Amelanospora sp. LB2 and application thereof

Abstract

The invention discloses a strain of nigrospora aurantiaca LB2, the nigrospora aurantiaca LB2 is preserved in Guangdong Province Microbial Culture Collection Center, and the preservation number is GDMCC No: 64550. The invention further discloses a method for preparing the nigrospora aurantiaca LB2. The melanospora sp. LB2 can be used for infecting and causing oxalis corniculata, sticktight and gramineous weeds so as to prevent and control the weeds; the melanospora nigra LB2 can also be used for producing haematochrome for pigment production.

Description

Technical Field

[0001] The present invention belongs to the field of microbial weed control, and more specifically, relates to a strain of Black Sporophycetes LB2 and application thereof. Background Art

[0002] Chemical herbicides are commonly used herbicides, but with the widespread use of chemical herbicides, problems such as pesticide residues and environmental hazards, such as environmental pollution, abnormal plant growth, improper dosage control that will affect other plants, harm to the human body, and long-term use of a single herbicide to produce resistant plants, are becoming increasingly serious. Therefore, the development and application of low-toxic and low-residue bio-source herbicides is an important part of promoting environmental sustainable development. Microbial herbicides are a new type of microbial herbicide that uses secondary metabolites produced by microorganisms or their metabolism, namely plant toxins, to control weeds. They have the advantages of being biologically active in nature and easy to degrade, and have good development potential. Summary of the invention

[0003] An object of the present invention is to solve at least the above problems and to provide at least the advantages which will be described hereinafter.

[0004] An object of the present invention is to provide a black spore mold ( N. aurantiaca )LB2, which produces red pigment and is effective in the production of Oxalis oxyphylla ( Oxalis corniculata L. ), Dendrobium ( Bidens pilosa L. ) and Imperata cylindrica ( Imperata cylindrica (L.) P. Beauv.) is highly pathogenic.

[0005] In order to achieve these objects and other advantages of the present invention, a black spore mold ( N. aurantiaca )LB2, the black spore mold LB2 ( Nigrospora aurantiaca ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on April 23, 2024. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the deposit number is GDMCC No: 64550.

[0006] A preparation with herbicidal effect, comprising black spore mold or its metabolites.

[0007] Preferably, the formulation is used to control Oxalis sorrel, Bidens pilosa and Imperata cylindrica.

[0008] The invention discloses an application of a black spore mold LB2 for producing a red pigment or for preparing a weed killing preparation.

[0009] Preferably, the Black Sporophyte LB2 is used for controlling lawn weeds.

[0010] The present invention at least includes the following beneficial effects: the black spore mold LB2 provided by the present invention can infect and cause disease to Oxalis sorrel, Bidens pilosa and grass weeds to achieve the effect of preventing and controlling weeds; the black spore mold LB2 can also produce red pigment for the production of pigments.

[0011] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a photo of the onset of the disease. Figure 2 These are photos of the growth of Nigrosporium LB2 on PDA medium for 6 and 9 days and the spores under an optical electron microscope; Figure 3 This is the phylogenetic tree diagram of Nigrosporium LB2; Figure 4 This is a graph showing the results of the in vitro experiment on the pathogenesis of Zanthoxylum bungeanum; Figure 5 The experimental results of verifying the grafting of Zanthoxylum bungeanum to indoor potted plants; Figure 6 This is a graph showing the results of an in vitro pathogenicity test of Nigrospora LB2 on Oxalis; Figure 7 This is a graph showing the results of an in vitro pathogenicity test of Nigrosporium LB2 on Bidens pilosa; Figure 8 This is a graph showing the results of in vitro pathogenicity test of Nigrospora LB2 on grass weeds; Fig. 9 This is a graph showing the results of the pathogenicity test of Black Sporangium LB2 on Oxalis plants. DETAILED DESCRIPTION

[0013] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0014] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0015] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0016] 1. Isolation of strains Two-sided needles (Zanthoxylum bungeana) were collected from Malu Town, Dongxing City, Fangchenggang City, Guangxi Zanthoxylum nitidum(Roxb.) DC.) Disease sample. The disease of Zanthoxylum in the field is quite serious. The symptoms are the appearance of carbonized black spots on the young shoots, main branches and young leaves of Zanthoxylum. The young leaves fall off when touched lightly. Figure 1 shown.

[0017] Clean the collected diseased samples with sterile water in an ultra-clean workbench, wait for them to dry naturally, use scissors to cut a small piece of diseased tissue about 5 mm at the junction of the diseased and healthy parts of the stems and leaves, place it in 75% ethanol for 5 s and 2.5% sodium hypochlorite solution for 3 min for disinfection, rinse it with sterile water 3 times, use sterile filter paper to absorb the moisture on the surface of the diseased tissue, and clamp it on the PDA plate with tweezers. Each culture dish is filled with 4-6 small pieces of diseased samples, and the plate is inverted in a constant temperature incubator at 28℃ for culture. After 3-5 days of culture, hyphae grow on the surface of the diseased tissue, which is promptly transferred to a new PDA plate to obtain a purified pathogen strain.

[0018] 2. Identification of strains 2.1 Morphological identification The fungus is colorless to light pink velvety hyphae in the early stage of growth on PDA medium. As the hyphae grow, the colonies become densely covered with pink hyphae and blood red in the later stage. In the later stage of growth, black particles can be seen distributed in the colonies. The spores of the fungus are black, oval to spherical, 13.60~16.10 um in size, and have a pink halo around the spores. Figure 2 shown.

[0019] 2.2 Molecular biological identification The universal primers ITS1 (SEQ ID NO: 1: 5'-tccgtaggtgaacctgcgg-3') and ITS4 (SEQ ID NO: 2: 5'-tcctccgcttattgatatgc-3') were used to amplify rDNA by PCR. The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0020] The PCR reaction system was (50 ul): 1.5 ul each of forward and reverse primers (10 μmol / L), 25 ul of 10×PCR buffer, 5 ul of 10×additive for high specificity, 1 ul of Taq enzyme, and an appropriate amount of sample was added and then filled with dd H2O.

[0021] The PCR cycle settings were as follows: 98 °C pre-denaturation for 2 min, 98 °C denaturation for 10 s, 60 °C annealing for 45 s, 68 °C extension for 1 min, 35 cycles, and finally 68 °C extension for 10 min, and 4 °C insulation. After amplification, electrophoresis was performed, and the PCR product was sent to Shanghai Bioengineering for bidirectional sequencing. After sequencing, a spliced ​​sequence of 553 bp was obtained. Sequence homology was compared by NCBI Blast, and rDNA-ITS was clustered by neighbor-joining to construct a multi-gene sequence phylogenetic tree, as shown in Figure 2. Figure 3 As shown, combined with morphological identification, it is judged to be Nigrospora aurantiaca .

[0022] The rDNA-ITS sequence of Black Sporophycetes LB2 is shown in SEQ ID NO:3: Tccgtaggggtgacctgcggagggatcattacagagttatccaactcccaaacccatgtgaacatatctctttgttgcctcggcgcaagctacccgggacctcgcgccccgggcggcccgccggcggacacaccaaac tctgttatcttcgttgattatctgagtgtctttatttaataagtcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcat cgaatctttgaacgcacattgcgcccattagtattctagtgggcatgcctgttcgagcgtcatttcaacccctaagcacagcttattgttgggcgtctacgtctgtagtgcctcaaagacattggcggagcggcagta gtcctctgagcgtagtaattctttatctcgcttttgttaggtgctgcccccccggccgtaaaaccccccaattttttctggttgacctcggatcaggtaggaatacccgctgaacttaagcatatcaaaagccggaggaa 553.

[0023] The fungus was named Black Sporophytum N. aurantiaca) LB2, the black spore mold LB2 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 23, 2024, and the preservation address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the preservation number is GDMCC No: 64550.

[0024] 3. Pathogenicity Verification 3.1 In vitro tieback verification According to Koch's postulates for plant pathogen identification, the purified strains were screened using an in vitro leaf inoculation test. A 5-cm diameter bacterial cake was obtained from the plate of the purified cultured strain using a hole puncher on a sterile operating table. The inoculated Zanthoxylum leaves, tender shoots, stems, etc. were placed in a plastic box covered with moist filter paper and cultured in a constant temperature incubator at 28°C. Each treatment was repeated 3 times, and the uninoculated PDA was used as a control. Disease symptoms (such as Figure 4 ), after 48 hours, the leaf lesions spread rapidly, and the symptoms were consistent with those in the field. The disease grade is classified as follows: Grade 0: no lesions on the leaves; Grade 1: lesions on the leaves; Grade 2: lesions spread to 1 / 3 to 2 / 3 of the leaves; Grade 3: more than 2 / 3 of the leaves are necrotic; Grade 4: when all the leaves are dead and discolored, it can reach Grade 2-3 after 48 hours. It can be judged that the fungus is a strong pathogen.

[0025] 3.2 Verification of indoor potted plant grafting The test of pathogenic bacteria was carried out by using potted Zanthoxylum bungeanum plants with good growth in the seedling stage, and the leaves and branches were inoculated without puncture wounds. The Zanthoxylum bungeanum seedlings with normal growth were cultured at room temperature for use. From the pathogenic bacteria colonies cultured for 3-5 days, a sterile puncher was used to take a bacterial cake with a diameter of 8 mm, and it was inoculated on the leaves, stems, and branches of the potted plants, and kept moist with a plastic bag. The disease was observed after 2 days. The test results are as follows: Figure 5 shown.

[0026] 4. Determination of the killing effect of strong pathogenic bacteria on weeds 4.1 In vitro weed inoculation assay The strong pathogenicity of the fungus was applied to the weed killing test. Oxalis, Bidens pilosa, and Imperata cylindrica were widely distributed on the lawns in Guangxi as the research objects. The in vitro leaf grafting test was also carried out. The test results are as follows: Figure 6 , Figure 7 , Figure 8 It can be observed that the fungus has a certain killing effect on Oxalis, Bidens pilosa, and Imperata cylindrica, among which the killing effect on Oxalis is the best.

[0027] 4.2 Determination of the killing effect of weeds by spraying fermentation liquid of strong pathogenic bacteria Transplant the normally growing Oxalis in the field into a flowerpot and culture it at room temperature for later use. Take a bacterial cake with a diameter of 8 mm from the bacterial colony that has been cultured for 5 days with a sterile cork borer and inoculate it in 250 mL of sterilized PDB solution for 2-3 days. Filter it with a sterile filter membrane to obtain the fermentation stock solution; spray it on the normally growing Oxalis and control the inoculation amount to 20-25 mL / pot. Use healthy plants that are only inoculated with sterile water as the control, and repeat each treatment 3 times. After inoculation, use a plastic bag to keep the moisture incubated. After 2 days, observe the disease condition of the plants. Fig. 9 It can be observed that some Oxalis leaves are diseased, which is consistent with the results of the in vitro grafting experiment.

[0028] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A strain of Black Sporophytum ( N. aurantiaca ) LB2, characterized in that The black spore mold LB2 is preserved in Guangdong Microbial Culture Collection Center with the preservation number of GDMCC No: 64550.

2. A preparation having a herbicidal effect, characterized in that: The invention comprises the black spore mold or its metabolites as described in claim 1.

3. The herbicidal preparation according to claim 1, characterized in that: The preparation is used to control Oxalis, Bidens pilosa and Imperata cylindrica.

4. Application of a strain of Black Sporangium LB2, characterized in that: Used in the production of red pigments or in the preparation of weed killer preparations.

5. The application of black spore mold LB2 according to claim 4, characterized in that, The black spore mold LB2 is used for preventing and controlling lawn weeds.

Images