Luminal breast cancer bone metastasis marker and predictive diagnostic kit based on circCCDC50 in tumor vesicles

By detecting the expression level of circCCDC50, the problem of predicting bone metastasis in Luminal type breast cancer is solved, early and non-invasive diagnosis is achieved, and the accuracy and reliability of the diagnosis are improved.

CN119662833BActive Publication Date: 2025-08-15SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510102858.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2025-08-15
Estimated Expiration
2045-01-22

AI Technical Summary

Technical Problem

The prior art is difficult to effectively predict the risk of bone metastasis in Luminal breast cancer, resulting in missed detection and prediction difficulties, affecting patients' quality of life and survival.

Method used

Using circCCDC50 as a biomarker, the expression level of circCCDC50 in patients' plasma is detected by quantitative PCR technology, providing a kit and system for diagnosis/prediction of bone metastasis in breast cancer, and using the specific expression differences of circCCDC50 for early diagnosis.

Benefits of technology

Early and non-invasive detection of bone metastasis in Luminal type breast cancer is achieved, the sensitivity and specificity of diagnosis is improved, missed detection caused by too small metastatic lesions is avoided, and reliable predictive indicators are provided.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005254625340000081
    Figure BDA0005254625340000081
  • Figure HDA0005254625350000011
    Figure HDA0005254625350000011
  • Figure HDA0005254625350000012
    Figure HDA0005254625350000012
Patent Text Reader

Abstract

This invention, belonging to the field of biological detection technology, discloses a marker and predictive diagnostic kit for luminal breast cancer bone metastasis based on circCCDC50 in tumor vesicles. Specifically, it discloses the use of circCCDC50 as a biomarker in the preparation of a product for the diagnosis / prediction of breast cancer bone metastasis. This invention proposes, for the first time, the use of circCCDC50 as a biomarker for luminal breast cancer bone metastasis. This circRNA can serve as a supplementary marker for the detection of luminal breast cancer bone metastasis and avoid missed detection of luminal breast cancer bone metastasis due to small metastatic lesions. circCCDC50 provides a broad and valuable predictive indicator for luminal breast cancer bone metastasis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and specifically relates to a luminal breast cancer bone metastasis marker and a predictive diagnostic kit based on circCCDC50 in tumor vesicles. Background Art

[0002] Breast cancer (BC) remains the leading cause of cancer-related death in women. The main cause of death in BC patients is metastasis to the bones, brain, lungs, and other internal organs. BC metastasis is organ-specific, and factors such as BC molecular subtype, the immune microenvironment of the metastatic organ, the vascular microenvironment of the metastatic organ, and the interaction between cancer cells and the metastatic organ all play a role in organ-specific metastasis. Luminal BC (LBC) accounts for 70% of all breast cancers. LBC, particularly ER+ tumors, has a higher propensity for bone metastasis. More than 70% of patients with advanced BC will develop bone metastases, leading to severe bone pain and skeletal-related events (SREs), such as pathological fractures. SREs significantly diminish the quality of life of breast cancer patients with bone metastases, resulting in a 25% decrease in overall survival. Furthermore, even after radical resection of BC, some LBC patients remain at high risk of bone metastatic recurrence, with peak recurrence rates occurring 2-3 and 5 years after surgery. Bone metastasis is a significant prognostic factor for BC. For patients with early-stage BC and no metastases, the 5-year survival rate is as high as 90%. However, once metastases develop, the 5-year survival rate drops to 10%, with a median survival of only 2.3 years. Therefore, it is necessary to predict the risk of bone metastasis in LBC patients. However, the specific regulatory mechanism of LBC bone metastasis has not yet been clarified, making it difficult to predict the risk of LBC bone metastasis. Summary of the Invention

[0003] The first aspect of the present invention aims to provide the use of circCCDC50 as a biomarker in the preparation of a product for the diagnosis / prediction of breast cancer bone metastasis.

[0004] The second aspect of the present invention aims to provide a method for using a substance for detecting circCCDC50 in the preparation of a product for diagnosing / predicting breast cancer bone metastasis.

[0005] The third aspect of the present invention is to provide a primer for detecting circCCDC50.

[0006] The fourth aspect of the present invention aims to provide a kit for diagnosing / predicting breast cancer bone metastasis.

[0007] The fifth aspect of the present invention aims to provide a system for early diagnosis / prediction of luminal breast cancer bone metastasis.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] In a first aspect, the present invention provides use of circCCDC50 as a biomarker in the preparation of a product for the diagnosis / prediction of breast cancer bone metastasis.

[0010] In some embodiments of the present invention, the breast cancer includes luminal breast cancer.

[0011] The present invention provides the use of circCCDC50 as a biomarker for early diagnosis of luminal breast cancer bone metastasis. The circRNA can be used as a supplementary marker for the detection of luminal breast cancer bone metastasis and avoid missed detection of luminal breast cancer bone metastasis due to small metastatic lesions. circCCDC50 can cover a wide range of valuable predictive indicators for luminal breast cancer bone metastasis. Specifically, the present invention quantitatively analyzed circCCDC50 by qRT-PCR and found that there was a difference in the expression level of circCCDC50 in plasma samples of luminal breast cancer patients with and without bone metastasis. Compared with the expression level of circCCDC50 in plasma samples of luminal breast cancer patients without bone metastasis, the expression level of circCCDC50 in plasma samples of luminal breast cancer patients with bone metastasis was significantly increased, indicating that circCCDC50 has the potential to serve as a biomarker for luminal breast cancer bone metastasis.

[0012] In some embodiments of the present invention, the circCCDC50 is circCCDC50 detected in tumor vesicles.

[0013] In some embodiments of the present invention, the nucleotide sequence of circCCDC50 is as follows:

[0014] CGCTACAAAGACCTGTGAGGATTTGGGAGTGAACAACAAGACTGTGAAATTG

[0015] CTCAGGAAATTCAGGAGAAGCTGGCTATTGAGGCAGAGAGACGCATTCAGGA

[0016] GAAGAAGGATGAGTATGCCGAGATTTTGCTGTCCTGGAGGACCACACCCTGGCTC

[0017] ACAGCCTGCAGGAACAAGAGATTGAGCATCATTTGGCATCGAACGTTCAGCGGAA

[0018] CCGTTTGGTCCAGCATGATCTCCAGGTGGCTAAGCAGCTCCAAGAGGAAGATCTG

[0019] AAAGCGCAGGCCCAGCTCCAGAAG (SEQ ID NO: 1).

[0020] In some embodiments of the present invention, the product includes at least one of a reagent, a kit, a test paper, a system, and a chip.

[0021] A second aspect of the present invention provides use of a substance for detecting circCCDC50 in the preparation of a product for diagnosing / predicting breast cancer bone metastasis.

[0022] In some embodiments of the present invention, the substance includes a substance for quantitatively detecting the expression level of circCCDC50.

[0023] In some embodiments of the present invention, the substance includes a substance for detecting circCCDC50 by PCR, biochip method, or nucleic acid sequencing method.

[0024] In some embodiments of the present invention, the substance includes one or more of a circCCDC50-specific probe, a gene chip, and a PCR primer.

[0025] In some embodiments of the present invention, the nucleotide sequences of the PCR primers are shown in SEQ ID NOs: 2-3.

[0026] In some embodiments of the present invention, the product includes but is not limited to a reagent, a kit, a test paper, a system or a chip.

[0027] In some embodiments of the present invention, the test sample of the product is selected from at least one of the blood, tissue, cells, and excrement of the subject to be tested.

[0028] In some embodiments of the present invention, the breast cancer includes luminal breast cancer.

[0029] In some embodiments of the present invention, the circCCDC50 is circCCDC50 detected in tumor vesicles.

[0030] In some embodiments of the present invention, the tumor vesicles are obtained by the following steps: collecting and storing peripheral blood in an EDTA blood collection tube, centrifuging the whole blood, and taking the supernatant; and extracting tumor vesicles from the supernatant by ultracentrifugation.

[0031] In a third aspect of the present invention, a primer for detecting circCCDC50 is provided, wherein the nucleotide sequence of the primer is shown in SEQ ID NO: 2-3.

[0032] A fourth aspect of the present invention provides a kit for diagnosing / predicting breast cancer bone metastasis, comprising the primers of the third aspect of the present invention.

[0033] This application uses primers for circCCDC50 as molecular markers for luminal breast cancer bone metastasis and uses them in the preparation of a luminal breast cancer bone metastasis prediction kit. This kit can be used to identify molecular markers for luminal breast cancer bone metastasis. The expression level of circCCDC50 is significantly different in the plasma of luminal breast cancer patients with and without bone metastasis. This can serve as a physical examination indicator, enabling the detection of abnormalities at an earlier, noninvasive stage, and helping to guide further testing.

[0034] In some embodiments of the present invention, the kit further comprises an RNA extraction reagent, a reagent for RNA reverse transcription reaction, and a reagent for PCR reaction.

[0035] In some embodiments of the present invention, the reagents for RNA reverse transcription reaction include reverse transcriptase, reverse transcription primers, random primers and buffer.

[0036] In some embodiments of the present invention, the reverse transcriptase comprises M-MLV reverse transcriptase, AMV reverse transcriptase, or a combination thereof.

[0037] In some embodiments of the present invention, the buffer comprises dNTPs and metal ions (such as magnesium ions, manganese ions or calcium ions), and at least one of ATP and / or GTP.

[0038] In some embodiments of the present invention, the reagents used for the PCR reaction include SYBR green mixed solution.

[0039] A fifth aspect of the present invention provides a system for early diagnosis / prediction of luminal breast cancer bone metastasis, the system comprising:

[0040] Detection module: used to detect the expression level of circCCDC50 in patient samples and output the circCCDC50 expression data to the analysis module;

[0041] Analysis module: Based on the expression level of circCCDC50, the diagnosis result is determined according to predetermined rules.

[0042] In some embodiments of the present invention, the predetermined rule is: when the expression level of circCCDC50 is detected to be higher than that of luminal breast cancer samples without bone metastasis, it is judged that the risk of bone metastasis of luminal breast cancer is high.

[0043] In some embodiments of the present invention, the predetermined rule is: when the expression level of circCCDC50 is detected by qRT-PCR and the Ct value is less than 27.35, it is judged as a high risk of bone metastasis of luminal breast cancer, otherwise it is a low risk.

[0044] In some embodiments of the present invention, the primers of the third aspect of the present invention or the kit of the fourth aspect of the present invention are used to detect the expression level of circCCDC50 in a patient sample.

[0045] The beneficial effects of the present invention are:

[0046] Based on circCCDC50 isolated from peripheral blood tumor vesicles of patients with luminal breast cancer, the present invention experimentally detected the expression of circCCDC50 in the blood of patients with and without bone metastasis of luminal breast cancer to enhance the understanding of the relevant role of circRNAs in luminal breast cancer. It was found that circRNAs are valuable in predicting bone metastasis of luminal breast cancer (sensitivity of 77.78%, specificity of 77.78%, and AUC of 0.908). Specifically, the present invention proposes for the first time to use circCCDC50 as a biomarker for bone metastasis of luminal breast cancer. This circRNA can be used as a supplementary marker for the detection of bone metastasis of luminal breast cancer and avoid the missed detection of bone metastasis of luminal breast cancer due to the small size of the metastatic lesions. circCCDC50 can cover a wide range of valuable predictive indicators for bone metastasis of luminal breast cancer and can be used to predict the probability of bone metastasis of luminal breast cancer.

[0047] The tumor vesicle circCCDC50, a marker for luminal breast cancer bone metastasis provided by the present invention, can be detected by obtaining peripheral blood, thereby achieving convenient operation.

[0048] The present invention provides a diagnostic kit for predicting luminal breast cancer bone metastasis based on tumor vesicle circCCDC50, which can detect the expression level of circCCDC50 in peripheral blood tumor vesicles of patients with luminal breast cancer in vitro, thereby predicting luminal breast cancer bone metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The results of candidate differential circular RNAs screened after deep sequencing of circular RNA was performed on tumor vesicles from primary tumor cells of patients with luminal breast cancer with bone metastasis and tumor vesicles from primary tumor cells of patients with luminal breast cancer without metastasis.

[0050] Figure 2 This is a graph showing the expression results of candidate differential circular RNAs in serum tumor vesicles of patients in the non-metastatic luminal breast cancer group and the luminal breast cancer bone metastasis group in the examples of the present invention.

[0051] Figure 3 : This is the ROC curve of circCCDC50 in serum tumor vesicles for predicting bone metastasis of luminal breast cancer in the example of the present invention. DETAILED DESCRIPTION

[0052] The present invention is further described in detail below through specific examples.

[0053] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0054] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0055] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0056] Example 1

[0057] 1. Selection and collection of plasma samples from patients with luminal breast cancer

[0058] Plasma samples were collected from 38 patients diagnosed with luminal breast cancer who were hospitalized at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, between March 2018 and August 2019 (including 17 patients with luminal breast cancer bone metastasis and 21 controls without luminal breast cancer). These patients served as the screening and testing cohorts. Plasma samples were collected from 208 patients diagnosed with luminal breast cancer who were hospitalized at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, between September 2019 and March 2024 (including 91 patients with luminal breast cancer bone metastasis and 117 controls without luminal breast cancer). Inclusion criteria for the plasma samples were: 1. Patients were newly diagnosed with breast cancer and had not received any prior treatment; 2. Patient basic information (such as name, age, alcohol consumption history, smoking history), laboratory test indicators (such as ALT, AST, TBIL, GGT, and GLU), and clinical data (such as tumor stage, lymph node metastasis, and tumor type) were collected via biopsy. The gender and age of all included subjects were the same as those in the case group. This application was also reviewed and approved by the Ethics Committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University.

[0059] 2. Experimental Methods

[0060] 2.1circCCDC50 is present in tumor vesicles derived from highly bone-metastatic luminal breast cancer cells. Therefore, tumor vesicles need to be isolated from plasma samples and obtained by the following steps:

[0061] Collect and store peripheral blood in EDTA blood collection tubes, centrifuge to separate the whole blood, and take the supernatant; use ultracentrifugation to extract tumor vesicles from the supernatant. Specifically:

[0062] (1) Draw whole blood using a blood collection tube containing EDTA (purple cap) (two 5 mL blood collection tubes or one 10 mL blood collection tube) and gently mix by inverting.

[0063] (2) Centrifuge at 1900 g for 10 min at 4°C using a swinging bucket rotor. Carefully aspirate the supernatant (plasma) and discard the last 500 μL.

[0064] (3) The obtained plasma was centrifuged again at 4°C, 3000 g for 15 min, and the plasma supernatant was carefully aspirated, taking care not to touch the sediment on the bottom and sides;

[0065] (4) The supernatant was divided into EP tubes and frozen at -80°C before extracting tumor vesicles to avoid repeated freezing and thawing;

[0066] (5) The supernatant was filtered through a 0.45 μm filter membrane, and the plasma filtrate was collected;

[0067] (6) Transfer the filtrate to a new centrifuge tube and centrifuge at 8000 × g for 70 min at 4°C in an ultraspeed rotor.

[0068] (7) Remove the supernatant, resuspend with 10 mL of pre-chilled 1× PBS, select an ultracentrifuge rotor, and ultracentrifuge again at 4°C, 8000×g for 70 min.

[0069] (8) Remove the supernatant, resuspend the tumor vesicles in 100 μL of pre-chilled 1× PBS, and store at -80°C.

[0070] The present invention purifies tumor vesicles to remove impurities in plasma and improve the accuracy of prediction.

[0071] 2.2 RNA extraction of tumor vesicle circCCDC50

[0072] RNA was extracted from tumor vesicles by the following steps:

[0073] (1) Add 200 μL of sample to a 1.5 mL centrifuge tube;

[0074] (2) Add 40 μL of proteinase K solution and 300 μL of lysis buffer (lysate composition: ammonium thiocyanate 1.8 M, sodium chloride 0.02 mM, glacial acetic acid 0.1 M, guanidine thiocyanate 1.5 M, and the rest is DEPC-treated water) and mix well;

[0075] (3) Add 20 μL of magnetic bead suspension and 250 μL of isopropanol, and vortex for 3 minutes to ensure that the magnetic beads are fully dispersed;

[0076] (4) Place the centrifuge tube on the magnetic stand and let it stand for 20 seconds until the magnetic beads are completely adsorbed. Keep the EP tube fixed on the magnetic stand and use a pipette to aspirate and discard the supernatant, avoiding contact with the magnetic beads during this period.

[0077] (5) Remove the 1.5 mL centrifuge tube from the magnetic stand, add 1000 μL of washing solution I (the composition of washing solution I is: 0.29 g of NaCl dissolved in 34 mL of anhydrous ethanol, and then add water to 40 mL) to the 1.5 mL centrifuge tube, blow off the magnetic beads hanging on the wall of the tube with a pipette, vortex and oscillate for 1 minute, and perform magnetic separation (refer to step (4) operation);

[0078] (6) Remove the 1.5 mL centrifuge tube from the magnetic stand, add 1000 μL of washing solution II (the composition of washing solution II is 0.14 g of TRIS dissolved in 34 mL of anhydrous ethanol, and then add water to 40 mL) to the 1.5 mL centrifuge tube, blow off the magnetic beads hanging on the wall of the tube with a pipette, vortex and oscillate for 1 minute, and perform magnetic separation (refer to step (4) operation);

[0079] (7) Place the centrifuge tube on a test tube rack, open the lid and let it stand at room temperature for 5 minutes. If there is still liquid, place it on a magnetic separator and let it stand until the remaining liquid is absorbed. Remove the centrifuge tube.

[0080] (8) Add 100 μL of elution buffer (2.5% SDS), blow off the magnetic beads with a pipette, and vortex for 1 minute to ensure that the magnetic beads are completely dispersed. After heating at 65°C for 7 minutes, vortex for about 3 seconds. Place the centrifuge tube on a magnetic separator until the solution is clear. Transfer the supernatant to a new 1.5 mL centrifuge tube. This is the purified nucleic acid, which can be stored at -20°C for later use.

[0081] 2.3 Reverse transcription of RNA from tumor vesicles

[0082] cDNA was synthesized according to the instructions of TOYOBO's reverse transcription kit ReverTraAce qPCR RT Master Mix with gDNARemover. The specific steps are as follows:

[0083] (1) RNA denaturation: For each sample, take 1.0 μg of RNA, make up the volume to 12 μL with nuclease-free water, and place it on a PCR instrument, setting the program to 65°C for 5 min;

[0084] (2) Removal of genomic DNA: Add 4.0 μL of 4× DNA Master Mix to (1), gently shake and mix, separate and place on a PCR instrument, set the program to 37°C, 5 min;

[0085] (3) Reverse transcription: Add 4.0 μL of 5×RT Master Mix II to (2), shake gently to mix, separate and place on a PCR instrument for reaction. The reaction program is 37°C, 15 min; 50°C, 5 min; 98°C, 5 min.

[0086] 2.4 Real-time fluorescence quantitative PCR was performed on the synthesized cDNA

[0087] The expression levels of target genes in plasma samples were detected using a Bio-Rad C1000 fluorescence quantitative instrument (fluorescence quantitative mix reagent: Premix Ex TaqTMII real-time PCR kit, ordered from Takara). The primer design is shown in Table 1. The final data analysis was performed using relative quantification (2 -ΔΔCt ) method for analysis; the details are as follows:

[0088] Table 1 circCCDC50 primer sequence list

[0089]

[0090] (1) Reaction setup: qPCR reaction system: 10 μL SYBR-Green I Premix Ex Taq, 0.8 μL upstream primer, 0.8 μL downstream primer, and 7.4 μL enzyme-treated water to obtain real-time qPCR mix. The prepared real-time qPCR mix was mixed and separated, and then dispensed into 8 tube strips. 2 μL of cDNA template was added. The reaction system is shown in Table 2.

[0091] Table 2 qRT-PCR reaction system

[0092] Reaction components Addition amount SYBR-Green I Premix Ex Taq 10 μL Upstream primer 0.8μL Downstream primer 0.8μL Enzyme-treated water 7.4μL cDNA 2μL

[0093] (2) Tightly cap the 8-tube strips, label them, and centrifuge at room temperature for 1 min at 1000 g.

[0094] (3) Set up the qPCR program and run it. The PCR program is as follows: 95°C, 5 min; 95°C, 30 sec; 61°C, 30 sec; 72°C, 30 sec, for a total of 40 cycles.

[0095] 2.5 Statistical analysis methods

[0096] Data were statistically analyzed using SPSS 17.0 or GraphPad Prism 9.0. GraphPad Prism 9.0 was used to detect circRNA expression and plot receiver operating characteristic (ROC) curves and area under the curve (AUC). Binary logistic regression was used for circRNA analysis. P < 0.05 was considered statistically significant.

[0097] 3. Results Analysis

[0098] 3.1 Differential expression of circCCDC50 in plasma

[0099] Three pairs of plasma samples from patients with bone metastasis and controls without bone metastasis were selected from the screening and testing cohorts. Tumor vesicles were isolated and subjected to deep circular RNA sequencing. Based on the sequencing results, the 10 circular RNAs with the greatest expression differences were selected using the criteria of |log2FC|>2.0 and P<0.05, such as Figure 1Subsequently, the expression levels of these 10 candidate circular RNAs in tumor vesicles of plasma samples were detected by qRT-PCR in the screening and testing cohorts. Figure 2 As shown in the results, the relative expression level of circCCDC50 in the tumor vesicles of the plasma of patients with luminal breast cancer bone metastasis was significantly higher than that of patients with luminal breast cancer without bone metastasis, and the expression difference was the most significant among the 10 candidate circular RNAs. Therefore, the expression level of circCCDC50 can be used to predict bone metastasis in patients with luminal breast cancer.

[0100] 3.2 Predictive value of plasma circCCDC50 for bone metastasis in patients with luminal breast cancer

[0101] To test the predictive value of plasma circCCDC50 for bone metastasis in patients with luminal breast cancer, 91 pairs of plasma samples from patients with luminal breast cancer bone metastasis and 117 controls without bone metastasis were collected. The expression level of circCCDC50 in the collected plasma samples was detected by qRT-PCR, and the ROC curve was drawn for analysis and comparison to investigate the predictive value of plasma circCCDC50 for bone metastasis in patients with luminal breast cancer. Figure 3 As shown, the receiver operating characteristic (ROC) curve showed that circCCDC50 expression levels could effectively distinguish between patients with and without bone metastasis. Specifically, the area under the curve (AUC) was 0.902, with a sensitivity of 81.11%, a specificity of 82.91%, and a 95% CI of 0.8618 to 0.9415. The difference in differentiation between the bone metastasis group and the non-bone metastasis group was significant (P < 0.0001). This suggests that plasma circCCDC50 can distinguish patients with and without bone metastasis from luminal breast cancer. Therefore, circCCDC50 is a good biomarker for the diagnosis of bone metastasis in luminal breast cancer and can be used for early diagnosis of bone metastasis in luminal breast cancer.

[0102] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. Use of circCCDC50 as a biomarker in the preparation of a product for the diagnosis / prediction of breast cancer bone metastasis; the nucleotide sequence of circCCDC50 is shown in SEQ ID NO: 1; the breast cancer is luminal breast cancer.

2. Use of a substance for detecting circCCDC50 in the preparation of a product for diagnosing / predicting bone metastasis of breast cancer, wherein the breast cancer is luminal breast cancer; The substance for detecting circCCDC50 is a circCCDC50-specific PCR primer; The nucleotide sequences of the PCR primers are shown in SEQ ID NOs: 2-3.

3. A system for early diagnosis / prediction of luminal breast cancer bone metastasis, characterized in that: The system comprises: Detection module: used to detect the expression level of circCCDC50 in patient samples and output the circCCDC50 expression data to the analysis module; Analysis module: Based on the expression level of circCCDC50, the diagnosis result is determined according to the predetermined rules; The nucleotide sequence of circCCDC50 is shown in SEQ ID NO:

1.

4. The system according to claim 3, characterized in that The predetermined rule is: when the expression level of circCCDC50 is detected to be higher than that of luminal breast cancer samples without bone metastasis, it is judged that the risk of bone metastasis of luminal breast cancer is high.

5. The system according to claim 3, wherein: Primers or a kit containing primers were used to detect the expression level of circCCDC50 in patient samples; The nucleotide sequences of the primers are shown in SEQ ID NOs: 2-3; The kit also includes an RNA extraction reagent, a reagent for RNA reverse transcription reaction, and a reagent for PCR reaction.

Citation Information

Patent Citations

  • CircRNA marker for breast cancer metastasis and / or prognosis and application

    CN114015774A

  • Application of circHIPK2 as breast cancer biomarker

    CN114921546A