Use of ncgl0762 protein and mutants thereof in the production of l-isoleucine

By mutating the NCgl0762 protein and constructing a fusion protein, the problem of low isoleucine production was solved, and the yield and purity of isoleucine were improved.

CN119708180BActive Publication Date: 2026-03-10NINGXIA EPPEN BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411981158.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2026-03-10
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

The yield of isoleucine in existing technologies is low and difficult to meet demand.

Method used

By mutating the NCgl0762 protein, especially by mutating the serine residue at position 64 to a phenylalanine residue, or by substituting, deleting, or adding amino acid sequences with proteins of high identity and function, and attaching tags at the N-terminus or C-terminus, fusion proteins can be constructed, and the production of isoleucine can be increased using recombinant vectors and microbial expression technologies.

Benefits of technology

It significantly improved the yield and purity of isoleucine and enhanced the ability to regulate the product.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005221584210000121
    Figure BDA0005221584210000121
Patent Text Reader

Abstract

The application discloses application of NCgl0762 protein and mutants thereof in production of L-isoleucine and belongs to the technical field of biotechnology.The application solves the technical problem of how to improve the yield of L-isoleucine.The sequence of the disclosed protein is SEQ ID No.4 or SEQ ID No.2.The yield of L-isoleucine can be improved by replacing the coding gene of the protein shown in SEQ ID No.2 with the coding gene of the protein shown in SEQ ID No.4 or improving the content or activity of the protein shown in SEQ ID No.2 or SEQ ID No.4 in the original biological cell.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of NCgl0762 protein and its mutants in the production of L-isoleucine. Background Technology

[0002] L-Isoleucine (chemical name 2-amino-3-methylbutyric acid) is a branched-chain amino acid and one of the eight essential amino acids for the human body. It plays an important role in promoting normal growth, repairing tissues, regulating blood sugar, and providing energy. It has wide applications in the manufacture of pharmaceuticals, food and health products, animal feed, and cosmetics.

[0003] Microbial fermentation is currently the main method for isoleucine production. Commonly used production strains include *Escherichia coli*, *Bacillus subtilis*, and mutant strains. Through gene sequencing technology, key enzymes in the isoleucine synthesis pathway can be introduced into high-yield strains, thereby increasing isoleucine production. This method not only improves isoleucine production but also allows for the regulation of product purity and structure. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to increase the yield of isoleucine.

[0005] To solve the above-mentioned technical problems, the present invention first provides a protein mutant, wherein the protein mutant contains the following A1), A2), or A3):

[0006] A1) The protein obtained by mutating the protein shown in SEQ ID No. 2, wherein the mutation site is the serine residue at position 64 of SEQ ID No. 2;

[0007] A2) A protein whose amino acid sequence of the protein described in A1) is replaced and / or deleted and / or added with one or more amino acid residues and has more than 98% identity with A1) and has the same function.

[0008] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0009] The amino acid residue resulting from the mutation of the serine residue at position 64 of SEQ ID No. 2 in A1) above can be a phenylalanine residue, but is not limited to a phenylalanine residue.

[0010] Specifically, the protein in A1) above is the protein shown in SEQ ID No. 4.

[0011] The protein in A2) above refers to a protein that shares more than 98% amino acid sequence identity with the protein described in A1) and has the same function. Identity refers to the similarity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences, the identity value (%) can then be obtained. The statement "more than 98% identity" means 98% or 99% identity.

[0012] The protein in A2) above may specifically be the protein shown in SEQ ID No. 2.

[0013] The proteins mentioned in A2 above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0014] The gene encoding the protein in A2) above can be obtained by deleting one or more amino acid residues from the codon of the DNA sequence shown in SEQ ID No. 3, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag coding sequence to its 5′ and / or 3′ ends, as shown in SEQ ID No. 1. The DNA molecule shown in SEQ ID No. 3 encodes the protein shown in SEQ ID No. 4, and the DNA molecule shown in SEQ ID No. 1 encodes the protein shown in SEQ ID No. 2.

[0015] The tag described in A3) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0016] In one embodiment of the present invention, the protein mutant shown is the protein shown in SEQ ID No. 4.

[0017] In another embodiment of the present invention, the protein mutant shown is the protein shown in SEQ ID No. 2.

[0018] The present invention also provides biomaterials related to said protein, said biomaterials comprising any one of the following B1) to B4):

[0019] B1) The nucleic acid molecule that encodes the protein;

[0020] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0021] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0022] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

[0023] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0024] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the protein of the present invention, as long as they encode the protein and have the same protein function, are derived from and equivalent to the nucleotide sequence of the present invention.

[0025] In the aforementioned biological materials, the nucleic acid molecule described in B1) may contain the following b11) or b12):

[0026] b11) A DNA molecule containing the coding sequence shown in SEQ ID No. 3;

[0027] The nucleotide sequences defined by b12) and b11) have 75% or more identity and encode the DNA molecule of the protein.

[0028] b11) can be a DNA molecule whose sequence contains SEQ ID No. 3.

[0029] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0030] The aforementioned 75% or higher identity can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0031] b12) can be the DNA molecule shown in SEQ ID No. 1.

[0032] B1) The nucleic acid molecule may be the DNA molecule shown in SEQ ID No. 3 or the DNA molecule shown in SEQ ID No. 1.

[0033] In the aforementioned biological materials, the expression cassette (gene expression cassette of the protein) containing a nucleic acid molecule encoding the protein described in B2) refers to DNA capable of expressing the protein in a host cell. This DNA may include not only a promoter to initiate gene transcription of the protein but also a terminator to terminate gene transcription of the protein. Furthermore, the expression cassette may also include an enhancer sequence.

[0034] B2) The promoter in the expression box may contain, or may be, as follows: b21) or b22):

[0035] b21) The DNA molecule shown in positions 21-70 of SEQ ID No. 7 in the sequence listing;

[0036] DNA molecules that have 75% or more identity with the nucleotide sequences defined by b22) and b21) and have promoter function.

[0037] In one embodiment of the present invention, the expression box B2) may be as shown in bits 21-295 of SEQ ID No. 7 or bits 21-295 of SEQ ID No. 8.

[0038] Recombinant vectors containing the protein expression cassette can be constructed using existing expression vectors.

[0039] In the aforementioned biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid can be the pK18mobsacB vector or the pXMJ19 vector.

[0040] B3) The recombinant vector may be pK18-NCgl0762. S64F pK18-NCgl0762 S64F The recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1156 of SEQ ID No. 5 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0041] B3) The recombinant vector may be pXMJ19-NCgl0762 or pXMJ19-NCgl0762. S64F pXMJ19-NCgl0762 is a recombinant vector obtained by inserting the gene expression cassette of the protein shown in positions 37-311 of SEQ ID No. 10 into the pXMJ19 vector. S64F The recombinant vector is obtained by inserting the gene expression cassette of the protein shown in positions 37-311 of SEQ ID No. 11 into the pXMJ19 vector.

[0042] In the aforementioned biological materials, the microorganisms may be at least bacteria, but may also be yeast, algae, or fungi. Specifically, the bacteria may be at least *Corynebacterium glutamicum*. The bacteria may also be *Escherichia coli*, *Pantoea ananatis*, *Bacillus brevis*, or *Brevis lactobacillus*.

[0043] In one embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032.

[0044] B4) The recombinant microorganism may be a recombinant microorganism obtained by replacing the coding gene of the protein shown in SEQ ID No. 4 (such as the gene shown in SEQ ID No. 3) in the starting microorganism with the coding gene of the protein shown in SEQ ID No. 2 (such as the gene shown in SEQ ID No. 1), or it may be a recombinant microorganism obtained by expressing the protein in the starting microorganism, or by increasing the content or activity of the protein in the starting microorganism.

[0045] In embodiments of the present invention, the recombinant microorganisms are recombinant bacteria YPI-0762-1, YPI-0762-2, YPI-0762-3, YPI-0762-4, YPI-0762-5, YPI-0762-6, YPI-0762-7, YPI-0762-8, YPI-0762-9, and YPI-0762-10.

[0046] The recombinant strain YPI-0762-1 is a strain obtained by replacing the gene shown in SEQ ID No. 1 of Corynebacterium glutamicum CGMCC20437 with the gene shown in SEQ ID No. 3.

[0047] The recombinant strain YPI-0762-2 is a strain obtained by replacing the gene shown in SEQ ID No. 1 of Corynebacterium glutamicum ATCC13032 with the gene shown in SEQ ID No. 3.

[0048] The recombinant strain YPI-0762-3 was obtained by inserting the gene expression cassette shown in positions 21-295 of SEQ ID No. 7 into the poxB site of the genome of Corynebacterium glutamicum CGMCC20437.

[0049] The recombinant strain YPI-0762-4 was obtained by inserting the gene expression cassette shown in positions 21-295 of SEQ ID No. 8 into the poxB site of the genome of Corynebacterium glutamicum CGMCC20437.

[0050] The recombinant strain YPI-0762-5 was obtained by inserting the gene expression cassette shown in positions 21-295 of SEQ ID No. 7 into the poxB site of the genome of Corynebacterium glutamicum ATCC13032.

[0051] The recombinant strain YPI-0762-6 was obtained by inserting the gene expression cassette shown in positions 21-295 of SEQ ID No. 8 into the poxB site of the genome of Corynebacterium glutamicum ATCC13032.

[0052] The recombinant bacteria YPI-0762-7 is a recombinant bacteria obtained by introducing the recombinant vector pXMJ19-NCgl0762 into Corynebacterium glutamicum CGMCC 20437.

[0053] The recombinant bacteria YPI-0762-8 is derived from the recombinant vector pXMJ19-NCgl0762. S64F Recombinant bacteria obtained by introducing Corynebacterium glutamicum CGMCC 20437.

[0054] The recombinant strain YPI-0762-9 is a recombinant strain obtained by introducing the recombinant vector pXMJ19-NCgl0762 into Corynebacterium glutamicum ATCC13032.

[0055] The recombinant bacteria YPI-0762-10 is derived from the recombinant vector pXMJ19-NCgl0762. S64F Recombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032.

[0056] The present invention also provides a method for producing isoleucine (such as L-isoleucine), the method comprising X1) or X2):

[0057] X1) Replace the coding gene of the protein shown in SEQ ID No. 2 in the starting bacteria with the coding gene of the protein shown in SEQ ID No. 4 to obtain recombinant bacteria; culture the recombinant bacteria to obtain isoleucine;

[0058] X2) Express the protein in the starting organism cells, or increase the content or activity of the protein in the starting organism cells to obtain recombinant organism cells; culture the recombinant organism cells to obtain isoleucine;

[0059] The starting organism cells are bacteria, yeast, algae, or fungi capable of synthesizing isoleucine.

[0060] The originating bacteria contain the coding gene for the protein shown in SEQ ID No. 2, or the DNA molecule shown in SEQ ID No. 1.

[0061] The originating bacteria can be at least bacteria. The bacteria can be at least Corynebacterium glutamicum, such as Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032.

[0062] The bacteria of this invention include, but are not limited to, Corynebacterium glutamicum. Any bacterium containing the L-isoleucine synthesis pathway can utilize the proteins and related biological materials of this invention to produce L-isoleucine. The bacteria can be at least Corynebacterium glutamicum. The bacteria can also be Escherichia coli, Pantoea ananatis, Bacillus brevis, or Brevis lactobacillus.

[0063] The method described above (X2) can be achieved by introducing the gene encoding the protein into the starting organism's cells and allowing it to be expressed.

[0064] In the above method, the recombinant biological cells (or recombinant bacteria) can be cultured using a culture medium that enables the recombinant biological cells (or recombinant bacteria) to grow;

[0065] And / or, the recombinant biological cells (or the recombinant bacteria) are cultured under conditions that enable the recombinant biological cells (or the recombinant bacteria) to grow.

[0066] The recombinant biological cells may be the recombinant microorganisms described above. The recombinant bacteria may also be the recombinant microorganisms described above.

[0067] The application of the protein or the biomaterial in the production of isoleucine, or in the preparation of products for the production of isoleucine, is also within the scope of protection of this invention.

[0068] The protein or biomaterial of this invention can be used to produce a variety of products, including but not limited to isoleucine (such as L-isoleucine) in the examples. The produced amino acids may also be glutamic acid, valine, glycine, alanine, leucine, lysine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, and citrulline. The production of various target products can be achieved by placing the protein of this invention into the target product synthesis pathway.

[0069] The proteins and their biomaterials of the present invention can be used to produce isoleucine. Replacing the coding gene of the protein shown in SEQ ID No. 2 in the starting organism cell with the coding gene of the protein shown in SEQ ID No. 4, or increasing the content or activity of the protein shown in SEQ ID No. 2 or SEQ ID No. 4 in the starting organism cell, can increase the yield of isoleucine.

[0070] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0071] Instructions for the Preservation of Biological Materials

[0072] Classification and nomenclature: Corynebacterium glutamicum

[0073] Strain number: YPILE001

[0074] Name of depositary institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0075] Abbreviation of depositary institution: CGMCC

[0076] Address of the depository: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Postcode: 100101

[0077] Date of preservation: August 17, 2020

[0078] CGMCC Registration Number: CGMCC No. 20437 Detailed Implementation

[0079] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available. SPSS 11.5 statistical software was used to process the data in the following examples. Experimental results are expressed as averages and analyzed using one-way ANOVA.

[0080] The *Corynebacterium glutamicum* CGMCC 20437 described in the following examples was deposited on August 17, 2020, at the China General Microbiological Culture Collection Center (CGMCC, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMCC No. 20437, and is classified as *Corynebacterium glutamicum*. *Corynebacterium glutamicum* CGMCC 20437 contains an L-isoleucine synthesis pathway.

[0081] In Examples 1-5, Corynebacterium glutamicum was cultured at 32°C.

[0082] Example 1: Construction of a recombinant vector containing a point-mutated NCgl0762 gene coding region fragment

[0083] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of primers for amplifying the coding region of the NCgl0762 gene were designed and synthesized. A point mutation was introduced into the coding region (SEQ ID No. 1) of the NCgl0762 gene of Corynebacterium glutamicum CGMCC 20437 (which was confirmed by sequencing to retain the wild-type NCgl0762 gene on its chromosome) by allele substitution. The point mutation was to mutate cytosine (C) to thymine (T) at position 191 of the nucleotide sequence (SEQ ID No. 1) of the NCgl0762 gene.

[0084] The DNA molecule shown in SEQ ID No. 1 encodes a protein with the amino acid sequence of SEQ ID No. 2 (this protein is a wild-type protein, denoted as protein NCgl0762).

[0085] The DNA molecule shown in SEQ ID No. 3 encodes a mutant protein with the amino acid sequence of SEQ ID No. 4 (this mutant protein is designated NCgl0762). S64FThe mutant protein NCgl0762 S64F The phenylalanine (F) at position 64 in (SEQ ID No. 4) is derived from a serine (S) mutation in the wild-type protein.

[0086] Vectors were constructed using NEBuilder recombination technology. Primers were designed as follows (synthesized by Invitrogen Shanghai). Nucleotides in bold indicate mutation sites:

[0087] P1: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GGGT AGGAAGCTGA AGAACC-3′,

[0088] P2:

[0089] P3:

[0090] P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TCAGCAGTGA TCCACACGC-3′.

[0091] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P1 and P2, P3 and P4, respectively, to obtain two DNA fragments (NCgl0762 Up and NCgl0762 Down) of the NCgl0762 gene coding region with mutated nucleotides and sizes of 616bp and 620bp, respectively.

[0092] The two DNA fragments (NCgl0762 Up and NCgl0762 Down) were separated and purified by agarose gel electrophoresis. They were then ligated with the pK18mobsacB vector (BioVector, containing a kanamycin resistance marker) purified after enzyme digestion (Xbal I / BamHI) using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation product was transformed into DH5α, and the resulting single clones were identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCTATG ACC-3′) to obtain the positive recombinant vector pK18-NCgl0762. S64F The recombinant vector pK18-NCgl0762 was digested with the correct enzymes. S64F The sample was sent to a sequencing company for sequencing and identification, and the recombinant vector pK18-NCgl0762 containing the correct point mutation (CT) was selected. S64F Save for future use.

[0093] Recombinant vector pK18-NCgl0762 S64FThe recombinant vector contains the DNA fragment shown in SEQ ID No. 5, which is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1156 of SEQ ID No. 5 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0094] Recombinant vector pK18-NCgl0762 S64F Contains the mutant gene NCgl0762 shown in SEQ ID No. 3 S64F .

[0095] Example 2: Constructing a system containing NCgl0762 S64F engineered strains with mutated genes

[0096] Construction method: The allelic substitution vector (pK18-NCgl0762) from Example 1 was used. S64F After being electroporated into *Corynebacterium glutamicum* CGMCC 20437 and *Corynebacterium glutamicum* ATCC13032, the bacteria were cultured in culture media (components are shown in Table 1). Single colonies were picked and cultured on a medium containing 15% sucrose (sucrose concentration 15 g / L, other components and concentrations are shown in Table 1). These single colonies were then cultured on media containing and without kanamycin. Strains that grew on the kanamycin-free medium but not on the kanamycin-containing medium were further identified by PCR using the following primers (synthesized by Invitrogen Shanghai):

[0097] P5: 5′-TAAAGCTTAG ACCTCTCTGC-3′,

[0098] P6: 5′-ACATTAATGT CTCCCAAATA-3′.

[0099] The obtained PCR amplification product (240bp) was sequenced. Through sequence alignment, the strain with a nucleotide mutation (CT) at position 191 of the NCgl0762 gene was identified as a positive strain with successful allelic substitution and was named YPI-0762-1 and YPI-0762-2, respectively.

[0100] The recombinant bacteria YPI-0762-1 and YPI-0762-2 respectively replaced the wild-type NCgl0762 gene in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 strains with the NCgl0762 gene shown in SEQ ID No. 3. S64F Strains obtained from mutated genes.

[0101] Table 1. Composition of the culture medium (the remainder is water)

[0102] Element concentration sucrose 10g / L Polypeptone 10g / L Beef extract 10g / L yeast powder 5g / L urea 2g / L Sodium chloride 2.5g / L Agar powder 20g / L pH 7.0

[0103] Example 3: Constructing genome overexpression of NCgl0762 and NCg10762 genes S64F engineered strains of genes

[0104] Vectors were constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of amplified upstream and downstream homologous arm fragments and NCgl0762 or NCgl0762 were designed and synthesized. S64F Primers for the gene coding region and promoter region were used to introduce NCgl0762 or NCgl0762 into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 via homologous recombination. S64F Gene expression cassette.

[0105] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0106] P7:

[0107] P8:

[0108] P9:

[0109] P10:

[0110] P11:

[0111] P12:

[0112] Construction method: Using the genomes of Corynebacterium glutamicum ATCC13032 or YPI-0762-1 from Example 1 as templates, PCR amplification was performed using primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain an 860bp upstream homologous arm fragment (sequence shown in SEQ ID No. 6), a 315bp fragment containing the NCgl0762 gene and its promoter (sequence shown in SEQ ID No. 7, where positions 21-70 represent the promoter, positions 71-295 represent the NCgl0762 gene, and positions 21-295 represent the NCgl0762 gene expression cassette), or a fragment containing NCgl0762. S64F A 315bp fragment of the gene and its promoter (sequence shown in SEQ ID No. 8, where positions 21-70 of SEQ ID No. 8 represent the promoter, and positions 71-295 represent NCgl0762). S64F Gene, positions 21-295, NCgl0762 S64F Gene expression cassette), downstream homologous arm fragment 817 bp (sequence shown in SEQ ID No. 9).

[0113] After the PCR reaction, the three fragments amplified from each template were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with the pK18mobsacB vector (containing kanamycin resistance as a selection marker) purified by Xbal I / BamHI digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation products were transformed into DH5α cells, and the resulting single clones were identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCT ATG ACC-3′) to obtain positive integrating vectors (recombinant vectors), namely pK18-NCgl0762OE and pK18-NCgl0762. S64F OE, the positive integration vector, contains a kanamycin resistance marker, and recombinants integrated into the genome can be obtained through kanamycin screening.

[0114] The correctly sequenced integration vectors (pK18-NCgl0762OE, pK18-NCgl0762) were used. S64FOE) was used to electroporate *Corynebacterium glutamicum* CGMCC 20437 and ATCC13032, respectively, and cultured in culture media (components are shown in Table 1). Single colonies were identified by PCR using primers P13 / P14. Strains amplifying a 1113 bp fragment were considered positive strains; those not amplified were considered the original strains. Positive strains were cultured on 15% sucrose medium, and single colonies were further identified by PCR using primers P15 / P16. Strains amplifying a 1082 bp fragment were identified as NCgl0762 or NCgl0762. S64F Positive strains whose genes were integrated into the genome of the target strain were named YPI-0762-3 (without mutation point) and YPI-0762-4 (with mutation point) as the starting strain of Corynebacterium glutamicum CGMCC 20437, respectively; and YPI-0762-5 (without mutation point) and YPI-0762-6 (with mutation point) as the starting strain of Corynebacterium glutamicum ATCC13032, respectively.

[0115] Recombinant bacteria YPI-0762-3 and YPI-0762-5 contain double copies of the NCgl0762 gene expression cassette. Specifically, recombinant bacteria YPI-0762-3 and YPI-0762-5 were obtained by inserting the NCgl0762 gene expression cassette (positions 21-295 of SEQ ID No. 7) into the upper poxB site of the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, while keeping other nucleotides in the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032 unchanged. Recombinant bacteria containing double copies of the NCgl0762 gene can significantly and stably increase the expression level of the NCgl0762 gene.

[0116] The recombinant strains YPI-0762-4 and YPI-0762-6 contain the mutated NCgl0762 shown in SEQ ID No. 3. S64F Gene; specifically, the recombinant strain YPI-0762-3 is formed by inserting the NCgl0762 gene into the poxB site of the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032. S64F The gene expression cassette (positions 21-295 of SEQ ID No. 8) was used to obtain recombinant bacteria that retained other nucleotides in the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032.

[0117] The PCR identification primers are shown below:

[0118] P13: 5′-GCCAGAAAT GGTTGCGTGA-3′,

[0119] P14: 5′-AAAGGTACAG CGTTGTTTGG-3′,

[0120] P15: 5′-CTGAATTCAG AGATCTACAA-3′,

[0121] P16: 5′-TCAAACGTAA TGCGGATCAG-3′.

[0122] Example 4: Constructing a vector to overexpress the NCgl0762 gene or NCgl0762 S64F engineered strains of genes

[0123] Vectors were constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of amplified vectors NCgl0762 and NCgl0762 were designed and synthesized. S64F Primers for the gene coding region and promoter region were designed as follows (synthesized by Invitrogen Shanghai):

[0124] P17: 5′- GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC CACC GCTTTCTGAG CCG G-3′ (The underlined nucleotide sequence is the sequence on pXMJ19)

[0125] P18: 5′- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC TCATAACTCC GTCTTCGTTG-3′ (The underlined nucleotide sequence is the sequence on pXMJ19).

[0126] Construction method: Using the genomes of Corynebacterium glutamicum ATCC13032 and YPI-0762-1 from Example 1 as templates, PCR amplification was performed using primers P17 / P18 to obtain fragments containing the NCgl0762 gene and its promoter (sequence shown in SEQ ID No. 10) and fragments containing NCgl0762. S64FThe gene and its promoter fragment (sequence shown in SEQ ID No. 11) was 345 bp. The amplified product was subjected to electrophoresis and purified using a column DNA gel extraction kit. The recovered DNA fragment was ligated with the shuttle vector pXMJ19 (BioVector, which contains chloramphenicol resistance as a selection marker) recovered by EcoRI / KpnI digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation product was transformed into DH5α and the resulting single clones were identified by PCR using M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18 primers to obtain the correct positive overexpression vectors pXMJ19-NCgl0762 (containing the NCgl0762 gene) and pXMJ19-NCgl0762. S64F (Contains NCgl0762) S64F (Gene). Because the vector contains a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the vector has been transformed into the strain. pXMJ19-NCgl0762 is a recombinant vector obtained by inserting the NCgl0762 gene expression cassette shown in positions 37-311 of SEQ ID No. 10 into the pXMJ19 vector. pXMJ19-NCgl0762 S64F To insert NCgl0762, represented by positions 37-311 of SEQ ID No. 11, into the pXMJ19 vector. S64F Recombinant vectors obtained from gene expression cassettes.

[0127] The correctly sequenced pXMJ19-NCgl0762 and pXMJ19-NCgl0762 S64F The vectors were electroporated into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and cultured in culture media (the composition of which is shown in Table 1). Single colonies produced by culture were identified by PCR using primers M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18. Strains amplified by PCR containing a 384bp fragment were considered positive strains. The modified strains obtained from Corynebacterium glutamicum CGMCC 20437 were named YPI-0762-7 (without mutation point) and YPI-0214-8 (with mutation point); the modified strains obtained from Corynebacterium glutamicum ATCC13032 were named YPI-0762-9 (without mutation point) and YPI-0214-10 (with mutation point).

[0128] The recombinant bacteria YPI-0762-7 and YPI-0762-9 were obtained by introducing the recombinant vector pXMJ19-NCgl0762 into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively. Both of them contain the NCgl0762 gene and its promoter (i.e., the NCgl0762 gene expression cassette).

[0129] Recombinant bacteria YPI-0762-8 and YPI-0762-10 respectively contain the recombinant vector pXMJ19-NCgl0762. S64F The recombinant bacteria obtained by introducing Corynebacterium glutamicum CGMCC 20437 and ATCC13032 both contained NCgl0762. S64F Gene and its promoter (i.e., NCgl0762) S64F Gene expression cassettes.

[0130] Example 5: Constructing an engineered strain with the NCgl0762 gene deleted from its genome.

[0131] Vectors were constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify the segments at both ends of the coding region of the NCgl0762 gene, serving as upstream and downstream homologous arms. The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0132] P19: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG TTTC AGGTGACTTA TGAAG-3′,

[0133] P20:

[0134] P21:

[0135] P22:

[0136] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P19 / P20 and P21 / P22, respectively, to obtain the upstream homologous arm fragment of NCgl0762 (660 bp) and the downstream homologous arm fragment of NCgl0762 (654 bp).

[0137] The amplified products were subjected to electrophoresis and purified using a column-based DNA gel extraction kit. The recovered DNA fragments were ligated with the pK18mobsacB vector (containing kanamycin resistance as a selection marker) purified by Xbal I / BamHI digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The single clones grown after transformation were identified by PCR using M13 primers to obtain the positive knockout vector pK18-ΔNCgl0762 with the correct sequence. This recombinant vector pK18-ΔNCgl0762 contains 1274 bp of up-down DNA from ΔNCgl0762 (sequence shown in SEQ ID No. 12).

[0138] The vector was sent for sequencing. The correctly sequenced knockout vector pK18-ΔNCgl0762 was electroporated into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032, respectively, and cultured in culture medium (the composition of which is shown in Table 1). Single colonies produced were identified by PCR using the following primers (synthesized by Invitrogen Shanghai):

[0139] P23: 5′-TTTC AGGTGACTTA TGAAGG-3′,

[0140] P24: 5′-AAGGCCACAT GGTTGGACC-3′.

[0141] The strains that simultaneously amplified bands of 1200 bp and 1425 bp in the above PCR were identified as positive strains, while the strains that amplified only the 1200 bp band were identified as the original strain. After screening on 15% sucrose medium, the positive strains were cultured on media containing and without kanamycin. Strains that grew on the kanamycin-free medium but not on the kanamycin-containing medium were further identified by PCR using primers P23 / P24. Strains amplifying a 1200 bp band were identified as positive strains with the NCgl0762 gene coding region knocked out. The NCgl0762 fragment of the positive strain was amplified again by PCR using primers P23 / P24 and sequenced. The strains with correct sequencing were named YPI-0762-011 (NCgl0762 gene knocked out in the genome of Corynebacterium glutamicum CGMCC20437) and YPI-0762-012 (NCgl0762 gene knocked out in the genome of Corynebacterium glutamicum ATCC 13032).

[0142] Example 6: L-Isoleucine Fermentation Experiment

[0143] The strains constructed in the above examples, along with the original strains *Corynebacterium glutamicum* CGMCC 20437 and *Corynebacterium glutamicum* ATCC 13032, were validated using shake-flask fermentation. The specific culture media are shown below, and each strain was replicated three times. The results are shown in Table 3.

[0144] Slant culture: The -80℃ preserved strain was streaked onto the activated slant (see Table 1 for culture medium composition), incubated at 30℃ for 24 h, and passaged once;

[0145] Shake flask seed culture: Use an inoculation loop to scrape a loop of slanted seeds and inoculate them into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium (see Table 1 for the composition of the culture medium, excluding agar powder). Seal the flask with nine layers of gauze and incubate at 37℃ and 200 rpm for 7-10 h.

[0146] Shake-flask fermentation: Inoculate 10-15% of the seed culture volume into a 500mL Erlenmeyer flask containing fermentation medium (final volume 30mL), seal with nine layers of gauze, and culture at 37℃ with shaking at 200r / min. During fermentation, maintain pH at 7.0-7.2 by adding ammonia water; add 60% (m / v) glucose solution to maintain fermentation; fermentation cycle 24h.

[0147] Table 2. Shake flask fermentation medium formulation (the rest is water)

[0148] Reagent Name Concentration (g / L) glucose 30 yeast powder 15 Polypeptone 15 ammonium sulfate 5 urea 3 <![CDATA[KH2PO4]]> 6 <![CDATA[K2HPO4]]> 5 Magnesium sulfate 0.2 Calcium pantothenate 0.6 Biotin 0.5 VB1 0.5 pH 6.8-7.2

[0149] The results are shown in Table 3. The NCgl0762 gene was mutated to NCgl0762. S64F The gene can increase the production of L-isoleucine. In Corynebacterium glutamicum, the interaction between the NCgl0762 gene and NCgl0762... S64F Gene overexpression also helps increase L-isoleucine production, while knocking out the NCgl0762 gene is not conducive to the accumulation of L-isoleucine.

[0150] Table 3. Results of L-Isoleucine Fermentation Experiment

[0151]

[0152] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A protein mutant, which is either A1) or A2): A1) a protein represented by SEQ ID No. 4; A2) a fusion protein obtained by attaching a tag to the N-terminus or / and C-terminus of A1).

2. A biological material, which comprises any one of the following B1) to B4): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette comprising the nucleic acid molecule according to B1); B3) a recombinant vector comprising the nucleic acid molecule according to B1), or a recombinant vector comprising the expression cassette according to B2); B4) a recombinant microorganism comprising the nucleic acid molecule according to B1), or a recombinant microorganism comprising the expression cassette according to B2), or a recombinant microorganism comprising the recombinant vector according to B3). B1) the nucleic acid molecule comprises a nucleotide sequence identical to the DNA molecule defining the coding sequence represented by SEQ ID No. 3 at 75% or more. B1) the nucleic acid molecule comprises a DNA molecule defining the coding sequence represented by SEQ ID No.

3. B1) is a DNA molecule whose sequence comprises SEQ ID No.

3.

6. A method for producing isoleucine, which comprises X1) or X2): X1) replacing a gene encoding the protein represented by SEQ ID No. 2 in a starting Corynebacterium glutamicum with a gene encoding the protein represented by SEQ ID No. 4 to obtain a recombinant Corynebacterium glutamicum; culturing the recombinant Corynebacterium glutamicum to obtain isoleucine; X2) causing a Corynebacterium glutamicum to express the protein according to claim 1 to obtain a recombinant Corynebacterium glutamicum; culturing the recombinant Corynebacterium glutamicum to obtain isoleucine.

7. Use of the protein according to claim 1 or the biological material according to any one of claims 2 to 5 in the production of isoleucine, or use in the preparation of a product for the production of isoleucine. ​ 3. The biomaterial of claim 2, wherein: ​ 4. The biomaterial of claim 3, wherein: ​ 5. The biomaterial of claim 4, wherein: ​ ​ ​ ​ ​

Citation Information

Patent Citations

  • NCgl2747 gene mutant and application thereof in preparation of L-lysine

    CN114835783A

  • Novel Polynucleotides

    US20020197605A1