Saccharomyces cerevisiae G-1 and application thereof in degradation of gibberellin GA3

Abstract

The invention discloses saccharomycetes G-1 and application thereof in degradation of gibberellin GA3, the Latin name of the saccharomycetes G-1 is Yarrowia lipolytica (Yarrowia lipolytica), the strain of the saccharomycetes G-1 is preserved in the China General Microbiological Culture Collection Center on December 1, 2024, and the preservation number is CGMCC No.32800. The invention further discloses a preparation method of the saccharomycetes G-1. The yeast G-1 is screened from a gibberellic acid fermentation filter residue organic fertilizer sample, the strain can grow in an inorganic salt culture medium with gibberellin GA3 as a unique carbon source, and the degradation efficiency of GA3 reaches 24% after the strain is cultured for 48 h; the microbial agent prepared from the microbial agent is applied to the composting process of fermentation filter residues, and the result shows that degradation of GA3 is obviously accelerated by adding 3% of the microbial agent to a treatment group. The strain has great application potential in the aspect of promoting harmless treatment of fermentation filter residues. The invention provides a new way for removing residual plant hormone gibberellin GA3 in soil and organic fertilizers, enriches a germplasm resource library of plant hormone degrading bacteria, and has a better application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial degradation, and specifically relates to a yeast G-1 and application thereof in degrading gibberellin GA3. Background Art

[0002] Gibberellin (GA) is an important plant growth regulator that promotes seed germination, flower bud formation, and increases crop yields. It is widely used in agricultural production. There are many types of gibberellin compounds, among which GA3 plays a major role in plants. It is the most popular gibberellin product on the market, commonly known as gibberellic acid, and is a slightly toxic pesticide. At present, gibberellin is mainly obtained in industry through microbial fermentation. The fermentation broth is used to extract gibberellin, and the solid waste produced after the residue is filtered is the fermentation residue. The fermentation residue has a complex composition, including nutrients such as crude protein, organic matter, and a large amount of residual gibberellin. Direct discharge without treatment will cause serious environmental pollution and threaten food safety and human health. Composting is one of the common methods for harmless and high-value treatment of solid waste. Through composting, the microorganisms in the material utilize and degrade the organic solid waste, and finally convert it into usable organic fertilizer. In order to speed up the composting process and improve the quality of compost, adding microbial agents is a common method during the composting process. The agents can not only change the composition of the compost microbial community, but also promote the degradation of substances such as plant hormones in the compost, fully decompose organic matter, and further improve the quality of the compost.

[0003] The key step in the harmless treatment of gibberellic acid fermentation residue is the degradation of gibberellin GA3. Biodegradation is one of the effective ways to control soil pollution and eliminate pesticide residues. Its degradation method can directly utilize the metabolism of certain microorganisms. Therefore, this experiment uses gibberellic acid fermentation residue organic fertilizer as raw material to screen strains that can degrade gibberellins, and investigates the effect of strains made into biological agents on the composting effect of fermentation residues. The purpose is to provide a reference for in-depth exploration of the biodegradation pathway of gibberellins and provide a practical method for the harmless and resourceful treatment of gibberellic acid fermentation residues. Summary of the invention

[0004] In view of the above-mentioned technical problems existing in the prior art, the object of the present invention is to provide a yeast G-1 and its application in degrading gibberellin GA3. The invention content of this application includes the screening of strains and their application in degrading gibberellin GA3, and the strains are prepared as fermentation agents to explore their effects on the degradation and harmlessness of gibberellin residues in agricultural environments.

[0005] The technical solution adopted by the present invention is as follows:

[0006] A yeast G-1, which is Yarrowia lipolytica, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 25, 2024, with the deposit number CGMCC No.32800, and the deposit address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0007] The isolation method of yeast G-1 is as follows: preliminarily screening microorganisms in fermentation residue organic fertilizer samples to obtain strains that can grow in an environment with gibberellin as the sole carbon source; continuously streaking and purifying the strains, and the colonies obtained on the plate are round, milky white, opaque, slightly convex, with neat colony edges, and dense short hair-like hyphae; molecular identification shows that the strain belongs to the genus Yarrowia, named yeast G-1, and its DNA sequence is shown in SEQ ID NO: 1.

[0008] Furthermore, yeast G-1 was inoculated into the sterilized inorganic salt liquid culture medium, and a treatment without inoculation of microorganisms was set as a blank control. The two groups of culture medium were placed in a shaker and cultured at 28°C. After 48 hours, the gibberellin content of the control group remained at the initial concentration, and the gibberellin degradation efficiency in the inorganic salt solution treated with the inoculated yeast reached 24%.

[0009] Another object of the present invention is to provide an application of yeast G-1 in degrading gibberellin GA3.

[0010] Furthermore, the yeast G-1 is made into a biodegradable agent and applied to the degradation of gibberellin residues in an agricultural environment. The degradation method is aerobic composting. The specific application method is: the yeast G-1 is made into a biodegradable agent, mixed with sawdust, and the sawdust is used as an auxiliary material and mixed evenly with the gibberellic acid fermentation residue to obtain a compost mixture, and aerobic composting and natural fermentation are performed.

[0011] Furthermore, the method for degrading gibberellin residues in an agricultural environment specifically comprises the following steps:

[0012] Step 1: Inoculate yeast G-1 into LB liquid culture medium, and culture it in a shake flask or a shaker at 28° C. and a rotation speed of 180 r / min to obtain the biodegradable bacterial agent.

[0013] Step 2: Use sawdust as auxiliary material for aerobic composting of fermentation residue. Utilize the hygroscopicity of sawdust to evenly spray the biodegradable agent on the sawdust. Then mix the gibberellic acid fermentation residue with the sawdust and stir evenly to obtain a compost mixture.

[0014] Step 3: aerobic composting and natural fermentation are performed on the compost mixture of step 2. In addition, no biodegradable agent is added, and only gibberellic acid fermentation residue supplemented with sawdust is used as composting raw material for aerobic composting and natural fermentation, which serves as a blank control group of the experiment.

[0015] Step 4: By measuring temperature regularly, turning the compost, taking samples, and testing the physical and chemical properties of samples at different stages of composting, observe the degradation of residual gibberellins by biodegradable bacteria and evaluate the composting process.

[0016] Furthermore, in step 2, the mass ratio of the gibberellic acid fermentation residue to the sawdust is 3.5-4.5:1, the mass fraction of the biodegradation agent added to the compost mixture is 1-5%, and the OD of the microbial concentration when the biodegradation agent is added is 600 It is 0.8-1.0.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) The present invention isolates a Yarrowia lipolytic yeast from the gibberellic acid fermentation residue organic fertilizer, and names it as yeast G-1. The strain can grow in an environment with gibberellin as the only carbon source, and has a good degradation effect on gibberellin. Yeast G-1 is inoculated and cultured in an inorganic salt culture medium, and the gibberellin degradation efficiency reaches 24% in 48 hours.

[0019] (2) The yeast G-1 provided by the present invention can be applied to the degradation of gibberellin residues in agricultural environments. The microbial agent prepared by the yeast G-1 is added to the fermentation residue aerobic composting process, which can enrich the microbial composition in the compost material, and the degradation bacteria and composting microorganisms can synergistically degrade, promote the increase of composting temperature, fully decompose organic matter in the compost, increase the degradation rate of residual gibberellin by composting, accelerate the composting process, and further improve the quality of compost.

[0020] (3) The yeast G-1 provided by the present invention has great application potential in the harmless resource utilization of fermentation residues, provides a new way to remove gibberellin residues in the environment, enriches the germplasm resource library of plant hormone-degrading bacteria, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the colony morphology of yeast G-1, Figure 1 The left picture shows the morphological characteristics of the colonies cultured on LB solid medium for 12 hours. Figure 1 The right picture shows the morphology of a single bacterium under a microscope;

[0022] Figure 2The concentration changes of GA3 degraded by yeast G-1 in the experimental group T1 and the control group CK in the inorganic salt medium within 48 hours;

[0023] Figure 3 The changes in composting temperature when yeast G-1 fermentation agent was added to aerobic composting.

[0024] Figure 4a This is the effect of yeast G-1 fermentation agent on the moisture content of the composting process.

[0025] Figure 4b This is the effect of yeast G-1 fermentation agent on the pH of the composting process.

[0026] Figure 4c This is the effect of yeast G-1 fermentation agent on the conductivity of the composting process.

[0027] Figure 5 This is the effect of yeast G-1 fermentation agent on the changes in gibberellin content during composting. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0029] Preparation of experimental medium:

[0030] LB medium: peptone 10 g, sodium chloride 10 g, yeast extract 5 g, distilled water 1000 ml, pH 7.0 ± 0.2.

[0031] LB solid medium: peptone 10 g, sodium chloride 10 g, yeast extract 5 g, agar 20 g, distilled water 1000 ml, pH 7.0 ± 0.2.

[0032] Inorganic salt culture medium: 1.5g ammonium sulfate, 2g dipotassium hydrogen phosphate, 0.2g magnesium sulfate, 0.5g sodium chloride, 1000ml distilled water.

[0033] Preparation of GA3 solution: Accurately weigh 500.0 mg of gibberellin GA3 and dissolve it in 20 ml of anhydrous methanol, dilute to 100 ml with distilled water to obtain a 5000 mg / L GA3 standard solution, and dilute to different concentrations according to the test requirements.

[0034] GA3-inorganic salt medium: The prepared inorganic salt medium is sterilized at 121°C for 10 min, filtered through a 0.45 μm filter membrane using a disposable syringe after cooling, and then GA3 solution is quantitatively added according to the required concentration to obtain GA3-inorganic salt medium.

[0035] Example 1: Isolation and identification of strains

[0036] Step 1: Screening and separation of gibberellin GA3-degrading bacteria:

[0037] (1) The strain screening used a selective culture medium with gibberellin GA3 as the sole carbon source. The screening sample was a gibberellic acid fermentation residue organic fertilizer sample, which was added to PBS buffer at a sample-liquid ratio of 1 g:10 mL and mixed evenly in a shaker at 28°C and 180 rpm to obtain a fermentation residue bacterial suspension; 1 ml of the supernatant after the suspension was added to a GA3-inorganic salt liquid culture medium, and cultured at 28°C and 180 rpm for 24 h. The microorganisms were selectively screened and enriched to the third generation to obtain a microbial enrichment solution.

[0038] (2) Using a 10-fold gradient dilution method, dilute the microbial enrichment solution in step (1) with sterile water to 10 -1 ~10 -4 The bacterial suspension of different concentrations was spread on LB solid medium and inverted in a constant temperature incubator at 28°C for culture. After 24 hours, a plate with a suitable density was selected and representative colonies were selected for streaking purification. After purification for 5 generations, the strain was identified.

[0039] Step 2: Morphological and molecular identification of GA3-degrading strains

[0040] (1) Morphological characteristics of strains

[0041] The single strain purified in step 1 was inoculated into LB solid medium, inverted and grown in a constant temperature incubator at 28°C for 24 hours, and the strain morphology was observed: the colony of the degradation bacteria G-1 was small, round and slightly convex, opaque milky white, with neat colony edges and dense short hairs (see Figure 1 The strain on the plate was gram-stained and observed under an electron microscope. The cells of the strain were spherical. Figure 1 Right picture.

[0042] (2) Molecular identification

[0043] The strain DNA was extracted using the Ezup column bacterial genomic DNA extraction kit, followed by PCR amplification (primer sequences were 27F: AGAGTTTGATCMTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT; ITS1: TCCGTAGGTGAACCTGCGG; ITS4-R: TCCTCCGCTTATTGATATGC); the amplified product was sequenced by Sangon Biotech (Shanghai) Co., Ltd., and the DNA fragment of the strain was obtained, and its DNA sequence is shown in SEQ ID NO: 1.

[0044] The DNA sequence of the strain was subjected to homology comparison in the NCBI GenBank database using the BLAST program. The ITS sequence determination results of the strain were subjected to BLAST homology similarity analysis on NCBI. The strain was identified as Yarrowia, Yarrowia lipolytica, and named Yeast G-1.

[0045] Example 2: Determination of Gibberellic Acid GA3 Degradation by Yeast G-1

[0046] After screening, yeast G-1 that can decompose and use gibberellins as a carbon source for growth activities was obtained, and the degradation efficiency of gibberellins by the yeast was further determined. The specific experimental contents are as follows:

[0047] (1) The yeast G-1 purified in Example 1 was inoculated into LB liquid culture medium and cultured at 28° C. and 180 rpm for 24 h to obtain a suspension of gibberellin-degrading bacteria.

[0048] (2) Dilute the degrading bacterial suspension with sterile water to OD 600 About 0.2, 500 μL of the diluted bacterial suspension was added to 100mL GA3-inorganic salt liquid culture medium, recorded as experimental group T1; at the same time, a culture medium treatment without inoculation of degrading bacteria was set as a control, and the control group was 500 μL of LB liquid culture medium added to 100mL GA3-inorganic salt liquid culture medium, recorded as control group CK. The initial concentration of gibberellin GA3 in the culture medium solutions of the experimental group T1 and the control group CK was the same, both 100 mg / L. The culture medium solutions of the experimental group T1 and the control group CK were cultured in a 180rpm shaking flask at 28°C, and samples were taken every 6 hours. The gibberellin content was determined by high performance liquid chromatography. The cultures were cultured for 48 hours, and the changes in the concentration of gibberellin GA3 over time were as shown in the following figure. Figure 2 shown.

[0049] The degradation efficiency of the degrading bacteria was calculated based on the changes in the gibberellin content in the culture medium.

[0050] GA3 degradation rate (%) = [1-(Cn / C0)] * 100%, where Cn is the GA3 concentration in the inorganic salt medium after 48 hours of culture, and C0 is the initial concentration of gibberellins in the medium. The gibberellins in the medium solution of the control group CK were not degraded and maintained at the initial concentration, while the degradation efficiency of gibberellins in the medium solution of the experimental group T1 reached 24% after 48 hours of degradation treatment.

[0051] Example 3: Preparation of GA3-degrading bacteria G-1 fermentation agent and its application in composting

[0052] The yeast G-1 screened in Example 1 was prepared as a fermentation agent, and the agent was added to the aerobic composting process of the fermentation residue. By observing the effects of the addition of the agent on the physicochemical properties of the compost material and the harmless treatment of the fermentation residue, the application of yeast G-1 in the degradation of gibberellin residues in an agricultural environment was explored.

[0053] Gibberellic acid fermentation residue is the solid waste produced after the fermentation liquid of Gibberellic acid is filtered through a plate and frame. The fermentation residue used in the experiment comes from Qianjiang Biochemical Co., Ltd. The composting experiment was carried out in the greenhouse of the mulberry silkworm experimental area of ​​Zhejiang Academy of Agricultural Sciences. The raw material for aerobic composting is gibberellic acid fermentation residue, and 20% sawdust is added as composting auxiliary material. The total weight of the material is 35kg. The compost is 60*45*40 (cm 3 The composting was carried out in a foam box. The function of the foam box is to maintain the temperature of the pile to prevent the rapid loss of temperature due to the small volume of compost and affect the fermentation process, but the box cover is not added to ensure the circulation of oxygen. There are two groups of composting treatments: the gibberellin degrading bacteria treatment group (T1 group) and the control treatment group (CK group). The specific steps of the composting experiment are as follows:

[0054] (1) Preparation of yeast G-1 fermentation agent: The yeast G-1 obtained in Example 1 was inoculated into LB liquid culture medium and cultured at 28°C with shaking at 180 rpm for 24 h to obtain a GA3-degrading bacterial fermentation agent. The OD value of the microbial concentration in the agent was 600 It is 0.9344.

[0055] (2) T1 treatment group: According to the mass ratio of the compost material, the fermentation agent of step (1) was added to the aerobic compost raw material at a mass fraction of 3%, and the added mass of the fermentation agent was about 1 kg. First, the fermentation agent was evenly sprayed on the sawdust of the compost auxiliary material, and the hygroscopicity of the sawdust was used to avoid uneven mixing of the fermentation agent and the compost material due to the high viscosity of the fermentation residue. The sawdust mixed with the agent was evenly spread on the gibberellic acid fermentation residue and stirred evenly, and then placed in a foam box.

[0056] CK treatment group: No fermentation agent was inoculated. The sawdust was evenly spread on the gibberellic acid fermentation residue. The materials were stirred and mixed evenly, and then put into a foam box for composting, which served as the blank control of the T1 treatment group.

[0057] (3) Composting process management: Compost aeration is controlled by manual turning; the compost is turned every 3 days in the early stage of composting and when the temperature rises above 50°C, and every 7 days after the temperature drops below 50°C, to ensure an aerobic environment in the compost. Samples are collected after each turning of the compost, and samples are randomly sampled and mixed for each treatment pile. The samples are stored at 4°C for subsequent extraction of gibberellin GA3 and determination of physical and chemical properties.

[0058] Specifically, the physical and chemical indicators of the compost sample and the specific steps of the detection are as follows:

[0059] (1) Temperature: The temperature of the pile was measured by randomly inserting a 50-cm-long alcohol thermometer into three different locations of each pile at a depth of about 25 cm. The ambient temperature of the greenhouse was measured by hanging the alcohol thermometer in the air. Moisture content: The fresh sample was dried in an oven at 105°C to constant weight and then measured. pH value and conductivity: The fresh sample was mixed with carbon-free water at a sample-liquid ratio of 1 / 10 (w / v), shaken in a shaker at 180 rpm for 1 h, and allowed to stand for half an hour. The pH value (pHS-3C pH meter) and EC value (Leci DDSJ-308F conductivity meter) of the supernatant were measured by the electrode method.

[0060] (2) Extraction and content determination of gibberellin GA3: Fresh samples collected from compost at different times were frozen at -80°C for 24 h, and dehydrated and dried at -55°C and 12.0 Pa vacuum conditions to prepare freeze-dried compost samples. The freeze-dried samples were ground in a ball mill and passed through an 80-mesh sieve to ensure that the samples were fully mixed and to avoid loss of gibberellin during sample preparation. The method for extracting gibberellins from samples is as follows: weigh about 0.2g of sample, add 1mL of precooled reagent one, and extract overnight at 4℃; centrifuge at 8000rpm for 10min, extract the residue with 0.5mL of reagent one for 2 hours, and take out the supernatant after centrifugation; combine the two supernatants and blow with nitrogen at 40℃ until there is no organic phase, add 0.5mL of reagent two to extract and decolorize 3 times, and discard the upper ether phase; add reagent three to adjust the pH to 2.8, extract with reagent four three times to combine the organic phase, and blow with nitrogen to dry; add 2mL of reagent five to vortex and dissolve, filter with a syringe filter and put on the machine; wherein, reagent one is acetic acid methanol aqueous solution (600ml ultrapure water is added with 6ml acetic acid, mixed and dissolved, and 400ml methanol is added to mix), reagent two is petroleum ether, reagent three is 1g / ml citric acid aqueous solution; reagent four is ethyl acetate, and reagent five is methanol (HPLC). The gibberellins content in the extract is determined by high performance liquid chromatography.

[0061] The physical and chemical properties of materials change during the composting process as follows:

[0062] Figure 3 The temperature changes of the two groups of composts: In the early stage of composting, due to the addition of bacterial agents, yeast G-1 grew vigorously in the compost samples, which promoted the increase of compost temperature. The temperature of the T1 treatment group rose rapidly to 51.33℃ on the first day of composting, and then entered the high temperature period, and reached the highest temperature of 63.9℃ on the sixth day of composting, which was significantly higher than that of the control treatment group; the average daily temperature of the T1 treatment group was 58.35℃ during the high temperature period (1d to 16d), which was about 3.35℃ higher than the average temperature of the CK group.

[0063] Compost moisture content changes as Figure 4aThe initial moisture content of the compost sample was about 68%. During the composting process, the moisture content of both treatment groups decreased. At 48 days after composting, the moisture content of the gibberellin-degrading bacteria treatment and the control group dropped to 47.98% and 46.46%, respectively, which were 19.89% and 22.23% lower than the initial sample moisture content.

[0064] like Figure 4b-Figure 4c As shown in the figure, the changes of pH and conductivity EC in the two treatments of T1 and CK during the composting process are consistent. During the high temperature period of composting (8d), as the materials degrade, the nitrogen-containing substances decompose into ammonium nitrogen and produce volatile gases such as ammonia. The pH rises rapidly, the materials become alkaline and gradually stabilize in the later stage of composting, fluctuating in the range of 8.03 to 8.69. As the materials continue to degrade during the composting process, the moisture content of the pile decreases, and the materials are concentrated, the conductivity EC values ​​of the two treatments increase and stabilize during the high temperature period. The EC value of the T1 treatment is 2.98ms / cm, and the EC value of the CK treatment is 3.27ms / cm. In terms of these physical and chemical indicators, the treatment after adding the fermentation agent is consistent with the changes in the rules of ordinary aerobic composting.

[0065] Figure 5 The changes of gibberellin content in the gibberellin-degrading bacteria treatment and the control treatment during the composting process. Figure 5 It can be seen that the initial sample contained a high content of gibberellins, which was 7.12 mg / g. In the early stage of composting, the gibberellins content in the material increased slightly due to the gibberellins remaining in the fermentation residues reusing the nutrients such as protein in the compost material. After 8 days, the degradation rate was faster and the gibberellins content decreased significantly. From the early changes, it can be seen that the main function of gibberellins degrading bacteria is to inhibit the increase of gibberellins content and promote the degradation of gibberellins in the early stage. At 40 days of composting, the gibberellins content in the T1 group treated with the bacterial agent dropped to 1.12 mg / g, and the gibberellins content in the CK group dropped to 2.89 mg / g. However, when the moisture content in the material reached 48 days of composting, due to the decrease in the moisture content of the material, the gibberellins were not completely degraded. Therefore, a certain amount of water was added to maintain the moisture content of the material, so that the compost was fermented again. The gibberellins in the T1 treatment group dropped to the detection limit at 65 days, which was considered to be completely degraded, while the gibberellins in the CK group were completely degraded at 75 days.

[0066] As can be seen from the above examples, the present invention provides a kind of yeast G-1 for degrading gibberellin GA3 and the preparation and application of its fermentation agent, the yeast is Yarrowia lipolytica in Latin, and the deposit number is CGMCC No.32800. The yeast G-1 of the present invention can grow in an environment with gibberellin as the only carbon source, and has a good degradation effect on gibberellin. After the strain is cultured for 48 hours, the degradation efficiency of gibberellin reaches 24%. It is prepared as a fermentation agent and applied to the aerobic composting process of fermentation residue, which significantly accelerates the degradation of residual gibberellin in the material, and has important significance for the harmless treatment of gibberellic acid fermentation residue, resource-based high-value utilization, and removal of gibberellin residues in agricultural environment.

[0067] The contents described in this specification are merely an enumeration of implementation forms of the inventive concept, and the protection scope of the present invention should not be regarded as being limited to the specific forms described in the embodiments.

Claims

1. A yeast G-1, characterized in that Yarrowia lipolytica Yarrowia lipolytica , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No. 32800.

2. A yeast G-1 as claimed in claim 1, characterized in that The appearance of the yeast G-1 colony is round, milky white, opaque, slightly convex, with neat colony edges and dense, short-hairy hyphae; the DNA sequence of the yeast G-1 is shown in SEQ ID NO:

1.

3. Use of the yeast G-1 as claimed in claim 1 in degrading gibberellin GA3.

4. The use according to claim 3, characterized in that The yeast G-1 is made into a biodegradation bacterial agent and is applied to the degradation of gibberellin residues in an agricultural environment.

5. The use according to claim 4, characterized in that The degradation method of gibberellin residues used in agricultural environments is aerobic composting. The specific application method is: yeast G-1 is made into a biodegradable agent, mixed with sawdust, and the sawdust is used as an auxiliary material and mixed evenly with the gibberellic acid fermentation residue to obtain a compost mixture, and aerobic composting is carried out for natural fermentation.

6. The use according to claim 5, characterized in that The mass ratio of gibberellic acid fermentation residue to sawdust is 3.5-4.5:1, the mass fraction of the biodegradation agent added to the compost mixture is 1-5%, and the OD of the microbial concentration when the biodegradation agent is added is 600 It is 0.8-1.

0.

7. The use according to claim 5, characterized in that The preparation process of the biodegradable bacterial agent is as follows: yeast G-1 is inoculated into LB liquid culture medium, and cultured in a shaking bottle or shaking table to make the OD of the microorganism concentration in the liquid 600 When the ratio reaches 0.8-1.0, the biodegradable bacterial agent is obtained.

Images