Serum-free adipogenic differentiation method for porcine fat precursor cells

Abstract

The invention discloses a serum-free adipogenic differentiation method for porcine adipose precursor cells, and relates to the technical field of mammalian animal cell differentiation.In the adipogenic differentiation process, an induced differentiation culture medium and a maintained differentiation culture medium are sequentially used, and the induced differentiation culture medium is composed of a basic culture medium and cell culture auxiliary factors; the cell culture auxiliary factor is composed of 66nmol / L insulin, 33 [mu] mol / L biotin, 17 [mu] mol / L pantothenic acid, 0.1 [mu] mol / L dexamethasone, 0.25 mmol / L IBMX, 1 [mu] mol / L rosiglitazone, 150 [mu] mol / L sodium oleate and 10 [mu] g / mL transferrin; the maintenance differential medium removes IBMX and rosiglitazone on the basis of inducing the differential medium. The serum-free adipogenic differentiation method for the porcine fat precursor cells, provided by the invention, is good in differentiation effect and high in repeatability.

Description

Technical Field

[0001] The invention relates to the technical field of mammalian cell differentiation, and in particular to a serum-free adipogenic differentiation method for pig fat precursor cells. Background Art

[0002] Cultured meat is a new type of product similar to traditional animal meat, which is made by extracting muscle and adipose stem cells from livestock and poultry, proliferating stem cells and differentiating them into myoblasts / lipids in a bioreactor, and then collecting and processing the cells. Fat provides tenderness and juiciness to meat, affecting its texture and taste. In cultured meat, adipocytes are differentiated from adipose stem cells, and the fat content and composition of cultured meat can be more precisely controlled compared to traditional meat.

[0003] Adipocyte differentiation is a complex process involving the transformation of undifferentiated adipocyte precursor cells (adipose stem cells) into mature adipocytes rich in lipid droplets. This process is essential for normal adipose tissue development and function. Adipocyte differentiation is a multi-step process involving cell proliferation, exit from the cell cycle, lipid droplet formation, and lipid droplet maturation. Adipocyte differentiation is regulated by multiple factors, including transcription factors, hormones, nutrients, etc.

[0004] Serum is often added to cell culture media to provide nutrients required for cell growth and proliferation. However, the use of serum also has some potential hazards. Serum comes from animal blood, and there are significant differences between different batches of serum, which can lead to variability in cell culture results and affect repeatability. Serum may contain microorganisms, viruses and mycoplasma contamination, which can damage cells, lead to culture failure or have adverse effects on the safety of cell-cultured meat. Serum contains growth inhibitors that can inhibit cell proliferation and hinder the efficiency of cell culture. Heterologous proteins in serum may trigger immune responses and activate immune receptors in cells. The acquisition of serum usually involves the collection and slaughter of animals, which affects animal welfare and raises ethical concerns. In addition, serum is expensive, which is not conducive to reducing the cost of cell-cultured meat. In order to solve the above problems caused by serum, a serum-free adipogenic differentiation method is a feasible means. For example, the patent application document with publication number CN117721074A discloses a serum-free adipogenic induction method for poultry, which avoids the use of fetal bovine serum in poultry fat precursor cells with a specific formula. However, there are essential differences in the adipogenic differentiation of fat precursor cells between poultry and mammals. From the perspective of the fat synthesis pathways of mammals and poultry, mammals mainly synthesize triglycerides (fats) in adipose tissue, while poultry mainly synthesize triglycerides in the liver. The fat synthesis pathway of mammalian adipocytes is mainly de novo fat synthesis, which converts glucose into fatty acids and triglycerides and requires the participation of multiple enzymes and coenzymes, especially a high content of fatty acid synthase. In poultry adipocytes, because the content of fatty acid synthase is very low, the fat synthesis pathway is mainly lipid regeneration, which refers to the re-esterification of free fatty acids into triglycerides and storage in adipocytes. From the induction step, the adipogenic differentiation process of poultry precursor cells is usually cultured in a culture medium for about 6 days, while the adipogenic differentiation process of mammalian precursor cells is induced in stages using different culture media. For example, the induced differentiation process of porcine precursor adipocytes disclosed in the patent application document with publication number CN117625527A has a total induced differentiation time of 8 days, including three stages of culture: the first two days are carried out in adipogenic differentiation medium, the middle two days are carried out in maintenance differentiation medium, and the last four days are carried out in complete culture medium. It can be seen that the adipogenic differentiation process of fat precursor cells of birds and mammals is difficult to learn from each other. Although there are serum-free schemes to induce adipogenic differentiation of avian fat precursor cells, it is still unknown whether the adipogenic differentiation process of mammalian fat precursor cells can proceed smoothly in serum-free culture medium.

[0005] Therefore, there is an urgent need to develop a chemically clear, inexpensive, and highly efficient serum-free adipogenic differentiation method for mammalian fat precursor cells to address the current problems that hinder the industrialization of mammalian cell-cultured meat due to low differentiation efficiency and poor repeatability. Summary of the invention

[0006] In view of the above problems in the prior art, the present invention provides a serum-free adipogenic differentiation method of porcine fat precursor cells, which provides a new idea for solving the problem that the existing mammalian fat precursor cell adipogenic differentiation technology has low differentiation efficiency and poor repeatability, which hinders the industrialization process of mammalian cell-cultured meat.

[0007] The technical solution adopted by the present invention is as follows:

[0008] A serum-free adipogenic differentiation method for porcine adipocytes. In the adipogenic differentiation process of the porcine adipocytes, a serum-free adipogenic induction differentiation medium and a serum-free adipogenic maintenance differentiation medium are used successively. The serum-free adipogenic induction differentiation medium consists of a basal medium and a cell culture auxiliary factor, and the cell culture auxiliary factor consists of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 0.25 mmol / L IBMX, 1 μmol / L rosiglitazone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin; the serum-free adipogenic maintenance differentiation medium consists of a basal medium and a cell culture auxiliary factor, and the cell culture auxiliary factor consists of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin.

[0009] The purpose of the present invention is to provide a modified cell adipogenic induction / maintenance differentiation medium with clear chemical composition for in vitro adipogenic differentiation of adipocytes, wherein the modified cell adipogenic induction / maintenance differentiation medium does not contain serum components. The serum-free medium means that no animal serum components such as fetal bovine serum, calf serum, chicken serum, duck serum, horse serum, etc. are added. The modified cell adipogenic induction / maintenance differentiation medium is an adipogenic cell differentiation medium added with cell culture auxiliary factors, and the adipogenic inducer and serum components in the traditional adipogenic induction / maintenance differentiation medium of adipocytes are replaced by the addition of cell culture auxiliary factors; the basic culture medium contains a penicillin-streptomycin double antibody solution.

[0010] Preferably, the basal culture medium is one of DMEM and DMEM / F12 culture medium containing a penicillin-streptomycin dual antibody solution.

[0011] Furthermore, the serum-free adipogenic differentiation method of porcine adipocytes comprises the following steps:

[0012] (1) Porcine preadipocytes were cultured in vitro until the confluence reached 100%, and then cultured for 2 days. The proliferation medium was discarded and serum-free adipogenic differentiation medium was added. The day of adding serum-free adipogenic differentiation medium was marked as day 0. The medium was changed every other day for 4 days.

[0013] (2) Remove the serum-free adipogenic differentiation medium and add serum-free adipogenic maintenance differentiation medium. Continue differentiation for 4 days, changing the medium every other day.

[0014] Furthermore, the preparation process of the porcine adipocytes is as follows:

[0015] (1) Subcutaneous fat from the neck of a pig is taken, cut into minced meat, 1-3 mg / mL collagenase solution is added, and the mixture is transferred to a tissue dissociation tube. After being dissociated using a tissue dissociator, the mixture is placed in a 37° C. water bath and digested for 60-90 minutes, with the tissue dissociator used to dissociate the mixture once every 15-20 minutes; an equal volume of high-glucose DMEM containing 10% fetal bovine serum is then added to terminate the digestion, and the mixture is filtered using a 70-150 μm cell sieve, wherein the volume ratio of the minced meat to the collagenase solution is 1:5;

[0016] (2) Centrifuge the digestion solution at 800-1500 rpm at room temperature for 5-10 min, discard the supernatant, and retain the cell pellet;

[0017] (3) Add 3 to 5 times the volume of minced meat and red blood cell lysis buffer to the cell pellet for resuspending, lyse at room temperature for 5 to 10 minutes, then centrifuge, discard the supernatant, and retain the cell pellet;

[0018] (4) The cell pellet was resuspended in high-glucose DMEM containing 20% ​​FBS and inoculated into a cell culture dish. After subculturing, high-glucose DMEM containing 10% FBS was used as the complete culture medium.

[0019] A serum-free adipogenic differentiation medium for porcine adipocytes is composed of a basal medium and a cell culture auxiliary factor. The cell culture auxiliary factor is composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 0.25 mmol / L IBMX, 1 μmol / L rosiglitazone, 150 μmol / L sodium oleate and 10 μg / mL transferrin.

[0020] A serum-free adipogenic maintenance differentiation medium for porcine adipocytes, comprising a basal medium and a cell culture auxiliary factor, wherein the cell culture auxiliary factor comprises 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate and 10 μg / mL transferrin.

[0021] In summary, compared with the prior art, the present invention has the following advantages and beneficial effects:

[0022] 1. The porcine adipocyte serum-free adipogenic induction / maintenance differentiation medium provided by the present invention has a good adipogenic differentiation effect. Experimental studies have shown that after adipocytes are induced to differentiate in vitro for 8 days using the improved cell adipogenic induction / maintenance differentiation medium described in the present invention, lipid droplets appear in almost all cells, and the cell differentiation efficiency reaches more than 80%.

[0023] 2. The present invention provides a serum-free adipogenic differentiation medium and induction method suitable for pig fat precursor cells, which is of great significance for the study of the mechanism of fat development in pigs and even mammals and the preparation of cultured meat.

[0024] 3. The porcine fat precursor cell serum-free adipogenic induction / maintenance differentiation medium provided by the present invention does not contain any serum components and has clear chemical composition, which is convenient for promoting the industrialization process of cell cultured meat. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a microscopic image of the porcine adipocyte precursor cells prepared in Example 1;

[0026] Figure 2 This is a microscopic image of porcine preadipocytes in Example 2 after 8 days of serum-free adipogenic differentiation;

[0027] Figure 3 This is an Oil Red O-stained microscopic image of porcine adipocytes after 8 days of serum-free adipogenic differentiation in Example 2;

[0028] Figure 4 This is a statistical graph of triglyceride content of porcine adipocytes at 0, 2, 4, 6 and 8 days of serum-free adipogenic differentiation in Example 2;

[0029] Figure 5 The figure is a statistical graph of the fluorescence quantitative PCR results of porcine adipocytes at 0, 2, 4, 6 and 8 days of serum-free adipogenic differentiation in Example 2;

[0030] Figure 6 This is a graph showing the Western blot results of porcine preadipocytes at 0, 2, 4, 6 and 8 days of serum-free adipogenic differentiation in Example 2. DETAILED DESCRIPTION

[0031] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0032] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0033] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0034] The present application will be described in detail below with reference to embodiments and experimental data.

[0035] Example 1

[0036] This example explores the separation and culture of porcine adipocytes, and the specific operations are as follows:

[0037] (1) Obtain subcutaneous fat from the neck of a pig, cut it into minced meat, add 1-3 mg / mL collagenase solution, transfer it to a tissue dissociation tube, dissociate it using a tissue dissociator, place it in a 37°C water bath, digest it for 60-90 minutes, and dissociate it using a tissue dissociator every 15-20 minutes; then add an equal volume of high-glucose DMEM containing 10% fetal bovine serum to terminate the digestion, and filter it with a 70-150 μm cell sieve, wherein the volume ratio of the minced meat to the collagenase solution is 1:5;

[0038] (2) Centrifuge the digestion solution at 800-1500 rpm at room temperature for 5-10 min, discard the supernatant, and retain the cell pellet;

[0039] (3) Add 3-5 times the volume of minced meat and red blood cell lysis buffer to the cell pellet for resuspending, lyse at room temperature for 5-10 min, then centrifuge, discard the supernatant, and retain the cell pellet;

[0040] (4) The cell pellet was resuspended in high-glucose DMEM containing 20% ​​FBS and inoculated into a cell culture dish. After subculturing, high-glucose DMEM containing 10% FBS was used as the complete culture medium.

[0041] The results of observation under the microscope are as follows Figure 1 As shown, Figure 1It is not difficult to see that the above steps obtain irregular long spindle-shaped porcine adipocytes.

[0042] Example 2

[0043] This example explores the differentiation and culture process of porcine adipocytes and the detection of related processes. The specific operation of the culture process is as follows:

[0044] When the cell confluence reaches 100%, continue to proliferate and culture for 2 days, remove the proliferation medium, add porcine fat precursor cell serum-free adipogenic differentiation medium, record the day of adding the differentiation medium as 0 day, change the medium every 1 day, induce differentiation for 4 days, change to the maintenance differentiation medium, change the medium every 1 day, and maintain differentiation for 4 days. The differentiation medium consists of a basal medium and a cell culture auxiliary factor, the basal medium is a DMEM medium, and the cell culture auxiliary factor consists of 66nmol / L insulin, 33μmol / L biotin, 17μmol / L pantothenic acid, 0.1μmol / L dexamethasone, 0.25mmol / L IBMX, 1μmol / L rosiglitazone, 150μmol / L sodium oleate, and 10μg / mL transferrin. The maintenance differentiation medium consists of a basal medium and cell culture auxiliary factors, wherein the basal medium is a DMEM medium, and the cell culture auxiliary factors consist of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin.

[0045] The results of observation under the microscope are as follows Figure 2 As shown, Figure 2 It can be found that the pig adipocytes differentiated for 8 days are full of spherical lipid droplets, indicating that the result of adipogenic differentiation is relatively ideal and the cell differentiation efficiency reaches more than 80%.

[0046] In order to further verify the differentiation effect of porcine adipocytes in this example, the following steps were also tested:

[0047] (1) This step uses Oil Red O staining to indicate the differentiation effect. The specific operation is as follows:

[0048] After 8 days of differentiation, remove the differentiation medium and wash once with PBS; add 4% PFA to fix the cells for 30 minutes. Remove the fixative and add the staining solution to wash for 30 seconds. Remove the wash solution and add Oil Red O staining solution to stain for 15-20 minutes. Discard the Oil Red O staining solution and add PBS to wash 1-3 times; observe under a microscope and take pictures.

[0049] The results of observation under the microscope are as follows Figure 3 As shown, Figure 3It can be found that the lipid droplets in the cells differentiated for 8 days were dyed red, which further proves that the effect of adipogenic differentiation is good.

[0050] (2) This step explores the triglyceride content of pig adipocytes at different stages of differentiation. The specific operation is as follows:

[0051] Porcine adipocytes at 0, 2, 4, 6 and 8 days of differentiation were collected and the TAG content was determined using a Priligy cell triglyceride (TAG) assay kit. The statistical results are shown in Figure 4 As shown, the TAG content in the cells gradually increased with the increase of differentiation time, indicating that the adipocytes gradually matured.

[0052] (3) This step explores the gene expression levels at different stages of pig adipocyte differentiation. The specific operations are as follows:

[0053] Porcine adipocytes at 0, 2, 4, 6 and 8 days of differentiation were collected, and RNA was extracted using the Promega RNA extraction kit, reverse transcribed using the Nearbank protein reverse transcription kit, and the expression of differentiation-related genes was detected using the Abclonal SYBR fluorescence quantification kit.

[0054] The total reverse transcription system was 20 μL, 2×NovoScript plus 1st Strand cDNA SynthesisSuperMix 10 μL, RNA template 0.5 μg, gDNAPurge 1 μL, and the volume was supplemented to 20 μL with RNA-free ddH2O, and mixed by pipetting. The reaction program was 50°C for 15 min and 85°C for 5 s. The cDNA was stored at -20°C. Primers were designed using the pickprimer online website on the NCBI website. The specific primer information is shown in Table 1. 18S was used as the internal reference gene. The cDNA master solution was diluted 10 times and used for qPCR. The qPCR reaction was performed using the SYBR fluorescent quantitative kit from abclonal. The reaction system was: 2×UniversalSYBR Green FastqPCR Mix 10 μL, 0.5 μL each of forward and reverse primers, 2.0 μL of cDNA template, and 7 μL of ddH2O. Reaction program: pre-denaturation at 95°C for 3 min, cycle reaction at 95°C for 5 s, and 60°C for 30 s, for a total of 40 cycles. Melting curve was the default setting of the instrument.

[0055] Table 1 Primer sequences for fluorescence quantitative PCR

[0056] Gene Upstream primer sequence - F (5′→3′) Downstream primer sequence -R(5′→3′) PPARγ CCAGCATTTCCACTCCACACTA GACACAGGCTCCACTTTGATG CEBPα AGCCAAGAAGTCGGTAGA CGGTCATTGTCACTGGTC DGAT1 CCCACCATCCAGAACTCCAT CGGTCTCCAAACTGCATGAG ACC TCAGAAGGAGGAGGAGGGAA ATGACGGGACTGTTTGGCTA SREBP1C TTTCTGACCCGCTTCTTCCT ACGGAACAACTGAGTCACCT DGAT2 CCCTCATAGCTGCCTACTCC GAGGAAAGACAGGACCCACT SCD CTTCCTGATCATTGCCAACA GCAAACCACCCTTCTCTTTG FASN CTGATCAAGGTGCTGCTGTC CGAAGGAGTTTATGCCCACG LPL GTTGAGGACACTTGCCATCT CCTCTTGTATAGGGCAGCCAC FABP4 AAGAAGTGGGAGTGGGCTTT TTCCTGGCCCAATTTGAAGG 18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG

[0057] The results are as follows Figure 5As shown in the figure, the expression of genes related to adipogenic differentiation gradually increased with the extension of differentiation time. This further indicates at the molecular level that porcine adipocytes have successfully undergone adipogenic differentiation and formed mature adipocytes.

[0058] (4) This step explores the expression levels of differentiation-related proteins at different stages of pig adipocyte differentiation. The specific operations are as follows:

[0059] (1) Cell protein extraction

[0060] Discard the culture medium and rinse once with PBS. Add an appropriate amount of RIPA lysis buffer containing protease inhibitors. Place on ice for 10 minutes. Scrape the cells from the bottom of the well with a cell scraper. Collect the cell lysate in a 1.5mL centrifuge tube and centrifuge at 4℃, 12,000rpm for 30 minutes. Transfer the supernatant to a new 1.5mL centrifuge tube. The supernatant is the cell protein. Store at -80℃ for later use.

[0061] (2) Western blot

[0062] Take the protein out of the -80℃ freezer and place it on ice to thaw. Take 20μL of protein and mix it with 5μL of 5× protein loading buffer, then boil it at 100℃ for 10min to denature the protein. Prepare SDS-PAGE gel. Add 10μL of denatured protein to each lane, and reserve one lane to add 5μL of prestained protein marker. The electrophoresis conditions are set to 120V electrophoresis for 15min and 200V electrophoresis for 40min. After the electrophoresis, use the wet transfer method to set a constant current of 400mA and transfer to the PVDF membrane for about 30min. Place the PVDF membrane in an antibody incubation box containing blocking solution (5% skim milk) at room temperature for 1h. Add the primary antibody (1:5000 dilution) to the antibody incubation box and incubate overnight at 4℃. Wash the membrane 3 times with TBST, 10min each time. Add the secondary antibody (1:5000 dilution) to the antibody incubation box and incubate at room temperature for 1h. Wash the membrane 3 times with TBST, 10min each time. Use ECL chemiluminescent liquid for detection and use chemiluminescent imaging system to take pictures. The results are as follows Figure 6 As shown by Figure 6 It is not difficult to see that the expression levels of adipogenic differentiation-related proteins gradually increase with the increase of differentiation time. This result further illustrates at the molecular level that porcine fat precursor cells undergo adipogenic differentiation.

[0063] The above-mentioned embodiments only express the specific implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the protection scope of the present application. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the technical solution concept of the present application, and these all belong to the protection scope of the present application.

Claims

1. A serum-free adipogenic differentiation method of porcine adipocytes, characterized in that: In the adipogenic differentiation process of the porcine fat precursor cells, a serum-free adipogenic induction differentiation medium and a serum-free adipogenic maintenance differentiation medium are used successively. The serum-free adipogenic induction differentiation medium consists of a basal medium and a cell culture auxiliary factor, and the cell culture auxiliary factor consists of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 0.25 mmol / L IBMX, 1 μmol / L rosiglitazone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin; the serum-free adipogenic maintenance differentiation medium consists of a basal medium and a cell culture auxiliary factor, and the cell culture auxiliary factor consists of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin.

2. The serum-free adipogenic differentiation method of porcine adipocytes according to claim 1, characterized in that: The basic culture medium is one of DMEM and DMEM / F12 culture medium containing penicillin-streptomycin dual antibody solution.

3. The serum-free adipogenic differentiation method of porcine adipocytes according to claim 1, characterized in that: The steps include: (1) Porcine preadipocytes were cultured in vitro until the confluence reached 100%, and then cultured for 2 days. The proliferation medium was discarded and serum-free adipogenic differentiation medium was added. The day of adding serum-free adipogenic differentiation medium was marked as day 0. The medium was changed every other day for 4 days. (2) Remove the serum-free adipogenic differentiation medium and add serum-free adipogenic maintenance differentiation medium. Continue differentiation for 4 days, changing the medium every other day.

4. The serum-free adipogenic differentiation method of porcine adipocytes according to claim 3, characterized in that: The preparation process of the porcine adipocytes is as follows: (1) Subcutaneous fat from the neck of a pig is taken, cut into minced meat, 1-3 mg / mL collagenase solution is added, and the mixture is transferred to a tissue dissociation tube. After being dissociated using a tissue dissociator, the mixture is placed in a 37° C. water bath and digested for 60-90 minutes, with the tissue dissociator used to dissociate the mixture once every 15-20 minutes; an equal volume of high-glucose DMEM containing 10% fetal bovine serum is then added to terminate the digestion, and the mixture is filtered using a 70-150 μm cell sieve, wherein the volume ratio of the minced meat to the collagenase solution is 1:5; (2) Centrifuge the digestion solution at 800-1500 rpm at room temperature for 5-10 min, discard the supernatant, and retain the cell pellet; (3) Add 3 to 5 times the volume of minced meat and red blood cell lysis buffer to the cell pellet for resuspending, lyse at room temperature for 5 to 10 minutes, then centrifuge, discard the supernatant, and retain the cell pellet; (4) The cell pellet was resuspended in high-glucose DMEM containing 20% ​​FBS and inoculated into a cell culture dish. After subculturing, high-glucose DMEM containing 10% FBS was used as the complete culture medium.

5. A serum-free adipogenic differentiation medium for porcine adipocytes, characterized in that: The serum-free adipogenic differentiation medium is composed of a basal medium and cell culture auxiliary factors, wherein the cell culture auxiliary factors are composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 0.25 mmol / L IBMX, 1 μmol / L rosiglitazone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin.

6. A serum-free adipogenic differentiation medium for porcine adipocytes, characterized in that: The serum-free adipogenic differentiation maintenance medium consists of a basal medium and a cell culture auxiliary factor, wherein the cell culture auxiliary factor consists of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin.

Images