 and screen transformants using ampicillin and kanamycin plates.

[0078] The specific experimental steps for transforming the shuttle vector pYES1 and the shuttle vector pYES2 plasmids constructed in Example 1 into Saccharomyces cerevisiae BY4741 are as follows:

[0079] (1) Activation of bacterial strains: Pick a fresh single clone and place it in a shake tube containing 3 mL YPD liquid culture medium and culture it overnight in a constant temperature shaker at 30°C.

[0080] (2) Determination of bacterial solution density: Measure the OD600 value of the bacterial solution. The measured value should be between 0.2 and 0.8.

[0081] (3) Transfer: Pipette an appropriate volume of bacterial solution and dilute it into a shake tube containing 3 mL of the corresponding liquid culture medium, so that the initial OD is 0.1, and culture it in a constant temperature shaker at 30°C for 4-6 h.

[0082] (4) Collecting bacteria: Take 1 mL of bacterial solution and measure the OD600. The optimal value is about 0.6. Centrifuge the remaining 2 mL of bacterial solution at 4200 rpm for 1 min, discard the supernatant, and collect the bacteria into a 1.5 mL EP tube with an appropriate label.

[0083] (5) Washing: Resuspend each EP tube with 700 μL 0.1 M LiAc / TE buffer, centrifuge at 4200 rpm for 1 min, and discard the supernatant.

[0084] (6) Resuspend: Add an appropriate volume of 0.1M LiAc / TE to resuspend the cells to a final concentration of 50 OD / mL. Generally, 1 OD of cells is used for each small system transformation, i.e., 20 μL of 50 OD / mL cells. Usually, if there is no extremely high requirement for the transformation rate, adding 1% of the original bacterial solution volume is sufficient.

[0085] (7) Transformation MIX preparation: For each transformation sample, prepare MIX as follows: 62.4 μL of 50% (W / V) PEG3350, 8.22 μL of 1 M LiOAc, 5 μL of ssDNA (salmon sperm, 2 mg / ml), 20 μL of Yeast competent cells and 20 ng of the plasmid to be transformed.

[0086] (8) Incubation: After the transformation system is fully mixed, incubate in a 30°C incubator for 35 min. Heat shock the transformation system in a 42°C water bath for 15 min.

[0087] (9) Plate coating: Use SC-Ura and SC-Leu in the transformation system to screen transformants.

[0088] The expression of shuttle vector pYES1 and shuttle vector pYES2 in three different hosts: Synechococcus, Escherichia coli and Saccharomyces cerevisiae. Figure 3 As shown, the shuttle vector pYES1 and the shuttle vector pYES2 constructed by the present invention can achieve stable replication in three different hosts, namely, Synechococcus, Escherichia coli and Saccharomyces cerevisiae, and effectively enhance the expression capacity of cyanobacterial genes.

[0089] The above describes the specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any technician familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed in the present application, which should be included in the protection scope of the present application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

Claims

1. A shuttle vector system based on endogenous plasmids of cyanobacteria, characterized in that: The shuttle vector system comprises a ternary replication element, which is a replication part of Synechococcus plasmid pANS or Synechococcus plasmid pANL, a replication part of Escherichia coli plasmid pUC19 and a replication part of Saccharomyces cerevisiae plasmid pRS416 or Saccharomyces cerevisiae plasmid pRS415.

2. The shuttle vector system according to claim 1, characterized in that: The replication part of the Synechococcus plasmid pANS is the replication origin pANS-ori-repA region, and the replication part of the Synechococcus plasmid pANL is the replication origin pANL-ori region and the maintenance region; the sequences of the replication part of the Synechococcus plasmid pANS and the replication part of the Synechococcus plasmid pANL are shown in SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence table, respectively.

3. The shuttle vector system according to claim 1, characterized in that: The replication part of the E. coli plasmid pUC19 is the replication origin pUCori region.

4. The shuttle vector system according to claim 1, characterized in that: The replication part of the Saccharomyces cerevisiae plasmid pRS416 and the replication part of the Saccharomyces cerevisiae plasmid pRS415 are both the replication origin CEN6 / ARSH4 region.

5. The shuttle vector system according to claim 1, characterized in that: The shuttle vector pYES1 is constructed based on the ternary replication elements, which are the replication part of Synechococcus plasmid pANS, the replication part of Escherichia coli plasmid pUC19 and the replication part of Saccharomyces cerevisiae plasmid pRS416. The average copy number of the shuttle vector pYES1 is 10-100.

6. The shuttle vector system according to claim 5, characterized in that: The screening marker genes of the shuttle vector pYES1 include ampicillin Amp and orotidine-5'-phosphate decarboxylase encoding gene URA3.

7. The shuttle vector system according to claim 1, characterized in that: The shuttle vector pYES2 is constructed based on the ternary replication elements, which are the replication part of Synechococcus plasmid pANL, the replication part of Escherichia coli plasmid pUC19 and the replication part of Saccharomyces cerevisiae plasmid pRS415. The average copy number of the shuttle vector pYES2 is 3-30.

8. The shuttle vector system according to claim 7, characterized in that: The screening marker genes of the shuttle vector pYES2 include kanamycin Kan and beta-isopropylmalate dehydrogenase encoding gene LEU2.

9. A method for constructing a shuttle vector system according to any one of claims 1 to 8, characterized in that: The following steps are involved: S1, using Synechococcus plasmid, Escherichia coli plasmid and Saccharomyces cerevisiae plasmid as templates, respectively amplifying the required replication parts by PCR method; S2, the desired replication part is connected by slow annealing to obtain a connection product, the connection product is introduced into an Escherichia coli recipient cell, and the transformant is screened on a plate to obtain a shuttle vector; S3. The shuttle vector is transformed into Synechococcus and Saccharomyces cerevisiae to verify the shuttle replication and expression capabilities.

10. Use of the shuttle vector system according to any one of claims 1 to 8 in the field of genetic manipulation of algae, bacteria and fungal cells, characterized in that: The applications include: A1, introducing the target gene into the shuttle vector and transforming yeast or Escherichia coli cells together to obtain a recombinant expression vector; A2. The recombinant expression vector is transformed into algae cells by electroporation or natural transformation, and transformants are picked on a selective culture medium.

Images