Single nucleotide detection method and related probe

Abstract

A method of sequencing a nucleic acid characterized by the steps of: (1) generating a stream of mononucleoside triphosphate by progressive enzymatic digestion of the nucleic acid; (2) producing at least one oligonucleotide-used probe by reacting at least one mononucleoside triphosphate with a corresponding biological probe in the presence of a polymerase, the corresponding biological probe comprising (a) a first single stranded oligonucleotide comprising an exonuclease closure site and (b) a second single stranded oligonucleotide comprising an exonuclease closure site; the present invention relates to a kit comprising (a) a single nucleotide triphosphate, (b) a closure site 5'side of the closure site and comprising a restriction endonuclease recognition site for capturing the mononucleotide triphosphate, and at least one fluorophore region located 5 'side of the recognition site and arranged to quench a fluorophore, and (b) second and optionally third single stranded oligonucleotides, their isolated from the first oligonucleotides, respectively, and capable of hybridizing to complementary regions on the first oligonucleotides flanking the capture sites 3'and 5 '; (3) cleaving the first oligonucleotide strand of the used probe at a recognition site with a restriction endonuclease to produce a first oligonucleotide component with a fluorophore; (4) digesting the first oligonucleotide component with an enzyme having 3 '-5' exonucleotide activity to produce a fluorophore in a detectable state, and (5) detecting the fluorophore released in step (4). Also provided are corresponding methods for use with enzymes having 5 '-3' exonuclease activity, as well as novel bioprobes and kits obtained therefrom.

Description

[0001] This application is a divisional application of the application with an international application date of May 15, 2018, international application number PCT / EP2018 / 062545, which entered the Chinese national phase application number 201880032020.3, and invention name “Single Nucleotide Detection Methods and Related Probes”.

[0002] The present invention relates to a method for detecting and characterizing a single nucleotide and a related biological probe, which is particularly suitable for sequencing DNA or RNA.

[0003] Next generation sequencing of genetic material has had a major impact on the biological sciences in general and on medicine in particular as the unit cost of sequencing has increased in relation to the availability of increasingly faster sequencing machines.

[0004] In our previous applications WO2014 / 053853, WO2014 / 053854, WO2014 / 167323, WO2014 / 167324, WO2014 / 111723, WO2015 / 121675 and WO2017 / 005789, we have described a new sequencing method, which relates to progressive digestion of polynucleotide analytes to produce an ordered mononucleotide stream, preferably a mononucleoside triphosphate stream, wherein each can be captured one by one in the corresponding droplet in the droplet stream. After this, each droplet can be subjected to chemical and / or enzymatic manipulation to display the specific mononucleotide initially contained therein. In one embodiment, these chemical and / or enzymatic manipulations comprise methods involving the use of one or more two-component oligonucleotide probe types, and each probe type is suitable for being able to selectively capture one of the mononucleotide types constituting the analyte. Typically, in each such probe type, one of the two oligonucleotide components contains a characteristic fluorophore, and in the unused state of the probe, the ability of these fluorophores to fluoresce remains extinguished due to the presence of a quencher in close proximity or by self-quenching. In use, when the probe captures its corresponding single nucleotide, it is made susceptible to subsequent exonucleolysis, thereby releasing the fluorophore from the quencher and / or each other so that it can fluoresce freely. In this way, the original single nucleotide present in each droplet can be indirectly inferred by spectroscopic means.

[0005] Variations of this approach have been described in our other pending applications, including WO201405385 and WO2016012789; the latter involves the use of a three-component probe. In particular, WO2016012789 describes an improved method characterized by the following steps: (1) generating a stream of single nucleotide triphosphates by progressive digestion of nucleic acid; (2) generating at least one substantially double-stranded oligonucleotide used probe by reacting at least one single nucleotide triphosphate with a corresponding probe in the presence of a polymerase and a ligase, the probe comprising (a) a first single-stranded oligonucleotide in an undetectable state labeled with, for example, a characteristic fluorophore and (b) a second and a third single-stranded oligonucleotide capable of hybridizing to a complementary region on the first oligonucleotide; (3) digesting the used probe with an enzyme having double-stranded nucleic acid exosome activity to generate a fluorophore in a detectable state and a single-stranded fourth oligonucleotide having at least a portion of a complementary sequence to the first oligonucleotide; (4) reacting the fourth oligonucleotide with another first oligonucleotide to generate a substantially double-stranded oligonucleotide product corresponding to the used probe; (5) repeating steps (3) and (4) in one cycle; and (6) detecting the fluorophore released in each iteration of step (3). The advantage of this method is that by iterating steps (3) and (4) in one cycle, the fluorescence signal can be strongly enhanced, thereby improving the overall sensitivity and therefore the reliability of nucleotide detection. In one embodiment, the second and third oligonucleotides are linked so that after nucleotide capture, they form a closed-loop single-stranded oligonucleotide component that is advantageously resistant to exonucleolytic cleavage.

[0006] Regarding other existing technologies, Fan et al. have published in Nature Reviews Genetics 7（8） A review of the progress in methods and platforms that enable highly parallel genomic assays for genotyping, copy number measurement, sequencing, detection of loss of heterozygosity, allele-specific expression, and methylation is provided in 632-644 (2006). Figure 2 a Schematic showing the use of a circularizable probe with 3' and 5' ends that anneal upstream and downstream of a single nucleotide polymorphism (SNP) site on the analyte, leaving a gap that is subsequently filled with nucleotides that are complementary to the SNP to form a complete circular probe that can be amplified after release. However, unlike our method, the nucleotides captured during the filling process are not obtained directly from the analyte itself.

[0007] WO03080861 discloses a method in which a nucleic acid analyte undergoes progressive pyrophosphorolysis in the presence of nucleotide-specific reactive labels which, upon release, are directly attached to the nucleotide. Not only is this completely different from the approach we employ, but in practice the fluorescence signal measured when the labeled nucleotide is subsequently detected may be too weak to allow reliable identification above the associated background noise.

[0008] Finally, WO9418218 teaches a DNA sequencing method in which the analyte undergoes progressive exonucleolysis to produce a stream of mononucleotide diphosphates or mononucleotide monophosphates, which are then added to a fluorescence enhancing matrix prior to detection. Not only is this a completely different approach from the one we describe, but any signal produced is likely to be too weak to be reliably detected and identified.

[0009] One disadvantage of the above-described exonucleolytic-based methods is that the rate of generation of the fluorescent signal is limited by the speed of the digestion phase, and the specificity of the exonuclease limits the achievable signal-to-noise level. Although this is by no means fatal to the application of the method, from a technical point of view, it is still highly desirable to shorten the incubation period associated with fluorescence growth and improve the signal-to-noise ratio to achieve faster and more accurate sequencing; especially when long sequencing reads are expected. We now achieve this by combining exonucleolytic digestion of the used probe with selective endonucleolytic cleavage of the strand carrying a quenched fluorophore. Therefore, according to a first aspect of the present invention, a method for sequencing nucleic acids is provided, characterized by the following steps: (1) generating a stream of mononucleotide triphosphates by progressive enzymatic digestion of nucleic acids; (2) generating at least one oligonucleotide used probe by reacting at least one mononucleotide triphosphate with a corresponding biological probe in the presence of a polymerase, the corresponding biological probe comprising (a) a first single-stranded oligonucleotide comprising an exonuclease blocking site, a restriction endonuclease recognition site located 5' to the blocking site and comprising a mononucleotide capture site for capturing the mononucleotide triphosphate, and a restriction endonuclease recognition site located 5' to the recognition site. at least one fluorophore region on the 5' side, which is arranged to quench the fluorophore, and (b) a second and optionally a third single-stranded oligonucleotide, which are separated from the first oligonucleotide and are capable of hybridizing to complementary regions on the first oligonucleotide located on the 3' and 5' sides of the capture site, respectively; (3) cutting the first oligonucleotide chain of the used probe at the recognition site with a restriction endonuclease to produce a first oligonucleotide component with a fluorophore; (4) digesting the first oligonucleotide component with an enzyme having 3'-5' nucleolytic activity to produce a fluorophore in a detectable state, and (5) detecting the fluorophore released in step (4).

[0010] According to a second aspect of the present invention, there is provided a method for sequencing a nucleic acid, characterized by the following steps: (1) generating a stream of mononucleoside triphosphates by progressive enzymatic digestion of the nucleic acid; (2) generating at least one oligonucleotide probe for use by reacting at least one mononucleoside triphosphate with a corresponding biological probe in the presence of a polymerase, the corresponding biological probe comprising (a) a first single-stranded oligonucleotide comprising a nuclease blocking site, a restriction endonuclease recognition site located 3' to the blocking site and comprising a single nucleotide capture site for capturing the mononucleoside triphosphate, and (b) a first single-stranded oligonucleotide comprising a nuclease blocking site, a restriction endonuclease recognition site located 3' to the blocking site and comprising a single nucleotide capture site for capturing the mononucleoside triphosphate. ' side, which is arranged to quench the fluorophore, and (b) a second and optional third single-stranded oligonucleotides, which are separated from the first oligonucleotide and can hybridize with complementary regions on the first oligonucleotide located on the 3' and 5' sides of the capture site; (3) using a restriction endonuclease to cut the first oligonucleotide chain of the used probe at the recognition site to produce a first oligonucleotide component with a fluorophore; (4) digesting the first oligonucleotide component with an enzyme having 5'-3' nucleolytic activity to produce a fluorophore in a detectable state, and (5) detecting the fluorophore released in step (4).

[0011] In a preferred embodiment, steps (2) and (3) are iterated as described below to significantly increase the number of released fluorophores for detection in step (5).

[0012] Step (1) of the method of the present invention comprises generating a mononucleoside triphosphate stream from a nucleic acid analyte by progressive enzymatic digestion. In one embodiment, this can be achieved by progressive exonucleolysis of the analyte and the subsequent action of a kinase on the obtained mononucleoside monophosphate (see, e.g., Biotechnology and Bioengineering by Bao and Ryu (DOI 10.1002 / bit.21498)). However, preferably, nucleoside triphosphates are generated directly from the analyte by progressive pyrophosphorolysis. The analyte suitably used in this step is a double-stranded polynucleotide, the length of which can in principle be unlimited; for example, including up to millions of nucleotides found in human genes or chromosome fragments. However, the length of the polynucleotide is generally at least 50, preferably at least 150 nucleotide pairs; suitably, it is greater than 500, greater than 1000 and in many cases thousands of nucleotide pairs long. The analyte itself is preferably RNA or DNA of natural origin (e.g., originating from plants, animals, bacteria or viruses), although the method can also be used to sequence synthetically produced RNA or DNA, or other nucleic acids consisting entirely or partially of nucleotides whose nucleobases are not normally encountered in nature, i.e., nucleobases other than adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Examples of such nucleobases include 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2-O-methylpseudouridine, 2-O-methylguanosine, inosine, N6-isopentyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, 5-methoxyuridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 2-methylthio-N6-isopentenyladenosine, uridine-5-hydroxyacetic acid-methyl ester, uridine-5-hydroxyacetic acid, wybutoxosine, wybutosine, pseudouridine, queuosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, 2-O-methyl-5-methyluridine and 2-O-methyluridine. In the case of DNA, the mononucleoside triphosphates produced are deoxyribonucleoside triphosphates, while in the case of RNA they are ribonucleoside triphosphates.

[0013] In one embodiment of the method, step (1) also includes a first substep of attaching the analyte to a substrate. Typically, the substrate comprises a microfluidic surface, microbeads or a permeable membrane, for example, a substrate made of glass or a non-degradable polymer. Preferably, the substrate also includes a surface particularly suitable for receiving the analyte. There are many methods for attaching the analyte to such a surface, any of which can in principle be used in this substep. For example, one method involves priming a glass surface with a functionalized silane (e.g., epoxysilane, aminohydrocarbylsilane or mercaptosilane). The reactive sites so generated can then be treated with a derivative of the analyte, the derivative of the analyte being modified to include a terminal amine, a succinyl group or a thiol group.

[0014] In another embodiment of step (1), the analyte is pyrophosphorolyzed to produce a stream of mononucleoside triphosphates, the order of which corresponds to the order of the analyte sequence. This pyrophosphorolysis can be carried out at a temperature of 20-90° C.; for example, in the presence of a reaction medium comprising a suitable polymerase. Preferably, it is carried out under continuous flow conditions so that the mononucleoside triphosphates are continuously removed from the reaction zone as they are released. Most preferably, the pyrophosphorolysis is carried out by continuously flowing an aqueous buffer medium containing an enzyme and other typical additives over the surface to which the analyte is bound.

[0015] In another embodiment, the enzyme used is one that is capable of causing progressive 3'-5' pyrophosphorolytic digestion of the analyte to produce a flux of nucleoside triphosphates with high fidelity and reasonable reaction rates. Preferably, the digestion rate is as fast as possible, and in one embodiment, it is 1-50 nucleoside triphosphates per second.

[0016] Further information on pyrophosphorolysis reactions applied to polynucleotide digestion can be found, for example, in J. Biol. Chem., 244 (1969) pp. 3019-3028, to which the reader is referred. Suitably, the pyrophosphorolysis digestion is carried out in the presence of a medium which also contains, for example, pyrophosphate anions and magnesium cations; preferably in millimolar concentrations.

[0017] In step (2) of the method of the invention, at least one single nucleoside triphosphate molecule (preferably each single nucleoside triphosphate in the stream) is reacted with the probe in the presence of a polymerase and optionally a ligase to produce a probe duplex used, which in one embodiment in which a ligase is additionally used is an isolated substantially double-stranded oligonucleotide. Preferably, prior to carrying out this step, the product of step (1) is treated with a pyrophosphatase to hydrolyze any residual pyrophosphate to a phosphate anion.

[0018] The polymerase used in step (1) is suitably selected from the group consisting of those polymerases that do not substantially show exonuclease or endonuclease activity under the reaction conditions. Examples of polymerases that can be advantageously used include, but are not limited to, prokaryotic pol 1 enzymes or enzyme derivatives obtained from bacteria, such as Escherichia coli (e.g., Klenow fragment polymerase), Thermus aquaticus (e.g., Taq Pol), Bacillus stearothermophilus, Bacillus caldovelox, and Bacillus caldotenax. If desired, in principle any suitable ligase can be used in this step.

[0019] The bioprobe used in step (2) comprises two or preferably three components; (a) a first single-stranded oligonucleotide labeled with a characteristic fluorophore in an undetectable state, and (b) a second and optionally a third unlabeled single-stranded oligonucleotide, each of which is separated from the first oligonucleotide and capable of hybridizing with a complementary region on the first oligonucleotide. In a three-component embodiment, the second and third oligonucleotides are separated entities, and in another embodiment, they are oligonucleotide regions connected by a joint region. In the latter case, in one embodiment, the joint region connects the ends of the second and third oligonucleotide regions. The joint region can in principle be any divalent group, but it is conveniently another oligonucleotide region itself. In one embodiment, the oligonucleotide joint region cannot substantially hybridize with the first oligonucleotide.

[0020] The separate first, second and third oligonucleotides are selected so that in step (2), the second and third oligonucleotides can hybridize to the 3' and 5' flanking regions on the first oligonucleotide, respectively, which regions are themselves juxtaposed on either side of a restriction endonuclease recognition site comprising a capture site, the capture site comprising a single nucleotide whose nucleobase is complementary to the nucleobase carried by the nucleoside triphosphate detected by the probe. This makes the probe highly selective for that particular nucleoside triphosphate. Thus, for example, if the analyte is derived from DNA and the first, second and third oligonucleotides comprise deoxyribonucleotides, then if the capture site comprises a nucleotide bearing a thymine nucleobase, the capture site will be highly selective for deoxyadenosine triphosphate. Thus, in a useful embodiment of the invention, step (2) can be performed in the presence of a probe system comprising a plurality of probe types; for example, one, two, three, four or more probe types, each probe type comprising a first oligonucleotide having a different capture site characteristic of a set of various different nucleobases being sought and a different detectable element attached thereto.

[0021] In one embodiment, the first oligonucleotide is at least one nucleotide longer than the complementary 3 ' side flanking region of the first oligonucleotide. In another embodiment, there is at least a single nucleotide mispairing between the nucleotide relative to it on the 3 ' end of the first oligonucleotide and the second oligonucleotide, to prevent nucleoside triphosphates from being captured at this site. Similarly, in one embodiment, the 3rd oligonucleotide is at least one nucleotide longer than the complementary 5 ' side flanking region of the first oligonucleotide, and in another embodiment, there is at least a single nucleotide mispairing between the 3 ' end of the 3rd oligonucleotide and the nucleotide relative to it in the first oligonucleotide, to prevent mononucleoside triphosphates from being captured at this site.

[0022] The first oligonucleotide is characterized in that it is marked by a fluorophore region, and this fluorophore region includes a fluorophore of its own uniqueness and / or characteristic type, and these fluorophores are arranged to be substantially undetectable when the probe is in an unused state. Preferably, they are arranged to be substantially non-fluorescent at those wavelengths at which these fluorophores are designed to be detected. Therefore, although the fluorophore can show general low-level background fluorescence in most of the electromagnetic spectrum, there will usually be a specific wavelength or wavelength envelope at which one or a small amount of fluorescence intensity is maximum. At one or more of these maximums, a fluorophore that should not be substantially fluorescent can be characteristically detected. In the context of this patent, the term "substantially non-fluorescent" or equivalent wording refers to 25% of the corresponding fluorescence intensity of the free fluorophore of equal quantity, preferably less than 10%, more preferably less than 1%, and most preferably less than 0.1% of the fluorescence intensity of the fluorophore sum attached to the first oligonucleotide at a relevant characteristic wavelength or wavelength envelope.

[0023] In principle, any method can be used to ensure that in the unused state of the first oligonucleotide, the fluorophore is substantially non-fluorescent. In one embodiment, this is achieved by arranging the fluorophores in close proximity to each other so that they quench each other (self-quenching arrangement). In another embodiment, the fluorophore region also includes a separate quencher in close proximity to the fluorophore, by which the same result can be achieved. In the context of this patent, what constitutes "close proximity" between fluorophores or between fluorophores and quenchers depends on the structural features of the specific fluorophores and possible first oligonucleotides. Therefore, the term is intended to be interpreted with reference to the required results rather than any specific structural arrangement of the various components in the two regions. However, for the purpose of providing examples only, it is pointed out that sufficient quenching can generally be achieved when adjacent fluorophores are separated by a distance corresponding to the characteristic Förster distance (usually less than 5nm).

[0024] As for the fluorophores themselves, they can in principle be selected from any of those conventionally used in the art, including but not limited to xanthene moieties (e.g. fluorescein), rhodamine and its derivatives, such as fluorescein isothiocyanate, rhodamine B, etc.; coumarin moieties (e.g. hydroxy-, methyl- and aminocoumarins) and cyanine moieties, such as Cy2, Cy3, Cy5 and Cy7. Specific examples include fluorophores derived from the following commonly used dyes: Alexa dyes, cyanine dyes, Atto Tec dyes and rhodamine dyes. Examples also include: Atto 633 (ATTO-TEC GmbH), Texas Red TM 、Atto 740(ATTO-TEC GmbH)、Rose Bengal、Alexa Fluor TM 750 C5-maleimide (Invitrogen), Alexa Fluor TM 532 C2-maleimide (Invitrogen) and rhodamine red C2-maleimide and rhodamine green and phosphoramidite dyes such as Quasar 570. Alternatively, quantum dots or near-infrared dyes, such as those provided by LI-COR Biosciences, can be used and should be considered "fluorophores" for the purpose of interpreting this patent. The fluorophore is typically attached to the first oligonucleotide via a nucleobase using chemistry known in the art.

[0025] Suitable quenchers include those that function via the Förster resonance energy transfer (FRET) mechanism. Examples of commercially available quenchers that can be used in conjunction with the above fluorophores include, but are not limited to, DDQ-1, Dabcyl, Eclipse, IowaBlack FQ and RQ, IR Dye-QCl, BHQ-0, BHQ-1, -2 and -3, and QSY-7 and -21.

[0026] Another feature of the first oligonucleotide is that it is included in the exonuclease blocking site at the recognition site 3' or 5' side, depending on which one of the above two methods is adopted. In one embodiment, the first oligonucleotide can include such blocking sites near either end or both ends. In principle, the blocking site can be any region, and due to its chemical composition, this region makes the first oligonucleotide anti-nuclease exonuclease at this site. Such a region can, for example, include thiophosphate joints, oligonucleotide spacers (such as Spacer3, Spacer 9, Spacer 18, dSpacer, etc.), 2'-O-methyl RNA bases, reverse bases, desulfurization biotin-TEG, dithiol, hexanediol and quencher (such as BHQ).

[0027] In one embodiment, the exonuclease blocking site can be achieved by making the first oligonucleotide circular (i.e., closed loop). In another embodiment, the second and / or third oligonucleotide will also be provided with a similar exonuclease blocking site.

[0028] Another feature of the first oligonucleotide is that it includes a restriction endonuclease recognition site, which includes the capture site mentioned above. The recognition site is located at (1) the 5' side of the nuclease blocking site and the 3' side of the fluorophore region, or (2) the 3' side of the nuclease blocking site and the 5' side of the fluorophore region, depending on which of the above two methods is used. In one embodiment, when more than one type of first oligonucleotide is used, preferably, each differently labeled first oligonucleotide still includes the same recognition site, so that only one restriction endonuclease needs to be used. Therefore, for many applications, the recognition site preferably contains a sequence containing at least one of each characteristic nucleotide of RNA or DNA, as the case may be.

[0029] Step (2) is suitably carried out by contacting each single nucleoside triphosphate in the stream with an enzyme as described above and one or more probes at a temperature of from 20 to 80°C.

[0030] As described above, the product of step (2) is the used probe, which is generally a substantially double-stranded duplex, the components of which are (i) the first oligonucleotide and (ii) the second oligonucleotide, which has additional nucleotides derived from mononucleoside triphosphates, and (iii) the optional third oligonucleotide. When step (2) is carried out in the presence of a ligase and the third oligonucleotide, (ii) and (iii) will together include a separate fourth oligonucleotide, and the used probe will be double-stranded near the recognition site. If the second and third oligonucleotides have previously been linked together via a linker region, then it is clear that this will result in a fourth oligonucleotide that is closed-circular and highly resistant to exonucleolytic cleavage.

[0031] In step (3), the used probe is treated with a restriction endonuclease at a temperature of 20 to 100° C. In one embodiment, the restriction endonuclease is a nicking endonuclease designed to cleave only the chain derived from the first oligonucleotide at the recognition site. In another embodiment, the restriction endonuclease can be a restriction endonuclease capable of cleaving both chains, and the second and / or third oligonucleotides can be made resistant to cleavage by the restriction endonuclease, for example by including an endonuclease blocking group in one or both of the second and third oligonucleotides. In one embodiment, these blocking groups can be selected from phosphorothioate bonds and other backbone modifications, oligonucleotide spacers, phosphate groups, etc. commonly used in the art. In a third embodiment, without the use of a ligase, the restriction endonuclease is a restriction endonuclease capable of cleaving both chains and has a cleavage site on the 3' side of the captured nucleotide (i.e., retained at the nick between the second and third oligonucleotides after the capture nucleotide).

[0032] Details of suitable restriction endonucleases (including nicking endonucleases) that may be used with the methods and probes of the invention may be found in the database associated therewith at http: / / rebase.neb.com.

[0033] Step (3) results in the cleavage of the strand derived from the first oligonucleotide into two separate components, one of which carries a fluorophore and a quencher (if used). Thereafter, in step (4), this component, now susceptible to exonucleolysis, is digested with an enzyme exhibiting either 3'-5' or 5'-3' exonucleolytic activity, depending on which of the above-mentioned specific methods is to be employed. Thus, as endonucleolysis and subsequent exonucleolysis occur, the observer sees the onset and rapid growth of a fluorescent signal. The characteristics of this fluorescence then indirectly reflect the nature of the mononucleoside triphosphate initially captured by the associated probe. Step (4) can be most effectively achieved at a temperature in the range of 30 to 100°C.

[0034] In one embodiment, it is preferred that step (3) is performed at a higher temperature than step (2), and / or step (4) is performed at a higher temperature than step (3).

[0035] Thereafter, in step (5), the fluorophores released in step (4) are detected, for example, by various iterations of steps (2) and (3), and the nature of the nucleobase attached to the single nucleoside triphosphate is determined by inference. By systematically implementing the method of the present invention for all single nucleoside triphosphates in the stream produced in step (1), characteristic data of the sequence of the original nucleic acid analyte can be generated and analyzed. Methods for doing so are well known in the art, for example, the reaction medium can be examined with light from a laser or similar source of high intensity electromagnetic radiation, and any generated fluorescence can be detected using a photodetector or equivalent device tuned to the characteristic fluorescence wavelength or wavelength envelope of the various fluorophores. This in turn causes the photodetector to generate a characteristic electrical signal that can be processed and analyzed in a computer using known algorithms.

[0036] As described above, in a preferred embodiment, at the end of step (3), the second oligonucleotide with its associated capture nucleotide and optionally the third oligonucleotide, or the fourth oligonucleotide derived from the used probe (if a ligase is used) is hybridized or otherwise complexed with another corresponding first oligonucleotide molecule, thereby generating a new oligonucleotide duplex that corresponds to the original used probe, i.e., has the same chemical and physical structure. This product is then subjected to repeated steps (3), thereby releasing the additional fluorophore in a detectable state and regenerating the fourth oligonucleotide or the second oligonucleotide with the captured nucleotide and optionally the associated third oligonucleotide. In this way, it is allowed to iterate steps (2) and (3), thereby further enhancing the fluorescence signal; in principle until substantially all of the associated first oligonucleotides are consumed. In one embodiment, step (4) is performed simultaneously with each iteration of steps (2) and (3), while in another embodiment, steps (2) and (3) are first iterated to generate a plurality of nicked first oligonucleotides, and then exonucleolytic cleavage is performed simultaneously in step (4). As a result of any of these embodiments, the observer sees an enhancement of the fluorescence signal that is greater than that obtained by other means.

[0037] In a particularly preferred embodiment, the method of the invention is carried out in whole or in part in a stream of droplets, wherein at least some of the droplets contain single nucleoside triphosphates; suitably a stream whose order reflects the original nucleotide sequence of the analyte. For example, such a method may be initiated by inserting the nucleoside triphosphates produced in step (1) one by one into a corresponding stream of aqueous droplets, held in an immiscible carrier solvent (e.g., a hydrocarbon or silicone oil) to help maintain ordering. Alternatively, this may be achieved by generating the droplets directly downstream of the digestion (pyrophosphorolysis) zone; for example, by causing the reaction medium to emerge from a droplet head of appropriate size into a flowing stream of solvent. Alternatively, small aliquots of the reaction medium from step (1) may be periodically and sequentially injected into a pre-existing stream of aqueous droplets suspended in solvent. If the latter approach is adopted, each droplet may already contain the various components of the probe as well as the enzyme and any other reagents (e.g., buffer) required to achieve steps (2) to (4). In another approach, the droplets generated in the previous embodiment may then be combined with such a pre-existing stream of droplets to achieve a similar result. In these droplet methods, step (5) preferably includes transporting the droplets to a storage area and inspecting each droplet to identify the released fluorophore. Thereafter, the results obtained from each droplet are combined into a data stream of features of the original nucleic acid analyte sequence.

[0038] In order to avoid the risk that a given droplet contains more than one nucleoside triphosphate, each nucleoside triphosphate is preferably released at a rate in step (1) so that each filled droplet is evenly divided into 1-20, preferably 2-10 empty droplets. Thereafter, the filled and unfilled droplet streams in the solvent are flowed along a flow path (suitably a microfluidic flow path) at a certain rate and manner so that they remain in a separated state and have no chance to combine with each other. Suitably, the limited diameter of the droplets used is less than 100 microns, preferably less than 50 microns, more preferably less than 20 microns, and even more preferably less than 15 microns. Most preferably, their diameter is in the range of 2-20 microns. In one embodiment, the droplet flow rate through the entire system is 50-3000 droplets per second, preferably 100-2000 droplets.

[0039] In the third aspect of the present invention, a multi-component biological probe is also provided, characterized in that it includes (a) a first single-stranded oligonucleotide, which includes a nuclease exonuclease blocking site, a restriction endonuclease recognition site located on the 5' side of the blocking site and including a single nucleotide capture site for capturing a single nucleoside triphosphate, and at least one fluorophore region located on the 5' side of the recognition site and arranged to quench the fluorophore, and (b) a second and optionally a third single-stranded oligonucleotide, which is capable of hybridizing with complementary regions on the first oligonucleotide on either side of the capture site.

[0040] In one embodiment, the exonuclease blocking site is located near the 3' end of the first oligonucleotide. In another embodiment, the exonuclease blocking site is achieved by making the first oligonucleotide circular (ie, closed loop).

[0041] In the fourth aspect of the present invention, a multi-component biological probe is also provided, characterized in that it includes (a) a first single-stranded oligonucleotide, which includes a nuclease exonuclease blocking site, a restriction endonuclease recognition site located on the 3' side of the blocking site and including a single nucleotide capture site for capturing a single nucleoside triphosphate, and at least one fluorophore region located on the 3' side of the recognition site and arranged to quench the fluorophore, and (b) a second and optionally a third single-stranded oligonucleotide, which is capable of hybridizing with complementary regions on the first oligonucleotide on either side of the capture site.

[0042] In one embodiment, the exonuclease blocking site is located near the 5' end of the first oligonucleotide. In another embodiment, the exonuclease blocking site is achieved by making the first oligonucleotide circular (ie, closed loop).

[0043] Preferably, a second and a third oligonucleotide are present in both the second and the third embodiments.

[0044] In one embodiment of these third and fourth aspects, the fluorophores on the first oligonucleotide are closely arranged to each other so as to self-quench. In another embodiment, the first oligonucleotide includes a quencher to quench the fluorophore in the fluorophore region. Suitable fluorophores and quenchers include but are not limited to those mentioned above. In another embodiment, the second and third oligonucleotides are connected by a joint region as described above; the joint region itself is preferably another oligonucleotide region.

[0045] As mentioned above, for the purpose of DNA or RNA sequencing, the bioprobes described herein can be assembled into a corresponding bioprobe system, which comprises a plurality of different first oligonucleotide types, which differ only in the core base characteristics of the capture site and the fluorophore used. In one embodiment, one, two, three, four or more different first oligonucleotide types that differ only in the core base characteristics of the capture site and the fluorophore can be used. For naturally occurring DNA or RNA, these core bases comprise A, G, C and T or U. In another embodiment, the bioprobe system is presented as a test kit, which further comprises at least one of a ligase, a polymerase, a restriction endonuclease and an enzyme that exhibits 3'-5' or 5'-3' exonucleolytic activity, as the case may be.

[0046] The detection method used in the above sequencing method is also generally applicable to analyzing, characterizing or quantifying single nucleotide triphosphates in a biological sample or a nucleic acid analyte obtained therefrom by applying only steps (2) to (5) of the above method to one or each single nucleotide triphosphate component. In such additional applications, the nature of these steps (2) to (5) and the biological probes used will be appropriately as described herein.

[0047] The invention will now be illustrated with reference to the following examples.

[0048] Example 1 - Preparation and use of probe

[0049] Prepare a single-stranded first oligonucleotide 1 having the following nucleotide sequence:

[0050] 5'-GCTGTGCCGGGCTCGTGTCTCTGCGTTTCTTGFFQGTGTGCATTGCATAGGTTCACGATAX-3'

[0051] A, C, G, and T represent nucleotides with characteristic DNA-related nucleobases; F represents a deoxythymidine nucleotide (T) labeled with Atto700 dye using conventional amine ligation chemistry; Q represents a deoxythymidine nucleotide labeled with BHQ-2 quencher; and X represents an inverted 3'dT nucleotide. It also contains a capture region (A nucleotide) at the 42nd base of its 5' end (which selectively captures deoxythymidine triphosphate nucleotides (dTTPs) in a mixture of deoxynucleoside triphosphates (dNTPs)) and a recognition sequence for the nicking restriction endonuclease Nb.BsrDI, "NNCATTGC".

[0052] Another single-stranded oligonucleotide 2 (which contains an oligonucleotide region having a sequence complementary to the 3' region flanking the capture site of the first oligonucleotide) and single-stranded oligonucleotide 3 (which contains an oligonucleotide region having a sequence complementary to the 5' region flanking the capture site of the first oligonucleotide and having a single base mismatch, a 5' phosphate group and a 3' inverted dT nucleotide region) were also prepared. They have the following nucleotide sequences:

[0053] Oligonucleotide 2: 5'-CGTGAACCTATGCAA-3'

[0054] Oligonucleotide 3: 5'-PGCGAACGTAAAATGTCATGGX-3'

[0055] Where P represents the 5' phosphate group and X represents the inverted 3' dT nucleotide.

[0056] A reaction mixture containing the probe is then prepared. It has ingredients corresponding to those derived from the following recipe:

[0057] 20uL 5x buffer pH 8.0

[0058] 10uL Oligonucleotide 1, 100 nM

[0059] 10uL Oligonucleotide 2, 10 nM

[0060] 10uL Oligonucleotide 3, 1000 nM

[0061] 10uL spermine solution, 10mM

[0062] 10 U Nb.BsrDI nicking endonuclease (e.g., New England Biolabs Inc.)

[0063] 3.5U E. coli ligase

[0064] 2.9U Bst large fragment polymerase

[0065] 2.7U Platinum Pfx polymerase

[0066] 6.7U Thermostable Inorganic Pyrophosphatase

[0067] 10uL mixture of dNTPs, 0.25 nM

[0068] Add water to 100uL

[0069] The 5x buffer contains the following mixture:

[0070] 25uL Trizma Acetate, 1M, pH 8.0

[0071] 50uL magnesium acetate aqueous solution, 1M

[0072] 25uL potassium acetate aqueous solution, 1M

[0073] 50uL Triton X-100 surfactant (10%)

[0074] 500µg BSA

[0075] Add water to 1ml

[0076] The capture of dTTP and the ligation of oligonucleotide 2 to oligonucleotide 3 to form the used probe are then performed by incubating the mixture at 37°C for 10 minutes, and then the temperature is raised to 56°C for 120 minutes to allow iterative cleavage of the first oligonucleotide. The temperature is then raised to 72°C for 15 minutes to digest the cleaved first oligonucleotide components with the fluorophore and quencher. As the reaction proceeds, the fluorescence intensity of the Atto700 dye in the reaction mixture is measured using a CLARIOStar microplate reader (e.g., BMG Labtech).

[0077] The increase in fluorescence intensity during the final 15-min digestion step was monitored in the presence and absence of the dNTP component of the reaction. Figure 1 As shown. It can be seen that the probe can effectively capture dTTP, and the cyclic nature of the method of the present invention leads to a rapid increase in the fluorescence signal. In contrast, in the comparative experiment (no dNTPs in the reaction mixture), the Atto700 dye on oligonucleotide 1 did not show any significant degree of fluorescence.

[0078] Example 2 - Droplet microfluidics method using probes

[0079] Figure 2 A microfluidic sequencing device is schematically shown, in which each droplet containing a single nucleotide base is reacted with a probe of the type described above.

[0080] An aqueous medium 1 containing a stream of mononucleotide triphosphates obtained by progressive pyrophosphorolysis of a 100 nucleotide base polynucleotide analyte derived from human DNA is flowed through a 10 micrometer diameter microfluidic tube made of PDMS polymer. The pyrophosphorolysis reaction itself is carried out by passing an aqueous and buffered (pH 7.5) reaction medium at 72°C, which contains Bst polymerase and a solution of sodium pyrophosphate and magnesium chloride at a concentration of 2 millimolar per liter, over glass microbeads to which the analyte has been previously attached via succinyl bridges. The order of the individual nucleotides in 1 downstream of the microbead corresponds to the sequence of the analyte. 1 emerges from the droplet head 2 into a first chamber 3, where it comes into contact with one or more streams of immiscible light silicone oil 4. The speed of these streams is selected to avoid turbulent mixing and to produce aqueous spherical droplets 5, each approximately 8 micrometers in diameter, suspended in the oil. Typically, the rate is adjusted so that an average of 10 empty droplets are present between adjacent filled droplets. The stream of 5 is then forwarded along a second microfluidic tube of the same diameter to a second chamber 6 into which a second stream of 5 micron aqueous spherical droplets 7 is also fed through a second droplet head 8. Droplets 5 and 7 are combined in a sequential manner to form an enlarged aqueous droplet 9 of approximately 9 microns in diameter. Each 7 contains an inorganic pyrophosphatase to destroy any residual pyrophosphate anions present in each 5.

[0081] The stream of 9 is then sent at the same rate through a microfluidic tube into a third chamber 10, where these droplets come into contact with a third stream of 5 micron aqueous spherical droplets 11 fed into it through a corresponding droplet head 12. The time for each 9 to move between chambers 6 and 10 is c. 2 minutes.

[0082] Droplets 9 and 11 are then combined in 10 to produce droplets 13 (about 10 microns in diameter). Each droplet 11 contains a mesophilic ligase, a thermophilic polymerase having 3'-5' exonuclease activity, a nicking restriction endonuclease Nb.BsrDI (e.g., New England Biolabs Inc.), and a probe system, wherein the probe system comprises four sets of single-stranded oligonucleotides similar to those described in Example 1 (each having a different first oligonucleotide labeled with a different fluorophore as described above).

[0083] The stream of bound droplets 13 thus formed is then incubated at 37° C. for 10 minutes, then at 56° C. for 120 minutes and then at 72° C. for 15 minutes. At the end of this time, 13 is transferred to a detection system 14 .

[0084] The detection system (not shown) typically includes a detection window where each droplet is examined with incident light from a laser. The action of this light then causes the released fluorophores in each droplet to fluoresce in a manner characteristic of the single nucleotide bases that were initially incorporated into the intact probe (or substantially entirely if the droplet was initially empty). The presence or absence of fluorescence is then detected at four characteristic wavelengths for the four fluorophores associated with the four oligonucleotide sets described above. Thus, as the droplets are examined sequentially, the sequence of nucleotide bases in the original polynucleotide analyte can be effectively read out.

Claims

1. A multi-component biological probe for capturing a single nucleoside triphosphate, the probe being characterized in that it comprises (a) a first single-stranded oligonucleotide comprising a nuclease blocking site, a restriction endonuclease recognition site located 5' to the blocking site and comprising a single nucleotide capture site, and at least one fluorophore region located 5' to the recognition site and arranged to quench the fluorophore, and (b) a separated second and optionally a separated third single-stranded oligonucleotide capable of hybridizing to complementary regions on the first oligonucleotide located on either side of the capture site.

2. The multi-component biological probe according to claim 1, characterized in that: The exonuclease blocking site is achieved by making the first oligonucleotide a closed circle.

3. The multi-component biological probe according to claim 1 or 2, characterized in that: The first oligonucleotide comprises a quencher to quench the fluorophore in the fluorophore region and / or the second oligonucleotide and the third oligonucleotide are connected via an oligonucleotide linker region.

4. Multi-component biological probe, characterized in that The invention comprises (a) a first single-stranded oligonucleotide comprising a nuclease exonuclease blocking site, a restriction endonuclease recognition site located 3' to the blocking site and comprising a single nucleotide capture site for capturing a single nucleoside triphosphate, and at least one fluorophore region located 3' to the recognition site and arranged to quench the fluorophore, and (b) a separate second and optionally a separate third single-stranded oligonucleotide capable of hybridizing to complementary regions on the first oligonucleotide located on either side of the capture site.

5. The multi-component biological probe according to claim 4, characterized in that: The exonuclease blocking site is achieved by making the first oligonucleotide a closed circle.

6. The multi-component biological probe according to claim 4 or claim 5, characterized in that: The first oligonucleotide comprises a quencher to quench the fluorophore in the fluorophore region, and / or the second oligonucleotide and the third oligonucleotide are connected via an oligonucleotide linker region.

7. A multi-component biological probe kit, characterized in that A combination comprising a plurality of different types of first oligonucleotides according to any one of claims 1 to 6, each first oligonucleotide in the combination having a different capture site selective for a different characteristic nucleobase and a different characteristic fluorophore.

8. The multi-component biological probe kit according to claim 7, characterized in that: The first oligonucleotide is of the type described in any one of claims 1 to 3, comprises a third oligonucleotide, and the kit further comprises one or more of a polymerase, a ligase, a restriction endonuclease, and an enzyme having 3'-5' exonucleolytic activity.

9. The multi-component biological probe kit according to claim 7, characterized in that: The first oligonucleotide is of the type described in any one of claims 1 to 3, comprises a third oligonucleotide, and the kit further comprises one or more of a polymerase, a ligase, a restriction endonuclease, and an enzyme having 5'-3' exonucleolytic activity.

10. A method for analyzing, characterizing or quantifying the nucleotide triphosphate composition of a biological sample or nucleic acid analyte, comprising the following steps: (2) generating at least one used oligonucleotide probe by reacting at least one single nucleoside triphosphate with a corresponding biological probe in the presence of a polymerase, the corresponding biological probe comprising (a) a first single-stranded oligonucleotide comprising an exonuclease blocking site, a restriction endonuclease recognition site located 5' to the blocking site and comprising a single nucleotide capture site for capturing the single nucleoside triphosphate, and at least one fluorophore region located 5' to the recognition site comprising a fluorophore arranged so that the fluorophore is quenched, wherein the fluorophores are arranged in close proximity to each other for self-quenching, or wherein the at least one fluorophore region further comprises a quencher configured to quench the fluorophore, and (b) second and third single-stranded oligonucleotides, which are separated from the first oligonucleotide and are capable of hybridizing to complementary regions on the first oligonucleotide located 3' and 5' to the capture site, respectively; (3) cleaving the first oligonucleotide chain of the used probe at the recognition site with a restriction endonuclease to generate a first oligonucleotide component carrying the fluorophore; (4) digesting the first oligonucleotide component with an enzyme having 3'-5' exonucleolytic activity to produce a fluorophore in a detectable state, and (5) detecting the fluorophore released in step (4); wherein the restriction endonuclease is a nicking endonuclease adapted to cleave only the first oligonucleotide; and Therein, steps (2) and (3) are iterated, and after said iterations, step (4) is performed.

11. The method according to claim 10, wherein: Step (2) is performed in the presence of a ligase to produce a substantially double-stranded used probe near the recognition site.

12. The method according to claim 10, characterized in that The exonuclease blocking site is achieved by making the first oligonucleotide a closed circle or by including a double stranded region therein.

13. The method according to any one of claims 10 to 12, wherein: The second oligonucleotide and the third oligonucleotide are connected by a linker region.

14. The method according to any one of claims 10 to 12, wherein: The second and / or third oligonucleotide is resistant to cleavage by the restriction endonuclease.

15. The method according to claim 10, wherein: The at least one fluorophore region includes a quencher to quench the fluorophore.

16. The method according to claim 10, wherein: Step (3) is carried out at a higher temperature than step (2), and / or step (4) is carried out at a higher temperature than step (3).

17. The method according to claim 10, wherein: The probe comprises a system of up to four different first oligonucleotide types, each type of oligonucleotide having a different capture site selective for one of the different characteristic nucleobases of naturally occurring or synthetic DNA or RNA and a different characteristic fluorophore.

18. The method according to claim 10, wherein: Step (1) further comprises containing each single nucleoside triphosphate in a corresponding droplet, and performing steps (2) to (5) in each droplet.

Images