A gene associated with corn kernel quality and its use
By using gene editing technology to inhibit the expression of the ZmASN2 gene in corn kernels, the amino acid and starch content were increased, the problem of low quality of corn kernels was solved, and high yield and high quality of corn kernels were achieved.
Patent Information
- Application Number
- CN202411972811.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-12-30
AI Technical Summary
The amino acid and starch contents in ordinary corn kernels are low, which affects its value as a source of high-quality protein and its application value.
Through gene editing technology, a knockout or low expression vector was constructed to inhibit the expression of the ZmASN2 gene in corn kernels, thereby increasing the amino acid and starch content, including asparagine, tryptophan, phenylalanine, histidine, arginine and serine, as well as the content of straight-chain and amylopectin.
It increases the amino acid and starch content of corn kernels, reduces plant height and ear height, improves corn yield and quality, and enhances the variety's tolerance to high density.
Smart Images

Figure CN119685344B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular genetics, and particularly relates to a gene related to the quality of corn kernels and application thereof. BACKGROUND
[0002] Starch is the main product of photosynthesis in most higher green plants, and is the main storage material in corn kernels. Starch is the main source of energy for humans and animals, and is not only used for daily diet, but also applied to food processing, new energy development, and medicine preparation, and is an important raw material in food, feed, and industry. Starch is mainly stored in the seeds of plants, and in the tubers of rhizome crops, and a small amount exists in stems, leaves, fruits, and pollen.
[0003] The starch content in common corn kernels may be affected by many factors during growth, such as insufficient light and temperature during the development stage, and lack of water and fertilizer during the filling period, resulting in a decrease in starch content.
[0004] Corn kernels are composed of embryos, endosperms, seed coats, and the like, and the endosperm is the largest component in corn kernels, and amino acids are mainly stored in the aleurone layer of the endosperm. In common corn kernels, the contents of limiting amino acids such as methionine, lysine, and tryptophan affecting the growth and development of monogastric animals are low, so common corn can only be used as a feed providing energy, and cannot be used as a high-quality protein source. Amino acid composition and content play a key role in the nutritional quality of corn, and are divided into three categories from the perspective of nutrition, i.e., essential amino acids, semi-essential amino acids, and non-essential amino acids. Due to the lack of essential amino acids, especially lysine and tryptophan, the endosperm protein quality of corn is poor, which seriously affects the application value and application range of corn, and it is particularly important to study the quality of corn kernels, i.e., protein and amino acid content.
[0005] Therefore, it is urgent to provide a gene capable of improving the quality of corn kernels. SUMMARY
[0006] The application aims to provide a gene related to the quality of corn kernels, and improve the amino acid content and starch content of corn kernels.
[0007] The technical scheme adopted by the application is as follows:
[0008] The application provides a gene related to the quality of corn kernels, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
[0009] The application provides an application of the gene, and the gene is used to improve the amino acid content of corn kernels.
[0010] Preferably, the amino acid content includes at least one of asparagine content, tryptophan content, phenylalanine content, histidine content, arginine content and serine content.
[0011] Preferably, the gene is used to increase the starch content of corn kernels.
[0012] Preferably, the starch content is the amylose content and / or the amylopectin content.
[0013] Preferably, the gene is used to reduce plant height and ear height of corn.
[0014] Preferably, the expression of the gene is inhibited by constructing a knockout vector or a low expression vector to improve the quality of corn kernels.
[0015] Preferably, the method for constructing the knockout vector or low expression vector includes homologous recombination, RNA interference technology, TALEN technology, Gateway technology or CRISPR / Cas9 system.
[0016] The present invention also provides a host cell, which contains the knockout vector or low expression vector.
[0017] Preferably, the method for constructing the host cell includes microinjection, liposome transfection, calcium phosphate co-precipitation or Agrobacterium-mediated transformation.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] The present invention provides a gene related to corn kernel quality, the nucleotide sequence of which is shown in SEQ ID NO. 1. The gene provided by the present invention has the function of regulating the contents of asparagine, tryptophan, phenylalanine, histidine, arginine and serine, and the contents of amylose, amylopectin and total starch in corn kernels.
[0020] The knockout mutant of the gene created by the gene editing technology of the present invention increases the content of asparagine, tryptophan, phenylalanine, histidine, arginine, serine, amylose, amylopectin and total starch in corn grains, while unexpectedly reducing plant height and ear height, which is beneficial to simultaneously increase corn yield and quality, and improve the variety's density tolerance. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Results of QTL mapping for aspartyl content in maize kernels.
[0022] Figure 2 is the genotype after gene editing.
[0023] Figure 3Comparison of grain starch content between ZmASN2 wild type WT and knockout lines KO-1 and KO-2.
[0024] Figure 4 Comparison of amino acid content between ZmASN2 wild type WT and knockout lines KO-1 and KO-2. DETAILED DESCRIPTION
[0025] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.
[0026] The inventive concept of the present invention is as follows:
[0027] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.
[0028] Experimental method: The amino acid content of corn kernels was detected by hydrolysis method.
[0029] (1) Principle: Protein is hydrolyzed into amino acids by hydrochloric acid, separated by ion exchange column, and then reacts with ninhydrin solution to produce a color reaction. The amino acid content is then determined by spectrophotometry.
[0030] (2) Reagents:
[0031] 6mol / L hydrochloric acid: Mix 12mol / L high-grade pure concentrated hydrochloric acid and water in a volume ratio of 1:1.
[0032] Buffer for amino acid analyzer: four sodium citrate buffers, pH: 3.3, 3.2, 4.0, 4.9.
[0033] The reaction solution for amino acid analyzer: ninhydrin and its buffer solution are prepared by the instrument manager.
[0034] (3) Sample pretreatment, as follows:
[0035] Accurately weigh a certain amount of uniform sample to the nearest 0.0001 g and place it in a hydrolysis tube. Add 6 mol / L HCl to the hydrolysis tube and mix.
[0036] Seal the tube with an alcohol burner and place in a 110°C thermostat for 22 hours. Cool to room temperature. Open the tube, filter the hydrolyzate, rinse several times with deionized water, and dilute to a 50mL volumetric flask. Pipette 1mL of the filtrate and dry it at 65°C with the lid open for two days to remove the solvent. Finally, dissolve it in 1mL of 0.02N HCl. Pass the sample through a 0.22μm filter membrane before testing.
[0037] (4) Calculation of amino acid content of samples is as follows:
[0038]
[0039] Where:
[0040] X: amino acid content in the sample, in g / 100g;
[0041] C: amino acid content in the test solution, unit is ng / 20μL;
[0042] F: sample dilution factor;
[0043] V: volume after hydrolysis, in mL;
[0044] M: sample mass, in g.
[0045] (5) Starch testing steps are as follows:
[0046] 5.1 Extraction: Accurately weigh 0.1000 g of defatted sample and place it in a 50 mL volumetric flask. Add 10 mL of 1 mol / L potassium hydroxide solution and fully dissolve it in a 75°C water bath for 20 min. After cooling, dilute to the mark with distilled water, shake well, let it stand for 15 min, and then filter.
[0047] 5.2 Determination: Take 5 mL of the filtrate and place it in a 50 mL volumetric flask. Add 25 mL of distilled water and adjust the pH to 3.0 with 0.1 mol / L hydrochloric acid solution. Add 0.5 mL of iodine reagent and dilute to the mark with distilled water. After standing at room temperature for 25 minutes, use the sample blank solution as a control and use a 1 cm colorimetric cup to measure the absorbance values Aλ1, Aλ2, Aλ3, and Aλ4 of the sample solution λ1, λ2, λ3, and λ4 respectively to obtain the △A sample. 直 , △A sample 支 , and then compared quantitatively with the standardized series.
[0048] 5.3 The standard curve is drawn as follows:
[0049] 5.3.1 Select the measurement wavelength and reference wavelength for amylose and amylopectin.
[0050] Pipette 1.0 mL and 5.0 mL of standard stock solutions of amylose and amylopectin, respectively, into a 50 mL volumetric flask. Add 25 mL of distilled water, adjust the pH to 3.0 with 0.1 mol / L hydrochloric acid solution, add 0.5 mL of iodine reagent, and bring to volume with distilled water. Let the solution stand at room temperature for 25 minutes. Using distilled water as a blank, perform a full-band visible light scan using a double-beam spectrophotometer to plot the absorption curves of amylose and amylopectin. Determine the measurement wavelengths λ1 and λ2 for amylose and amylopectin, as well as the reference wavelengths λ3 and λ4.
[0051] 5.3.2 Drawing of dual-wavelength amylose standard curve.
[0052] Pipette 0.3mL, 0.5mL, 0.7mL, 0.9mL, 1.1mL, and 1.3mL of amylose standard stock solution into a 50mL volumetric flask. Add 25mL of distilled water, adjust the pH to 3.0 with 0.1mol / L hydrochloric acid solution, add 0.5mL of iodine reagent, and distilled water to volume. After standing at room temperature for 25 minutes, use distilled water as a blank and measure Aλ1 and Aλ3 at wavelengths λ1 and λ3 in a 1cm cuvette to obtain △A. 直 =Aλ1-Aλ3, with △A 直 The vertical axis is amylose concentration, mg / mL is the horizontal axis, and a dual-wavelength amylose standard curve is prepared.
[0053] 5.3.3 Drawing of dual-wavelength pullulan standard curve.
[0054] Pipette 2.0mL, 2.5mL, 3.0mL, 3.5mL, 4.0mL, 4.5mL, and 5.0mL of the pullulan standard stock solution into a 50mL volumetric flask. The following steps are the same as in 5.3.2. Using distilled water as a blank, measure Aλ2 and Aλ4 at wavelengths λ2 and λ4 using a 1cm cuvette, respectively, to obtain △A. 支 =Aλ2-Aλ4, with △A 支 The vertical axis is the abscissa, and the amylopectin concentration, mg / mL, is the horizontal axis. A dual-wavelength amylopectin standard curve is prepared.
[0055] 5.4. The results are calculated as follows:
[0056] The contents of amylose and amylopectin in 100 g of fresh corn kernels were calculated according to formula (1) and formula (2), respectively.
[0057] Formula (1):
[0058] Formula (2):
[0059] Where:
[0060] Y1: the content of amylose in the sample, in g / 100g;
[0061] Y2: amylopectin content in the sample, in g / 100g;
[0062] C1: the concentration of amylose in the sample solution obtained from the standard curve, in mg / mL;
[0063] C2: the concentration of amylopectin in the sample solution obtained from the standard curve, in mg / mL;
[0064] M1: The mass of the defatted sample used for measurement, in g;
[0065] W1: moisture content in the sample, in g / 100g;
[0066] W2: crude fat content in the sample, in g / 100g;
[0067] The calculation result is rounded to 2 decimal places.
[0068] Example 1
[0069] A gene associated with corn kernel quality, as follows:
[0070] The present invention is analyzed by GWAS, and the results are shown in Figure 1 , a gene related to the amino acid and starch content of maize kernels, ZmASN2, was found at the same location in both populations. This gene is located on chromosome 3 of the maize genome at 225163653bp to 235330494bp. In the B73 reference genome, the ID number for version v3 is GRMZM2G093175, the ID number for version v4 is Zm00001d044608, and the ID number for version v5 is Zm00001eb163240. The two populations used in this study were the CUBIC population of 1400 families and the natural population of 513 families. The nucleotide sequence of ZmASN2 is shown in SEQ ID NO. 1.
[0071] SEQ ID NO.1:
[0072]
[0073] Example 2
[0074] An application of a gene related to corn kernel quality, specifically as follows:
[0075] To further verify the function of the ZmASN2 gene, the present invention used CRISPR / Cas9 gene editing technology to knock out the ZmASN2 gene and investigated the trait performance of corn after knockout.
[0076] Gene editing was performed using conventional techniques commonly used in the art. The target sequence for editing was shown in SEQ ID NO. 2, and the maize recipient for the gene editing was KN5585. The resulting gene-edited materials, KO-1 and KO-2, were subjected to grain trait investigation and starch content testing.
[0077] SEQ ID NO. 2: CGACCAGCCCCTCTACAACG.
[0078] The grain phenotypes of the gene-edited accessions are shown in Table 1; the agronomic phenotypes of the gene-edited accessions are shown in Table 2. The results showed that the 100-grain weight of the WT accessions was 26.07 g, while that of KO-1 was 28.49 g, representing a 9.28% increase compared to the WT, a nonsignificant difference. The 100-grain weight of KO-2 was 25.50 g, representing a 2.19% decrease compared to the WT, a nonsignificant difference. Regarding grain length, thickness, and width, the grain length of the WT accessions ranged from 8.56 mm to 9.82 mm, with an average of 9.17 mm. The grain length of KO-1 ranged from 8.24 mm to 9.67 mm, with an average of 9.13 mm. The grain length of KO-1 was slightly smaller than that of the WT, with no significant difference. The grain length of KO-2 ranged from 7.60 mm to 9.32 mm, with an average of 8.51 mm. The grain length of KO-2 was significantly smaller than that of the WT, a highly significant difference. The grain thickness of WT ranged from 4.61 mm to 6.19 mm, with an average of 5.38 mm. The grain thickness of KO-1 ranged from 5.18 mm to 6.43 mm, with an average of 5.66 mm. There was no significant difference between KO-1 and WT. The grain thickness of KO-2 ranged from 4.58 mm to 6.37 mm, with an average of 5.49 mm. There was no significant difference between KO-2 and WT in grain thickness. The grain width of WT ranged from 7.28 mm to 9.33 mm, with an average of 8.23 mm. The grain width of KO-1 ranged from 8.45 mm to 9.02 mm, with an average of 8.65 mm. The grain width of KO-1 was slightly larger than that of WT, but there was no significant difference. The grain width of KO-2 ranged from 8.01 mm to 9.02 mm, with an average of 8.41 mm. There was no significant difference between KO-2 and WT in grain width.
[0079] Analysis of agronomic traits of KO-1, KO-2, and WT revealed that the average stem diameter of WT was 1.16 cm, KO-1 was 1.25 cm, and KO-2 was 1.32 cm, with no significant differences between KO-1, KO-2, and WT. Regarding 100-grain weight, WT was 26.07 g, while KO-1 was 28.49 g, representing a 9.28% increase compared to WT, with no significant difference. KO-2 was 25.50 g, representing a 2.19% decrease compared to WT, with no significant difference. Regarding ear length, ear diameter, number of rows per ear, and number of kernels per row, the average ear length of WT in 2022 was 107.87 mm, while that of KO-1 was 104.10 mm, with no significant difference between KO-1 and WT. The average ear length of KO-2 was 101.65 mm, with no significant difference between KO-1 and WT. The average ear diameter of the WT was 40.98 mm, while the average ear diameter of the KO-1 was 42.18 mm, with no significant difference between KO-1 and WT. The average ear diameter of the KO-2 was 37.96 mm, also with no significant difference between WT and WT. The average number of ear rows of the WT was 12.80, while the average number of ear rows of the KO-1 was 12.20, with no significant difference between KO-1 and WT. The average number of ear rows of the KO-2 was 11.00, with a significant difference between WT and WT. The average number of grains per row of the WT was 17.00, while the average number of grains per row of the KO-1 was 16.10, while the average number of grains per row of the KO-2 was 14.70. There were no significant differences between KO-1 and KO-2 and WT. In terms of ear height, the average ear height of WT was 34.60 cm, the average ear height of KO-1 was 32.70 cm, and the average ear height of KO-2 was 30.40 cm. There was no significant difference among KO-1, KO-2 and WT.
[0080] By analyzing the gene sequence of the target site, it was found that the gene sequence after KO-2 editing caused the increase of 2 bases AC, and the gene sequence after KO-1 editing caused the decrease of 33 bases AACGAGGACCAGTCGGTGGTCGTCGCCGTCA, see Figure 2 , which results in truncation of the starch coding sequence.
[0081] The starch and amino acid contents of WT, KO-1 and KO-2 were tested. Figure 3 and Figure 4 The contents of amylose, straight chain starch and total starch in KO-1 and KO-2 were significantly higher than those in W; the contents of serine, tyrosine and aspartic acid in KO-1 and KO-2 were significantly higher than those in WT.
[0082] Table 1. Grain phenotypes of gene-edited materials
[0083] Material Length of grain, mm Width of grain, mm Thickness of grain, mm Hundred-grain weight, g WT 9.17±0.13 8.23±0.58 5.38±0.46 26.07±1.08 KO-1 9.13±0.14 8.65±0.05 5.66±0.15 28.49±0.17 KO-2 8.51±0.17** 8.41±0.09 5.49±0.19 25.50±1.22
[0084] Phenotypes are expressed as mean ± standard error, ** represents p value less than 0.01 in student-t test, * represents p less than 0.05.
[0085] Table 2 Phenotypes of agronomic traits of gene editing materials
[0086] Material Stem diameter, cm Ear length, cm Ear diameter, cm Ear weight, g Number of ear rows Number of grains per row Height of ear, cm WT 1.16±0.10 10.79±0.56 4.10±0.13 68.39±1.13 12.80±0.44 17.00±1.64 34.60±1.20 KO-1 1.25±0.10 10.41±0.33 4.22±0.13 72.13±1.69 12.20±0.70 16.10±0.75 32.70±1.58 KO-2 1.32±0.10 10.16±0.49 3.80±0.10 57.90±1.58 11.00±0.68* 14.70±1.25 29.10±1.74
[0087] Phenotypes are expressed as mean ± standard error, ** represents p value less than 0.01 in student-t test, * represents p less than 0.05.
[0088] The technical features of the above-described embodiments can be combined arbitrarily. In order to make the description simple, all possible combinations of the technical features in the above-described embodiments are not described, however, as long as the combinations of the technical features do not exist contradictory, they should be considered as the scope of the description.
[0089] The above-described embodiments only express several implementation manners of the present application, the description is more specific and detailed, however, it should not be understood as the limitation to the scope of the patent. It should be pointed out that, for the ordinary skilled in the art, several modifications and improvements can be made without departing from the concept of the present application, and these belong to the protection scope of the present application.
Claims
1. An application of a gene related to corn kernel quality, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.1; the corn kernel quality is the amino acid content and starch content of the corn kernel; Knocking out the gene increases the amino acid content of corn kernels; the amino acids are serine, tyrosine, and aspartic acid.
2. The use according to claim 1, characterized in that Knocking out the gene to increase the starch content of corn kernels; The starch is amylose and / or amylopectin.
3. The use according to claim 1, characterized in that The expression of the gene is suppressed by constructing a knockout vector or a low expression vector to improve the quality of corn kernels; The method for constructing the knockout vector or low expression vector is homologous recombination, RNA interference technology, TALEN technology, Gateway technology or CRISPR / Cas9 system.
4. An application of a gene related to corn plant height and ear height, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.1; The application refers to knocking out the gene to reduce the plant height and ear height of corn.
Citation Information
Patent Citations
Application of aspartic protease 1 and coding gene thereof in regulation and control of photosynthesis, yield and protein content of wheat
CN116536290A
Mutant histidine decarboxylase and use thereof
WO2018168801A1