A specific TCR molecule targeting liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex, TCR-T cell, and preparation and application thereof
By screening and preparing specific TCR molecules targeting alpha-fetoprotein antigen peptides and HLA-A24 complexes of hepatocellular carcinoma cells, TCR11-T cells were prepared, which solved the treatment problems of advanced hepatocellular carcinoma patients and achieved efficient killing and personalized treatment of alpha-fetoprotein-expressing liver cancer cells.
Patent Information
- Application Number
- CN202411841485.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-13
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2044-12-13
AI Technical Summary
The existing clinical treatment methods are difficult to meet the needs of patients with advanced hepatocellular carcinoma, and it is necessary to develop more effective immunotherapy methods, especially specific killing methods for liver cancer cells expressing alpha-fetoprotein.
Through multiomics machine learning, specific TCR molecules targeting alpha-fetoprotein antigen peptides and HLA-A24 complex were screened, TCR11-T cells were prepared, and in vitro cell co-culture killing system was verified to establish a personalized TCR-T cell therapy technology.
It has achieved efficient and specific killing of liver cancer cells with high alpha-fetoprotein expression, provided a personalized and precise treatment strategy, and is scalable, suitable for liver cancer treatment in different patients.
Smart Images

Figure CN119613530B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of genetic engineering and immunotechnology, and more specifically to a specific TCR molecule and TCR-T cell targeting a liver cancer cell alpha-fetoprotein antigen peptide and an HLA-A24 complex, as well as their preparation and application. Background Art
[0002] Liver cancer is the sixth most common cancer worldwide and the fourth leading cause of cancer-related deaths, with more than 750,000 deaths worldwide each year. The pathophysiology of liver cancer is a complex multi-step process. The malignant transformation of liver cells caused by the interaction of various factors is the early stage of liver cancer development. Liver cancer cells that have undergone malignant transformation will show some abnormal expression indicators, such as a significant increase in alpha-fetoprotein. Serological tests can usually detect high levels of expression of related indicators in a timely manner. Currently, the treatment of liver cancer is mainly based on tumor staging and expected benefits. Surgical resection, liver transplantation and local ablation are usually the first choice for patients with early-stage liver cancer. Interventional therapy is the first choice for patients in the middle stage, while patients in the late stage receive direct systemic treatment.
[0003] However, current clinical treatments are still unable to achieve ideal results for patients with advanced hepatocellular carcinoma. Therefore, new and more effective clinical treatments still need to be continuously studied. Among them, the effective application of T cell receptor genetically engineered T cells, namely TCR-modified T cells (TCR-T) therapy in solid tumors is considered to be one of the most promising immunotherapy methods. Studies have reported that TCR-T transduced by a natural high-affinity TCR targeting the HBsAg epitope peptide S20-28 presented by HLA-A2 is effective and safe for people with hepatocellular carcinoma.
[0004] Therefore, screening effective hepatocellular carcinoma-specific TCRs and creating TCR-T cells for killing hepatocellular carcinoma is a promising direction for anti-tumor immunotherapy. Tumor-specific TCRs screened from tumor tissue can specifically bind to tumor cells that abnormally express tumor-associated antigens, and the transduced TCR-T cells can thereby induce T cells to kill tumor cells. Based on the above analysis, multi-omics machine learning can be used to screen hepatocellular carcinoma alpha-fetoprotein-specific TCR11 and prepare TCR11-T. In vitro cell co-culture killing system can be used to verify the killing of hepatocellular carcinoma-specific TCR11-T cells against specific liver cancer cell lines. Summary of the Invention
[0005] The present invention uses multi-omics machine learning to screen TCR (TCR11)-specific TCR targeting hepatocellular carcinoma antigen-alpha-fetoprotein, prepares TCR11-modified T cells (TCR11-T), and verifies the killing of hepatocellular carcinoma-specific TCR11-T cells against specific liver cancer cell lines in an in vitro cell co-culture killing system, thereby establishing a personalized TCR-T cell therapy technology for identifying liver cancer tumor cells, thereby achieving the purpose of tumor treatment.
[0006] According to a first aspect of the present invention, a specific TCR molecule targeting a complex of an alpha-fetoprotein antigen peptide of a liver cancer cell and HLA-A24 is provided, wherein the specific TCR molecule comprises an α chain and a β chain, wherein the sequence of the α chain is shown in SEQ ID NO: 1, and the sequence of the β chain is shown in SEQ ID NO: 2;
[0007] The TCR molecule can specifically bind to the complex of alpha-fetoprotein and HLA-A24, and can specifically kill liver cancer tumor cells expressing the complex.
[0008] According to another aspect of the present invention, a TCR-T cell is provided, wherein the TCR-T cell contains the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex.
[0009] Preferably, the T cells of the TCR-T cells are selected from CD8 + T cells, CD4 + T cells, NKT cells, or MAIT cells.
[0010] According to another aspect of the present invention, a method for screening specific TCR molecules targeting the complex of liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 is provided, comprising the following steps:
[0011] (1) Based on the single-cell transcriptome sequencing results of liver cancer tissue and adjacent tissue, single-cell transcriptome analysis was performed. First, dimensionality reduction analysis was used to determine the clustering of cancer tissue, adjacent tissue, and peripheral blood cells. Then, TCR enrichment analysis was performed to extract TCRs with an enrichment number of more than 20 to obtain tumor-enriched TCRs.
[0012] (2) Screening out antigenic peptide sequences of liver cancer tumor-associated antigens;
[0013] (3) Obtain transcriptome data of liver cancer tumor samples, select chromosomes for genomic alignment, and determine the HLA typing results of liver cancer tumor samples;
[0014] (4) Based on the affinity between the MHC molecules obtained in step (3) and the antigen peptides of the liver cancer tumor cell-associated antigens obtained after screening in step (2), antigen peptide-MHC complexes capable of binding are screened and used as targets for screening tumor-specific TCRs;
[0015] (5) The antigen peptide-MHC complex screened in step (4) and the TCR molecule with the strongest tumor-enriched TCR affinity obtained in step (1) are used as specific TCR molecules targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex.
[0016] Preferably, the liver cancer tumor-associated antigens are alpha-fetoprotein-derived antigenic peptides, glypican-3-derived antigenic peptides, mucin-1-derived antigenic peptides, New York esophageal squamous cell carcinoma-1-derived antigenic peptides, and sal-like gene-4-derived antigenic peptides.
[0017] According to another aspect of the present invention, a method for preparing TCR-T cells is provided, characterized in that it comprises the following steps:
[0018] S1: Based on the TCR clustering information of the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and the HLA-A24 complex, and the transcriptome characteristic information of the liver cancer tumor sample, a T cell receptor sequence that specifically activates T cells targeting the liver cancer tumor cell alpha-fetoprotein is obtained; then, the base sequence corresponding to the T cell receptor sequence information is obtained, the base sequence is assembled into a lentiviral vector, and sequence ligation is performed to terminate with a stop codon to obtain a specific TCR receptor vector plasmid targeting the liver cancer cell alpha-fetoprotein antigen peptide and the HLA-A24 complex;
[0019] S2: The tool cells are inoculated into a culture dish and cultured overnight. The plasmid obtained in step S1 and the lentiviral packaging helper plasmid are co-transfected into the tool cells using a liposome transfection reagent. After culture, the viral supernatant is collected, filtered through a filter membrane, and concentrated by ultrafiltration centrifugation to obtain concentrated lentivirus;
[0020] S3: The concentrated lentivirus obtained in step S2 is transfected into target cells to obtain TCR-T cells.
[0021] According to another aspect of the present invention, there is provided the use of the specific TCR molecule targeting the complex of liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 in the preparation of a drug for treating liver cancer.
[0022] According to another aspect of the present invention, there is provided the use of the TCR-T cells in the preparation of drugs for treating liver cancer.
[0023] In general, the above technical solutions conceived by the present invention have the following technical advantages compared with the existing technology:
[0024] (1) The present invention uses single-cell transcriptome data to perform deep machine learning to ensure the representativeness and accuracy of the screening results. This study combines single-cell transcriptome sequencing analysis of hepatocellular carcinoma with TCR immunogenomic analysis, MHC phenotypic analysis, antigen peptide-MHC affinity, and TCR-antigen peptide-MHC binding analysis to conduct deep machine learning combined with multi-omics algorithms, providing a solid theoretical and technical foundation for the accurate screening of hepatocellular carcinoma tumor-specific TCRs.
[0025] (2) The TCR11-T of the present invention has high killing ability against HLA-A24(+) tumor cell lines that highly express alpha-fetoprotein. The in vitro cell killing experiment verified that the TCR11-T screened and transduced in vitro has high killing ability and specificity against the HLA-A24(+) human liver cancer cell line that highly expresses alpha-fetoprotein. (3) The present invention establishes a precise treatment strategy based on patient personalization. The individualized single-cell transcriptome data analysis of the present invention enables the screening of TCRs with specific individual immunogenicity.
[0026] (4) The present invention is scalable. The system has the ability to kill cells from hepatocellular carcinoma patients that express specific MHC molecules and highly express alpha-fetoprotein. Therefore, the screened TCRs can provide a reference for the preparation of anti-tumor immunotherapy for other liver cancer patients that have the same MHC molecules and highly express alpha-fetoprotein. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Flowchart for the screening and validation of specific TCR sequences targeting the complex of hepatocellular carcinoma cell alpha-fetoprotein antigen peptide and HLA-A24.
[0028] Figure 2 TCR enrichment analysis for hepatocellular carcinoma.
[0029] Figure 3 This is a flow cytometric identification diagram of T cells transduced with alpha-fetoprotein antigen peptide and HLA-A24 complex-specific TCR11 in vitro.
[0030] Figure 4 The results are flow cytometric analysis of in vitro killing of hepatocellular carcinoma cell by TCR11 specific to the complex of alpha-fetoprotein antigen peptide and HLA-A24. DETAILED DESCRIPTION
[0031] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely for the purpose of explaining the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.
[0032] The present invention provides a specific TCR molecule, a TCR-T cell, and a preparation and application thereof targeting a liver cancer cell alpha-fetoprotein antigen peptide and an HLA-A24 complex, comprising the following steps:
[0033] 1. Single-cell transcriptome sequencing of tumor specimens and adjacent adjacent specimens
[0034] Cancer tissues and adjacent tissues from patients with hepatocellular carcinoma were collected. Tumor-enriched TCRs were obtained by single-cell transcriptome sequencing combined with TCR analysis. Bioinformatics analysis was used to screen the affinity between TCRs and hepatocellular carcinoma tumor antigen peptide-MHC complexes.
[0035] 1.1 Single-cell transcriptome analysis to obtain tumor-enriched TCRs;
[0036] 1.2 Analysis of hepatocellular carcinoma tumor-associated antigens and tumor-specific antigen peptides;
[0037] 1.3 HLA typing results of patient specimens;
[0038] 1.4 Comparison of the affinity of tumor-associated and tumor-specific antigens for the patient's MHC molecules;
[0039] 1.5 Comparison of affinity between antigen peptide-MHC molecule complex and tumor-enriched TCR.
[0040] 2. In vitro transduction of liver cancer-specific TCR11 into T cells to prepare TCR11-T cells
[0041] 2.1 TCR11 light chain and heavy chain splicing and gene synthesis;
[0042] 2.2 Lentiviral packaging and identification;
[0043] 2.3 Lentiviral transduction and TCR11 expression identification.
[0044] 3. In vitro killing validation experiment of specific TCR11-T targeting liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex
[0045] 3.1 Identification of alpha-fetoprotein levels in tumor cell lines;
[0046] 3.2 Identification of HLA-A24 expression in tumor cell lines;
[0047] 3.3 CFSE labeling and staining of target cells;
[0048] 3.4 In vitro killing experiment of TCR11-T cells transduced by lentivirus.
[0049] The preparation and application of the specific TCR molecules and TCR-T cells targeting the complex of alpha-fetoprotein antigen peptide and HLA-A24 of liver cancer cells of the present invention specifically include the following steps:
[0050] 1. Single-cell transcriptome sequencing of tumor specimens and adjacent adjacent specimens
[0051] 1.1 Single-cell transcriptome analysis to obtain tumor-enriched TCRs:
[0052] Single-cell transcriptome sequencing results of five pairs of hepatocellular carcinoma tissues and adjacent tissues were downloaded from the public database GSE98638. Single-cell transcriptome analysis was performed using R language. First, dimensionality reduction analysis was performed to determine the clustering of cancer tissues, adjacent tissues, and peripheral blood cells. Next, TCR enrichment analysis was performed, and TCRs with an enrichment count exceeding 20 were extracted and mapped in the dimensionality reduction analysis graph to obtain tissue information of the enriched TCRs, as well as T cell population information and T cell receptor sequence information.
[0053] 1.2 Analysis of Hepatocellular Carcinoma Tumor-Associated Antigens and Tumor-Specific Antigen Peptides:
[0054] Related information on hepatocellular carcinoma tumor-associated antigen peptide sequences was screened out from existing and databases, including 20 alpha-fetoprotein-derived antigen peptides, 23 phosphatidylinositol proteoglycan-3-derived antigen peptides, 2 mucin-1-derived antigen peptides, 26 New York esophageal squamous cell carcinoma-1-derived antigen peptides, and 7 sal-like gene-4-derived antigen peptides.
[0055] 1.3 HLA typing results of patient specimens:
[0056] The transcriptome data of the selected patient tumor samples were obtained, and the major chromosomes were selected for genome alignment using Python to determine the patient's HLA typing results.
[0057] 1.4 Comparison of the affinity of tumor-associated antigens and tumor-specific antigens to patients’ MHC molecules:
[0058] The NetMHCpan server was used to predict the affinity of the patient MHC molecules obtained in 1.3 and the hepatocellular carcinoma tumor-associated antigens and tumor-specific antigen peptides obtained after screening in 1.2. Based on the affinity score, antigen peptide-MHC complexes with high binding affinity (with affinity less than 500nM) were screened and used as targets for screening tumor-specific TCRs.
[0059] 1.5 Comparison of affinity between antigen peptide-MHC molecule complex and tumor-enriched TCR:
[0060] Based on the premise of high-affinity binding of the antigen peptide-MHC complex, we screened TCR sequences that can recognize and bind to the complex with high affinity. The pMTnet server was used to predict the affinity between the antigen peptide-MHC complex screened by 1.4 and the TCR enriched by 1.1. This resulted in a candidate TCR for hepatocellular carcinoma tumor-specific killing, TCR11, and the antigen peptide-MHC molecule complex with the highest affinity binding to it, AFP and HLA-A24.
[0061] 2. In vitro transduction of liver cancer-specific TCR11 into T cells
[0062] 2.1 TCR11 light chain and heavy chain splicing and gene synthesis:
[0063] By querying the TCR group information and T cell receptor sequence information of TCR11 in 1.1 and the transcriptome feature information of the corresponding patient in 1.3, a potential T cell receptor sequence targeting hepatocellular carcinoma alpha-fetoprotein-specific activated T cells was obtained. The base sequence corresponding to the above T cell receptor sequence information was obtained from the IMGT database (human TCR database), and the TCR α chain sequence (SEQ ID NO: 1) was obtained by online identification and alignment:
[0064] ATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAACCCGTGGAAATTCAGTGACCCAGATGGAAGGGCCAGTGACTCTCTCAGAAGAGGCCTTCCTGACTATAAACTGCACGTACACAGCCACAGGATACCCTTCCCTTTTCTGGTATGTCCAATATCCTGGAGAAGGTCTACAGCTCCTCCTGAAAGCCACGAAGGCTGATGACAAGGGAAGCAACAAAGGTTTTGAAGCCACATACCGTAAAGAAACCACTTCTTTCCACTTGGAGAAAGGCTCAGTTCAAGTGTCAGACTCAGCGGTGTACTTCTGTGCCCTGAGGTTCCCCAATGCTGGTGGTACTAGCTATGGAAAGCTGACATTTGGACAAGGGACCATCTTGACTGTCCATCCAAATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGC
[0065] TCR β-chain sequence (SEQ ID NO:2):
[0066] ATGCTGCTGCTTCTGCTGCTTCTGGGGCCAGGTATAAGCCTCCTTCTACCTGGGAGCTTGGCAGGCTCCGGGCTTGGTGCTGTCGTCTCTCAACATCCGAGCTGGGTTATCTGTAAGAGTGGAACCTCTGTGAAGATCGAGTGCCGTTCCCTGGACTTTCAGGCCACAACTATGTTTTGGTATCGTCAGTTCCCGAAACAGAGTCTCATGCTGATGGCAACTTCCAATGAGGGCTCCAAGGCCACATACGAGCAAGGCGTCGAGAAGGACAAGTTTCTCATCAACCATGCAAGCCTGACCTTGTCCACTCTGACAGTGACCAGTGCCCATCCTGAAGACAGCAGCTTCTACATCTGCAGCGCCAGCCCCGAGGGCCTGGGCCTGTATGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGTTGTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAGGCCACACTGGTGTGCCTGGCCACAGGCTTCTTCCCCGACCACGTGGAGCTGAGCTGGTGGGTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACGGACCCGCAGCCCCTCAAGGAGCAGCCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTCTGGCAGAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAGAGCAGACTGTGGCTTTACCTCGGTGTCCTACCAGCAAGGGGTCCTGTCTGCCACCATCCTCTATGAGATCCTGCTAGGGAAGGCCACCCTGTATGCTGTGCTGGTCAGCGCCCTTGTGTTGATGGCCATGGTCAAGAGAAAGGATTT
[0067] The obtained α chain and β chain sequences of the above-mentioned reactive TCR were assembled into a lentiviral vector, connected through the P2A sequence, and ended with a stop codon to obtain a successful construction of a specific TCR receptor vector plasmid targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex (this step was synthesized by the company).
[0068] 2.2 Lentiviral packaging and concentration:
[0069] 293T cells were inoculated into 10 cm culture dishes and cultured overnight. The core plasmid carrying the full TCR11 sequence and two lentiviral packaging helper plasmids (PMD2.0G and PSPAX2) were co-transfected into 293T tool cells using liposome transfection reagent. After 3 days of culture, the viral supernatant was collected, filtered through a 0.45 μm filter membrane, and concentrated by ultrafiltration centrifugation. The resulting virus was named TCR11-lentivirus, aliquoted, and stored in a -80°C refrigerator for later use.
[0070] 2.3 Lentiviral transduction and TCR11 expression identification:
[0071] Jurkat 76 cell lines were used as target cells for viral transduction. Control virus and TCR11 virus were used to infect Jurkat 76 cell lines, respectively. A viral infection gradient was set to obtain the optimal infection system. Fresh culture medium was replaced 2 days after infection. 3 days after infection, the expression of T cell marker CD3 signals in target cells was detected by flow cytometry to determine whether viral infection was successful. The negative control was Jurkat 76 cell lines transfected with control virus. The results showed that more than 80% of T cell marker CD3 positive signals were detected only in the cell lines transfected with TCR11-lentivirus.
[0072] 3. In vitro killing validation experiment of specific TCR11-T targeting liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex
[0073] The cell line HepG2 (MHC molecule is HLA-A24 positive) with high expression of alpha-fetoprotein, the cell line HLF (MHC molecule is HLA-A24 positive) with low expression of alpha-fetoprotein, and the H1299 cell line (MHC molecule is HLA-A24 negative) were selected to verify the specific recognition of TCR11-T for specific AFP and HLA-A24 and the killing of target cells expressing the corresponding molecules.
[0074] 3.1 Identification of alpha-fetoprotein levels in tumor cell lines:
[0075] 1*10 of each of the three tumor cell lines 6The cells were lysed at room temperature with 1ml of Trizol reagent, shaken with 200µl of chloroform for 15 seconds, and placed on ice for 10 minutes before high-speed centrifugation. The upper extract layer was aspirated and added with 400µl of isopropanol. The cells were placed on ice for 10 minutes before high-speed centrifugation. The precipitate was cleared twice with 75% ethanol, air-dried at room temperature, and the RNA pellet was dissolved in enzyme-free water. Reverse transcriptase was used to convert the RNA into cDNA. The α-fetoprotein gene fragment was amplified using SYBR template and compared. The results showed that HepG2 expressed significantly higher α-fetoprotein levels than the other two cell lines.
[0076] 3.2 Identification of HLA-A24 Expression in Tumor Cell Lines:
[0077] 1*10 of each of the three tumor cell lines 6 Proteinase K was added for digestion and protein degradation, followed by phenol and chloroform extraction, and ethanol precipitation to obtain genomic DNA from the cell lines. PCR amplification of the HLA-A24 molecule confirmed that the HepG2 and HLF cell lines were HLA-A24-positive, while the H1299 cell line was HLA-A24-negative.
[0078] 3.3 CFSE labeling and staining of target cells:
[0079] Three tumor cell lines (i.e., HepG2, H1299, and HLF cell lines) were labeled with CFSE staining solution and stained in a cell culture incubator at 37°C for 20 minutes. FBS was added at half the volume of the suspension to terminate the staining. After washing twice with PBS, the cells were resuspended in 1640 medium containing 10% FBS.
[0080] 3.4 Lentiviral transduction of TCR11-T in vitro killing experiment:
[0081] CFSE-stained target cells and the prepared TCR11-T cell line were added to each 96-well plate at a ratio of 1:10. After co-culture for 24 hours, the cells were centrifuged and stained with propidium iodide. Flow cytometry was used to detect the killing of CFSE-positive cell populations (i.e., tumor cell lines). The results showed that the HepG2 tumor cell line, which was HLA-A24 positive and highly expressed alpha-fetoprotein, showed a significant killing-positive population, while the HLF cell line, which was HLA-A24 positive and lowly expressed alpha-fetoprotein, showed only a lower killing-positive population. No significant killing-positive population was observed in the HLA-A24-negative H1299 cell line.
[0082] It will be easily understood by those skilled in the art that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A specific TCR molecule, characterized in that: The specific TCR molecule contains an α chain and a β chain, the sequence encoding the α chain is shown in SEQ ID NO: 1, and the sequence encoding the β chain is shown in SEQ ID NO: 2; The TCR molecule can specifically bind to the complex of alpha-fetoprotein and HLA-A24, and can specifically kill liver cancer tumor cells expressing the complex.
2. A TCR-T cell, characterized in that The TCR-T cell contains the specific TCR molecule according to claim 1.
3. The TCR-T cell according to claim 2, wherein The T cells of the TCR-T cells are selected from CD8 + T cells, CD4 + T cells, NKT cells, or MAIT cells.
4. Use of the specific TCR molecule according to claim 1 in the preparation of a drug for treating liver cancer.
5. Use of the TCR-T cell according to claim 2 or 3 in the preparation of a drug for treating liver cancer.
Citation Information
Patent Citations
T cell receptor (TCR) capable of identifying alpha fetoprotein (AFP) antigen
CN110407927A
High-affinity T-cell receptor for AFP antigen recognition
RU2021108169A