Application of sodium tanshinone IIA sulfonate in preparation of anti-PEDV (Porcine Epidemic Diarrhea Virus) product

Abstract

The invention discloses application of sodium tanshinone IIA sulfonate in preparation of anti-PEDV (porcine epidemic diarrhea virus) products, and belongs to the technical field of biology. According to the application disclosed by the invention, 2320 compounds are screened, and the tanshinone IIA sodium sulfonate is found to have a good inhibition effect on PEDV (Porcine Epidemic Diarrhea Virus). Tanshinone IIA sodium sulfonate with the concentration of 200 [mu] M is added in the process that African green monkey kidney cells are infected with PEDV in vitro, compared with a control group, the protein expression level, the mRNA content of N genes and the virus titer of PEDVN of an experimental group with the tanshinone IIA sodium sulfonate are obviously reduced, and it is indicated that the tanshinone IIA sodium sulfonate can be used for inhibiting infection and proliferation of the porcine epidemic diarrhea virus. The invention verifies that the tanshinone IIA sodium sulfonate can effectively inhibit the PEDV proliferation and the action mechanism thereof in an in-vitro environment, and the discovery not only widens the biological characteristics of the tanshinone IIA sodium sulfonate, but also provides a powerful experimental basis for the development of the tanshinone IIA sodium sulfonate as a novel potential anti-PEDV drug.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of sodium tanshinone IIA sulfonate in preparing an anti-PEDV product. Background Art

[0002] According to the World Health Organization, porcine epidemic diarrhea virus (PEDV) is a single-stranded positive-strand RNA virus. Since its discovery in 1977, it has become one of the important pathogens affecting the pig industry. Porcine epidemic diarrhea (PED) is an acute, highly contagious enteric coronavirus infectious disease with vomiting, rapid dehydration and diarrhea as the main clinical symptoms, and a high mortality rate in piglets under 7 days of age. PEDV has a variety of transmission routes and its mutations are becoming more and more significant, so it is very difficult to prevent and control PEDV. At present, the prevention and control strategies for PED in pig farms are mainly focused on biosafety management and vaccine immunization. Because of the diversity of transmission routes, biosafety management is difficult to eliminate PEDV infection; because of the high variability of PEDV, the cross-protection performance of vaccines between different strains is poor, and it is impossible to effectively prevent and control the epidemic of PEDV. In addition, since the intestinal mucosal immune system of suckling piglets has not yet fully developed, and PEDV vaccines need to work through mucosal immunity, the clinical immune effect of vaccines is often poor. PEDV outbreaks in pig herds are frequent, and effective prevention and control strategies are urgently needed. Therefore, the development of new antiviral drugs against PEDV infection is crucial.

[0003] Studies have shown that various natural compounds, such as glycyrrhizic acid (GLY), block the infection process of PEDV by interfering with the HMGB1 / TLR4-MAPKp38 signaling pathway; hyperoside inhibits the in vitro replication of PEDV by affecting the binding of PEDVN protein to p53 and intervening in the blockade of N protein synthesis. Studies have confirmed that a variety of flavonoids have inhibitory effects on PEDV, such as flavonols and quercetin, but their inhibitory effects on PEDV at the maximum safe concentration are still poor, so it is very valuable to continue to develop flavonoids for the inhibition of PEDV. We screened out sodium tanshinone IIA sulfonate as a good candidate drug through high-throughput drug screening technology. Tanshinone IIA originates from the root of Salvia miltiorrhiza of the Lamiaceae family and is known for its powerful antibacterial properties. Its sulfonated derivative sodium tanshinone IIA sulfonate has a significant effect on the treatment of angina pectoris in clinical practice and is widely regarded as a new treatment for coronary heart disease, highlighting the safety of this drug. Finally, experiments proved that sodium tanshinone IIA sulfonate can achieve high-efficiency inhibition of PEDV. Summary of the invention

[0004] The invention provides application of sodium tanshinone IIA sulfonate in preparing an anti-PEDV product. The CAS registration number of the sodium tanshinone IIA sulfonate is 69659-80-9.

[0005] Furthermore, the product is a drug candidate.

[0006] Furthermore, the dosage form of the candidate drug is any one of powder, tablet, granule, capsule, solution, emulsion and suspension.

[0007] Furthermore, in the product, sodium tanshinone IIA sulfonate is the only active ingredient.

[0008] Furthermore, the candidate drug also contains medically acceptable excipients.

[0009] Furthermore, the application is to inhibit the proliferation of PEDV in cells.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] The present invention screened 2320 compounds and found that sodium tanshinone IIA sulfonate has a good inhibitory effect on PEDV. Tanshinone IIA is derived from the traditional Chinese medicine Danshen (the root of Danshen of the Labiatae family) and has significant antibacterial properties. Its sulfonated derivative, sodium tanshinone IIA sulfonate, has been shown to have excellent therapeutic effects on angina pectoris in clinical applications. As a new drug for the treatment of coronary heart disease, its efficacy has been widely recognized. The compound also shows biological activities such as antibacterial, anti-inflammatory, blood circulation promotion, and accelerated wound healing. It has low toxicity after long-term use and has no obvious side effects.

[0012] The present invention tests and verifies that sodium tanshinone IIA sulfonate effectively inhibits PEDV proliferation in an in vitro environment and its mechanism of action. This discovery not only broadens the biological properties of sodium tanshinone IIA sulfonate, but also provides a strong experimental basis for its development as a potential new anti-PEDV drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 High-throughput screening of anti-PEDV drugs in Example 1: (A) Screening compound pattern diagram; (B) Cell activity of each compound in the first round of screening; (C) Compound screening result diagram.

[0014] Figure 2The CC50 and IC50 determination results of sodium tanshinone IIA sulfonate in Example 1 are as follows: (A) the CC50 determination results of sodium tanshinone IIA sulfonate on Vero E6 cells; (B) the CC50 determination results of sodium tanshinone IIA sulfonate on PK1 cells; (C) the IC50 determination results of sodium tanshinone IIA sulfonate on Vero E6 cells; (D) the IC50 determination results of sodium tanshinone IIA sulfonate on PK1 cells.

[0015] Figure 3 The inhibitory effects of different concentrations of sodium tanshinone IIA sulfonate on PEDV in Example 1: (A) TCID 50 Determination of virus titer; (B) RT-qPCR determination of PEDVN gene mRNA level; (C) IFA determination of PEDV-specific fluorescence in cells; (D) WB determination of PEDVN protein expression level in Vero E6 cells; (E) WB determination of PEDVN protein expression level in PK1 cells.

[0016] Figure 4 The life cycle of sodium tanshinone IIA sulfonate acting on PEDV in Example 1: (A) TCID 50 Determination of the killing effect of sodium tanshinone IIA sulfonate on PEDV; (B) Schematic diagram of drug addition time points; (C) TCID 50 The virus titer at different time points was measured; (D) RT-qPCR was used to measure the mRNA level of the PEDVN gene at different time points.

[0017] Figure 5 The target of sodium tanshinone IIA sulfonate on PEDV in Example 1: (A) sodium tanshinone IIA sulfonate and PEDV M pro Molecular docking results; (B) GC376 and PEDV M pro Molecular docking result diagram; (C)M pro Fluorescence activity measurement results. DETAILED DESCRIPTION

[0018] The experimental methods and detection methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials are commercially available unless otherwise specified.

[0019] Example 1

[0020] 1. Materials and Methods

[0021] 1.1 Cells and viruses

[0022] Vero cells are maintained by our laboratory. PEDV 0818 strain passaged in Vero cells is maintained by our laboratory.

[0023] 1.2 Main Reagents

[0024] The L1021 Discovery Probe FDA-approved Drug Library for drug screening was purchased from Selleck; Tanshinone IIA sulfonate sodium for in vitro experiments was purchased from Yuanye Company with a purity of >99%. GAPDH monoclonal antibodies were purchased from Proteintech (China); Alexa 594-labeled goat anti-mouse antibody and HRP-conjugated AffiniPure goat anti-mouse IgG (H+L) were also from Proteintech. The specific monoclonal antibody against PEDVN protein was provided by Qianxun Biotechnology Co., Ltd., China. Reverse transcription kit and SYBR were purchased from Novozymes.

[0025] 3. Determination of CC50 and IC50

[0026] The toxic effect of sodium tanshinone IIA sulfonate on Vero E6 cells was evaluated using an MTT kit. During the experiment, the cells were first evenly spread in a 96-well plate and placed in an incubator for overnight culture to ensure that the cells formed a dense monolayer. Subsequently, the cells were washed three times with sterile PBS to remove impurities in the culture medium. Next, the cells in the wells were treated with sodium tanshinone IIA sulfonate at a concentration of 0-1000 μM and placed in an incubator for 48 hours. The culture medium was then discarded, gently washed three times with sterile PBS, and 110 μL of MTT solution (10 μM TT and 100 μL cell maintenance solution) was added to each well. The well plate was returned to a constant temperature incubator at 37°C and 5% carbon dioxide for incubation for 4 hours. Finally, the liquid in the well was discarded, 100 μL of DMSO was added to each well, incubated in a 37°C, 5% carbon dioxide incubator for 15 minutes, and the absorbance value of each well was accurately measured using an enzyme reader at a specific wavelength of 490 nm. Three replicates were performed for each well. One hour after the PEDV infection, the cells were treated with 0-200 μM sodium tanshinone IIA sulfonate. The half inhibitory concentration of sodium tanshinone IIA sulfonate on Vero E6 cells and PK1 cells was measured according to the above experimental process.

[0027] 4.TCID 50 Determination method

[0028] Vero E6 cells were spread in a 96-well plate and cultured overnight to ensure the formation of a uniform and dense monolayer of cells. Subsequently, the virus solution was slowly added to the monolayer of cells using a 10-fold dilution method to ensure sufficient contact between the virus and the cells. After that, the entire well plate was transferred to a constant temperature incubator at 37°C and 5% carbon dioxide to provide optimal conditions for viral replication and cell infection. During the culture process, wells with characteristic pathological morphologies such as syncytia were marked as PEDV-positive wells, indicating that the virus had successfully infected and induced cytopathic effects.

[0029] 5. RNA Extraction and RT-qPCR

[0030] Total RNA was extracted from Vero E6 cells using TRIZOL reagent according to the reagent instructions, and RNA was reverse transcribed into cDNA using Hiscript II First Strand cDNA Reverse Transcription Kit. Gene expression was evaluated by SYBR using Light Cycler96 real-time fluorescent polymerase chain reaction system (Roche Diagnostics, Switzerland). The upstream primer sequence (SEQ ID NO.1) is: TGAGGGTGTTTTCTGGGTTG, and the downstream primer sequence (SEQ ID NO.2) is: ACAATCTCAACTACGCTGGG. β-actin was used as an intragroup control. Data were thresholded by cycle (2 -ΔΔCt ) method for analysis.

[0031] 6. Western Blot

[0032] Total protein in cells was extracted using RAPI strong lysis buffer (Beyotime, China) containing protease inhibitor PMSF. The extracted proteins were separated by SDS-PAGE polyacrylamide gel electrophoresis, and then the proteins on the gel were transferred to nitrocellulose membrane; after transfer, the nitrocellulose membrane was placed in a blocking solution containing 5% skim milk powder and incubated at 37°C for 1 hour to block nonspecific binding sites on the membrane; after blocking, the membrane was thoroughly washed with PBST solution (phosphate buffer PBS+Tween20) to remove excess milk powder and nonspecific binding substances; appropriately diluted specific primary antibody solution was added to the membrane and incubated at 4°C; the next day, the primary antibody solution was recovered and the membrane was fully washed again with PBST solution; the secondary antibody diluent was added, the membrane was placed on a shaker, and incubated at 37°C for 1 hour; after incubation, the unbound secondary antibody was removed by multiple washings; the chemiluminescent developer was prepared on site and evenly added to the nitrocellulose membrane for chemiluminescent development; the developed bands were analyzed using ImageJ software to evaluate the protein expression level.

[0033] 7. Indirect Immunofluorescence

[0034] Remove the maintenance solution from the sample wells, wash twice with sterile PBS; fix with 4% paraformaldehyde at room temperature for 20 minutes, and then wash three times with PBS; add 5% skim milk powder to block at 37°C for 1 hour, wash three times with PBS; add diluted PEDV-N antibody and incubate at 4°C overnight; wash three times with PBS, add fluorescently labeled goat anti-mouse antibody and incubate at 37°C for 1 hour. DAPI was incubated at room temperature for 15 minutes to mark the cell nucleus. Finally, the cells were observed with a Nikon inverted microscope.

[0035] 8.M pro Activity assay

[0036] By CoronavirusM pro / 3CL pro The activity of Mpro in PEDV-infected cells was determined by an active fluorescence detection kit. Vero E6 cells were evenly plated on a 12-well plate, cultured at 37°C, 5% CO2 for 12 hours, washed three times with sterile PBS, and then infected with PEDV. Afterwards, the cells were treated with sodium tanshinone IIA sulfonate (concentration 200 μM) for 1, 2, 3, and 4 hours, and then washed with PBS. Cell samples were collected with RIPA strong lysate and the Mpro activity was determined according to the coronavirus M pro / 3CL pro The samples were processed according to the instructions of the activity fluorescence detection kit. The excitation wavelength of the microplate reader was 325nm and the emission wavelength was 393nm, and the reading was once every minute. After processing, the amount of MCA product was determined according to the MCA (fluorescent substrate for detecting protease activity) calibration curve to evaluate M pro activity.

[0037] 2 Results

[0038] 2.1 Drug library screening

[0039] In order to screen out compounds with significant inhibitory effects on porcine epidemic diarrhea virus (PEDV), we systematically conducted a high-throughput screening experiment on 2320 compounds in the L1021-DiscoveryProbe-FDA-approved-Drug-Library. Figure 1As shown in A, Vero E6 cells were first infected with PEDV at a multiplicity of infection (MOI = 0.05) for one hour, and then 0.2 μL of the test compound was added to each well. One hour later, in order to discard the unadsorbed PEDV virus particles in the wells, the liquid was replaced, and 99.8 μL of cell maintenance liquid was added to each well and 0.2 μL of the corresponding compound was added. After 36 hours of culture, the liquid in the wells was removed, and the cell activity of each well was determined by observing the cytopathic effect (CPE) combined with the MTT method to determine whether each compound had an inhibitory effect on PEDV. The screening results are shown in Figure 1 As shown in B. After preliminary screening, there were 308 compounds (accounting for 13.28% of the total FDA library) with cell activity greater than 50% and no obvious cytotoxicity compared with the DMSO control group, showing the ability to inhibit the proliferation of PEDV. In order to further screen compounds with high inhibitory activity on PEDV proliferation, we conducted a second round of screening on these 308 candidate compounds. The screening condition was that the cell activity was greater than 70%. After rigorous evaluation, 33 compounds (accounting for 1.4% of the total FDA library) effectively inhibited the proliferation of PEDV. Finally, we conducted a third round of screening. The screening condition was that the activity of cells infected with PEDV treated with compounds was greater than 90%. In the end, 27 compounds (accounting for 1.1% of the total FDA library) were locked in. These compounds showed almost no cytotoxicity while inhibiting PEDV. Based on the inhibitory efficacy, safety considerations and cost-effectiveness analysis of the compounds, sodium tanshinone IIA sulfonate, a flavonoid compound, was selected as the object of further research. Figure 1 C.

[0040] 2.2 Determination of CC50 and IC50 of Tanshinone IIA Sulfonate Sodium

[0041] To determine the maximum safe concentration of sodium tanshinone IIA sulfonate, we used the MTT method to determine the toxic effects of sodium tanshinone IIA sulfonate on Vero E6 and PK1 cells. In the experiment, we selected 200, 400, 600, 800 and 1000 μM sodium tanshinone IIA sulfonate to treat Vero E6 cells, and added MTT reagent 48 hours later to determine the cell survival rate at each concentration. The results showed that at a concentration below 400 μM, Vero E6 cells treated with sodium tanshinone IIA sulfonate ( Figure 2 A) The cell viability was close to 80%; Vero E6 cells treated with sodium tanshinone IIA sulfonate ( Figure 2B) The cell viability exceeded 80%. To further explore the half-inhibitory concentration of sodium tanshinone IIA sulfonate in Vero E6 cells, the concentration range was narrowed, and the cells were treated with 0, 25, 50, 75, 100, 150, and 200 μM sodium tanshinone IIA sulfonate for 48 hours. For Vero E6 cells and PK1 cells infected with PEDV, MTT analysis revealed that when the concentration was higher than 50 μM, the cell viability of the sodium tanshinone IIA sulfonate-treated group was close to 100%, while when it was lower than 25 μM, the cell viability dropped significantly to below 60% ( Figure 2 C; Figure 2 D).

[0042] 3.3 Antiviral activity of sodium tanshinone IIA sulfonate

[0043] In order to determine the inhibitory effect of different concentrations of sodium tanshinone IIA sulfonate on PEDV, Vero E6 cells were first infected with PEDV (MOI = 0.05) for one hour, and then treated with 300 μM, 200 μM, 100 μM, and 20 μM sodium tanshinone IIA sulfonate. After 20 h, the supernatant and cells were collected for real-time fluorescence quantitative PCR, TCID 50 , Western Blot and IFA. The mRNA level of PEDVN in cells was determined by real-time quantitative PCR. The results showed that sodium tanshinone IIA sulfonate significantly reduced the mRNA level of PEDVN in a dose-dependent manner ( Figure 3 A) At the same time, TCID 50 The results showed that the virus titer of PEDV was significantly reduced compared with the control group ( Figure 3 B), thus indicating that sodium tanshinone IIA sulfonate can effectively inhibit the replication of PEDV. To further analyze the effect of sodium tanshinone IIA sulfonate on PEDV protein synthesis, Western Blot assay was performed to detect the level of PEDVN protein in infected cells. Subsequently, IFA was used to determine the potential inhibitory effect of sodium tanshinone IIA sulfonate on the number of PEDV-infected cells. As the concentration of sodium tanshinone IIA sulfonate increased, PEDV-specific immunofluorescence gradually decreased in infected Vero E6 cells ( Figure 3 C), indicating that the antiviral effect of sodium tanshinone IIA sulfonate exhibits a concentration-dependent response. Figure 3 As shown in D, with the increase of sodium tanshinone IIA sulfonate concentration, the expression level of N protein in infected cells gradually decreased, and sodium tanshinone IIA sulfonate at a concentration above 200 μM almost completely blocked the synthesis of PEDV N protein. It was not ruled out that sodium tanshinone IIA sulfonate specifically inhibited PEDV on Vero E6 cells. We then verified whether sodium tanshinone IIA sulfonate inhibited PEDV on PK1 cells. WB results ( Figure 3E) shows that 200 μM sodium tanshinone IIA sulfonate completely inhibited the proliferation of PEDV in PK1 cells.

[0044] 3.4 Effect of sodium tanshinone IIA sulfonate on the life cycle of PEDV

[0045] To understand whether sodium tanshinone IIA sulfonate has a direct killing effect on PEDV virus particles, we incubated PEDV (MOI = 0.05) with 100 μM sodium tanshinone IIA sulfonate at room temperature for 1 h before infection as the experimental group, and the control group was incubated at room temperature with only PEDV without drug addition. Then, Vero E6 cells in 96-well plates were infected. The supernatant was collected after 24 h, and TCID 50 The infection titer was determined by the method, and the results showed that ( Figure 4 A), compared with the control group, the virus titer in the experimental group did not decrease. Therefore, we determined that sodium tanshinone IIA sulfonate does not directly inhibit the infectivity of PEDV to cells, that is, sodium tanshinone IIA sulfonate cannot be identified as a virus-killing drug.

[0046] The process of PEDV infection of cells includes adsorption, invasion, replication, assembly and release. In order to further explore the period when sodium tanshinone IIA sulfonate inhibits PEDV infection, we set the cells to be treated with 100μM sodium tanshinone IIA sulfonate one hour before PEDV infection, and added the same concentration of drugs again at different time points (1h, 3h, 6h, 12h) after virus infection. The time-of-addition assay mode is shown in the figure below. Figure 4 As shown in B. 24h after virus infection, the cell supernatant was collected and TCID 50 The assay and real-time fluorescence quantitative PCR technology were used to evaluate the changes in viral titer and viral nucleic acid levels. Figure 4 C, TCID 50 The results showed that, whether it was pretreatment 1 hour before infection or treatment 1 hour and 3 hours after infection, sodium tanshinone IIA sulfonate significantly reduced the viral titer of PEDV, indicating its effective inhibition of viral replication. Furthermore, real-time fluorescence quantitative PCR analysis ( Figure 4 D) and TCID 50 The results were consistent, confirming that the application of sodium tanshinone IIA sulfonate 1h before infection and 1h and 3h after infection significantly downregulated the expression level of PEDVN gene mRNA, reflecting the reduction of viral nucleic acid replication. Based on the above findings, we infer that sodium tanshinone IIA sulfonate may mainly interfere with the early stages of PEDV adsorption, invasion and replication of host cells, thereby showing a strong inhibitory effect in the early stages of viral infection.

[0047] 3.5 Molecular docking and M pro Activity assay

[0048] M pro It is a key enzyme in the life cycle of PEDV, responsible for cleaving the virus's polyprotein, thereby releasing non-structural proteins with multiple functions. These non-structural proteins play an important role in viral replication and transcription. pro It can be used as a key target for screening antiviral drugs. GC376 is a coronavirus M pro Inhibitors against various coronaviruses pro The activity showed good inhibitory effect, thus playing an inhibitory role in the virus. Therefore, we used molecular docking technology to study the interaction between sodium tanshinone IIA sulfonate and M pro , GC376 and M pro Table 1 shows the interaction between M pro The binding energy of sodium tanshinone IIA sulfonate and GC376 was analyzed. The results showed that sodium tanshinone IIA sulfonate and M pro The docking binding energy of the ligand GC376 is -8.8 kcal / mol, which is lower than that of the original ligand GC376 and M pro The docking binding energy is -7.2 kcal / mol. The molecular docking results show that both compounds have pro The "binding pocket" region of Figure 5 A and 5B. Specifically, sodium tanshinone IIA sulfate formed hydrogen bonds with amino acid residues Gln-8 and Arg-294, with bond lengths of 3.5 nm, 2.9 nm, and 3.3 nm, respectively. GC376 established hydrogen bonds with amino acid residues Arg-136, His-280, and Lys-5, with bond lengths of 3.0 nm, 3.2 nm, and 3.2 nm, respectively. These findings suggest that sodium tanshinone IIA sulfate has a higher hydrogen bonding capacity than GC376 and therefore has a higher affinity for M pro Has better binding affinity and activity.

[0049] Table 1 Docking of sodium tanshinone IIA sulfonate and GC376 pro Molecular binding energy and docking amino acid sites

[0050]

[0051] In order to investigate whether the activity of PEDV Mpro treated with Tanshinone IIA sodium sulfate was inhibited, coronavirus M pro / 3CL pro The experimental determination was performed using an active fluorescence detection kit. One group was treated with Tanshinone IIA sodium sulfate as the experimental group, and the other group was only infected with PEDV as the control group. Figure 5 C shows that as the infection time increases, M pro The activity was strongest at 2 hours and 3 hours, confirming that M proIt started to work 2 hours after virus infection. Compared with the control group, the MCA content in the experimental group was significantly reduced, and the MCA content was significantly reduced 2 hours and 3 hours after infection, confirming the inhibitory effect of tanshinone IIA sodium sulfate on Mpro activity. These findings are consistent with the results of molecular docking.

[0052] discuss

[0053] PEDV can cause acute, highly contagious and severe intestinal diseases in pigs, especially leading to high mortality in suckling piglets. Data show that when highly pathogenic PEDV variants are prevalent in China, the mortality rate of suckling piglets can reach 80% to 100%, seriously endangering the healthy development of the pig industry. At present, the prevention and control measures based on vaccine prevention cannot completely suppress the prevalence of PEDV. Therefore, the development of antiviral drugs has great research value and application prospects. At present, studies have found that many drugs have the effect of inhibiting PEDV, but these anti-PEDV drugs that have been discovered have more or less some problems, such as whether long-term use of cinconazole will cause toxic effects has not been confirmed; xanthohumol only exists in hops, and the content is low. Extracting high-purity xanthohumol requires complex extraction and purification processes, which increases production costs. Therefore, it is of great research significance to continue to develop drugs that inhibit PEDV infection. By exploring new uses or new targets for existing drugs, the FDA drug library provides important support for drug innovation. Therefore, we selected the L1021 Discovery Probe FDA-approvedDrug Library to screen anti-PEDV drugs, and finally selected the compound Tanshinone IIA sulfonate sodium to study the inhibitory effect and mechanism of action of PEDV. Tanshinone IIA sulfonate sodium, a star molecule in the field of non-traditional antiviral drugs, has opened up new perspectives for the innovative research and development of antiviral drugs due to its unique multi-target regulatory mechanism, excellent bioavailability, low risk of drug interactions, and its significant antioxidant, anti-inflammatory and potential cardiovascular protection and other multiple biological effects, and no toxic effects after long-term use. Tanshinone IIA sulfonate sodium is a supplement to the discovered anti-PEDV drugs, and its wide range of biological activities indicates great potential and application prospects in antiviral strategies.

[0054] This study screened 2320 compounds in the L1021 Discovery Probe FDA-approved Drug Library and selected sodium tanshinone IIA sulfonate, a natural compound, for in-depth study of its inhibitory effect on PEDV. After determining its CC50 and IC50, a concentration below 300 μM was selected for subsequent experiments. 50The results showed that with the increase of sodium tanshinone IIA sulfonate concentration, the virus titer of PEDV continued to decrease; the real-time fluorescence quantitative PCR results confirmed that the mRNA level of PEDV N gene decreased with the increase of sodium tanshinone IIA sulfonate concentration; Western Blot results confirmed that sodium tanshinone IIA sulfonate completely inhibited the synthesis of PEDVN protein when the concentration was above 200μM; the results of immunofluorescence analysis (IFA) experiments showed that with the increase of sodium tanshinone IIA sulfonate concentration, PEDV-specific immunofluorescence gradually decreased in infected Vero E6 cells. The above experiments confirmed that the inhibitory effect of sodium tanshinone IIA sulfonate on PEDV was dose-dependent. In addition, Western Blo results showed that sodium tanshinone IIA sulfonate at a concentration of 200μM also completely inhibited the synthesis of PEDVN protein in PK1 cells, excluding the specific action of sodium tanshinone IIA sulfonate on a certain cell to inhibit PEDV. Secondly, we added sodium tanshinone IIA sulfonate to treat Vero E6 cells infected with PEDV at different time points, confirming that sodium tanshinone IIA sulfonate acts on the adsorption and invasion stages of viral infection. It is worth noting that GC376, as a covalent inhibitor of cysteine ​​proteases, has been shown to have significant inhibitory effects on a variety of coronaviruses including hepatitis A and PTV, and is a broad-spectrum coronavirus M pro Finally, through molecular docking technology, we confirmed that tanshinone IIA sodium sulfate and M pro The docking binding energy of GC376 is lower than that of M pro , M pro The activity of the drug was experimentally verified and the results of molecular docking were confirmed. This finding shows that Tanshinone IIA sodium sulfate is a broad-spectrum coronavirus inhibitor, providing a new solution for the development of drugs to inhibit PEDV. The high-throughput screening of the L1021 Discovery Probe FDA-approved Drug Library in this article can also be used to develop drugs against other animal viruses, providing new prevention and control ideas for controlling animal diseases.

[0055] in conclusion

[0056] Tanshinone IIA sodium sulfonate has an inhibitory effect on PEDV, and the inhibitory effect is dose-dependent. Tanshinone IIA sodium sulfonate exerts an anti-PEDV effect by acting on the adsorption and invasion stages of virus particles.

[0057] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of sodium tanshinone IIA sulfonate in the preparation of anti-PEDV products, characterized in that: The CAS registration number of the sodium tanshinone IIA sulfonate is 69659-80-9.

2. The use according to claim 1, characterized in that: The product described is a drug candidate.

3. The use according to claim 2, characterized in that: The dosage form of the candidate drug is any one of powder, tablet, granule, capsule, solution, emulsion and suspension.

4. The use according to any one of claims 1 to 3, characterized in that: Tanshinone IIA sulfonate sodium is the only active ingredient in the product.

5. The use according to claim 2 or 3, characterized in that: The candidate drug also contains medically acceptable excipients.

6. The use according to claim 4, characterized in that: The candidate drug also contains medically acceptable excipients.

7. The use according to any one of claims 1 to 3, characterized in that: The application is to inhibit the infection and proliferation of PEDV.

Images