Application of amiC gene in increasing yield of isocoumarin antibiotics

Abstract

The invention discloses an application of amiC gene in increasing the yield of isocoumarin antibiotics, the amiC gene is transformed into a bacterial strain for producing the isocoumarin antibiotics, a bacterial strain for overexpressing the amiC gene is obtained through screening, and the capacity of the bacterial strain for producing the isocoumarin antibiotics is obviously improved. According to the invention, amiC gene transformation is introduced into bacillus subtilis for producing the Amicacins antibiotics, it is accidentally found that compared with an original strain, the production capacity of the Amicacins antibiotics of the genetically modified fmb60amiC strain is greatly improved, and powerful support is provided for large-scale industrial production; the strain with high yield of the Amicacins antibiotics is obtained by means of molecular biology, a new method for improving the yield of the Amicacins antibiotics is expanded, and research on new functions of the amiC gene is started.

Description

Technical Field

[0001] The invention belongs to the technical field of biopharmaceuticals and relates to an application, in particular to an application of an amiC gene in improving the yield of isocoumarin antibiotics. Background Art

[0002] Isocoumarin antibiotics (Amicoumacins antibiotics) as a class of natural products, it is a kind of iso-fragrant compounds produced by microorganisms, has a wide range of antibacterial activity, can effectively inhibit the growth of a variety of pathogenic microorganisms, and has important application prospects in agriculture and medicine. However, the current output of Amicoumacins antibiotics is low, which limits its application in industrial production. Although the traditional fermentation production process can increase the output to a certain extent, the bottleneck of output improvement still exists, and many traditional methods still need to rely on complex operations and high costs. Therefore, exploring strategies to improve antibiotic production through genetic engineering technology has become a hot topic in current research.

[0003] At present, a large number of studies on the production of natural antibiotics have been carried out at home and abroad, especially in the fermentation production of antimicrobial peptides and secondary metabolites. However, although fermentation processes and separation technologies have made some breakthroughs in optimizing production conditions and increasing the yield of antimicrobial substances, they still face difficulties in large-scale industrial production. Genetic engineering technology has gradually been applied to the directional transformation of strains to increase the yield of target products by optimizing the metabolic pathways of strains. Related research mainly focuses on strain improvement through exogenous gene overexpression, mutation screening, etc., but research on Amicoumacins antibiotics is still in its infancy.

[0004] In recent years, facing the huge threat of increasingly serious bacterial resistance and emerging infectious diseases, the demand for new antibiotics has become increasingly urgent. Microbial natural products are one of the main sources of antibiotics. Bacillus subtilis fmb60 is a Gram-positive bacterium that can secrete a variety of natural products with antibacterial, antitumor, and biological herbicidal activities during metabolism. Among them, Amicoumacins antibiotics are isocoumarin compounds, which have excellent antibacterial, antitumor, and antiviral activities, especially against Helicobacter pylori, methicillin-resistant and benzylpenicillin-resistant Staphylococcus aureus. It has a significant inhibitory effect and has attracted widespread attention. However, in practice, it has not been widely used in the development of new antibiotics. The reason is that its production cost is high. Therefore, increasing its yield has become a key issue in reducing its production cost.

[0005] At present, research results at home and abroad show that the main method to increase the production of Amicoumacins antibiotics is to select excellent strains and optimize their fermentation conditions, while molecular biological methods are rarely used to improve strains to increase the production of Amicoumacins antibiotics. However, with the gradual maturity of molecular biological technology and the deepening of research on the mechanism of antibiotic synthesis and secretion, the original strains are genetically modified by modifying the signal pathways in their synthesis and secretion, thereby improving their ability to synthesize and secrete antibiotics.

[0006] The NRPS / PKS gene cluster in the genome of B. subtilis fmb60 was annotated by antiSMASH, in which the amiC gene was annotated as a hypothetical protein. This gene with unknown function greatly hindered our research on the biosynthetic pathway of Amicoumacins antibiotics and hindered engineering transformation, resulting in our inability to obtain valuable drug precursors.

[0007] Therefore, in order to solve the above technical problems, the current research and development trend is to explore new functions of the amiC gene through molecular biology methods, develop a Bacillus with high production of Amicoumacins antibiotics, improve its ability to secrete Amicoumacins antibiotics, and enable large-scale industrial production. Summary of the invention

[0008] The purpose of the present invention is to provide an application of the amiC gene in increasing the production of isocoumarin antibiotics. The amiC gene is introduced into a strain to obtain a strain that overexpresses the amiC gene to increase the production of Amicoumacins antibiotics. Compared with the original strain, the production capacity of Amicoumacins antibiotics is greatly improved, a new method for producing Amicoumacins antibiotics in strains that produce Amicoumacins antibiotics is expanded, and strong support is provided for large-scale industrial production, which opens up research on new functions of the amiC gene.

[0009] In order to achieve the above object, a technical solution provided by a specific embodiment of the present invention is as follows:

[0010] In one aspect, the present invention provides a biomaterial that can be used to increase the production of isocoumarin antibiotics, wherein the biomaterial contains an amiC gene that can be overexpressed, and the nucleotide sequence of the amiC gene is shown in SEQ ID NO:1.

[0011] In one or more embodiments of the present invention, the biological material is selected from an expression cassette, a recombinant vector and a strain comprising an amiC gene, wherein the strain is a Bacillus that produces isocoumarin antibiotics;

[0012] Preferably, the Bacillus is selected from any one of Bacillus subtilis, Bacillus Velezii or Bacillus amyloliquefaciens; the Bacillus is preferably a strain fmb60amiC overexpressing the amiC gene.

[0013] On the other hand, the present invention also provides an amiC gene and the use of the above-mentioned biological material in increasing the yield of isocoumarin antibiotics or producing isocoumarin antibiotic-related products, and the nucleotide sequence of the amiC gene is shown in SEQ ID NO: 1.

[0014] In one or more embodiments of the present invention, the biological material package is selected from an expression cassette, a recombinant vector and a strain comprising the amiC gene.

[0015] In one or more embodiments of the present invention, the strain is a Bacillus that produces Amicoumacins antibiotics, and the Bacillus is preferably selected from at least one of Bacillus subtilis, Bacillus Velezii or Bacillus amyloliquefaciens.

[0016] In one or more embodiments of the present invention, the strain is the amiC gene overexpressing strain fmb60amiC.

[0017] In one or more embodiments of the present invention, the product related to the production of isocoumarin antibiotics is selected from any one of food additives, preservatives, antiseptics and medicines including isocoumarin antibiotics.

[0018] On the other hand, the present invention also provides a method for preparing a high-yield strain of isocoumarin antibiotics or a method for increasing the yield of Amicoumacins antibiotics, comprising transforming the amiC gene into Bacillus that produces Amicoumacins antibiotics, and screening to obtain a strain that overexpresses the amiC gene.

[0019] In one or more embodiments of the present invention, the method is performed by a method comprising the following steps:

[0020] 1) Designing a first primer pair based on the nucleotide sequence of the amiC gene, and using the genomic DNA of the target Bacillus as a template to amplify the target fragment of the amiC gene;

[0021] 2) Designing a second primer pair for inverse PCR, using the vector plasmid as a template, and amplifying a linear plasmid fragment;

[0022] 3) connecting the target fragment of the amiC gene and the linear plasmid fragment to obtain a transformant;

[0023] 4) Then the transformant is transferred into the target Bacillus, and the strain expressing the amiC gene is obtained.

[0024] In one or more embodiments of the present invention, the strain is Bacillus, and the Bacillus is preferably at least one selected from Bacillus subtilis, Bacillus Velezii or Bacillus amyloliquefaciens, preferably strain fmb60amiC.

[0025] In one or more embodiments of the present invention, it is characterized in that, in step 1), the first primer pair comprises an amiC upstream primer and an amiC downstream primer, the nucleotide sequence of the amiC upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the amiC downstream primer is shown in SEQ ID NO: 3; or

[0026] In step 2), the second primer pair includes an inverse PCR upstream primer and an inverse PCR downstream primer, the nucleotide sequence of the inverse PCR upstream primer is shown in SEQ ID NO:4, and the nucleotide sequence of the inverse PCR downstream primer is shown in SEQ ID NO:5.

[0027] In one or more embodiments of the present invention, the method is performed by a method comprising the following steps:

[0028] (1) Construction of amiC gene overexpression vector pHY01-amiC

[0029] A. Design primers (first primer pair) based on the amiC gene of Bacillus subtilis, including amiC-F and amiC-R, and use the genomic DNA of Bacillus subtilis fmb60 as a template to PCR amplify the gene fragment of amiC. At the same time, design reverse PCR primers, including reverse PCR upstream primer (pHY300-F) and reverse PCR downstream primer (pHY300-R), and use the pHY300-PaprN plasmid as a template to amplify the linear plasmid fragment pHT01, which is stored at -20°C for future use after enzyme digestion verification and sequencing. The above primer sequences are listed below:

[0030]

[0031] The PCR reaction conditions for the above-mentioned amplification of the amiC gene fragment and the reverse PCR are as follows: The PCR amplification system is as follows:

[0032]

[0033] The PCR reaction conditions were: 98°C for 30 s; 98°C for 10 s, 60°C for 30 s, 72°C at 1 kb / min, 30 cycles; 72°C for 10 min. The amplified product was verified by agarose gel electrophoresis and GelRad staining, and the target gene fragment was recovered according to the instructions of the gel recovery kit.

[0034] B. Then use One Step Cloning Kit to connect the linear plasmid and the target gene. The connection uses a 20μL system:

[0035]

[0036] After the reaction solution reacted at 37°C for 30 min, a reaction mixture was obtained, and 10 μL of the reaction mixture was taken to transform into E. coli JM110 competent cells. The transformation method was referred to the competent cell instruction manual. Ampicillin (Amp, 50 μg / mL) was added to the medium required for transformant culture, and colony PCR verification was performed using primers pHY verification F and pHY verification R;

[0037] name Sequence (5'-3') pHY Verification F GAATGAAGCCATACCAAACGA(SEQ ID NO:6) pHY Verification R GATAACATCCGATCTACATGC(SEQ ID NO:7)

[0038] The reaction system (20 μL) is as follows:

[0039]

[0040]

[0041] After the recombinant plasmid pHY01-amiC was verified to be correct by colony PCR and product sequencing, the positive transformants were selected for expansion culture to extract the demethylated plasmid for subsequent electroporation;

[0042] (2) Construction of amiC gene overexpression strain

[0043] Competent cells were prepared using Bacillus subtilis fmb60 as the starting strain. The obtained amiC gene overexpression vector pHY01-amiC was transformed into Bacillus subtilis fmb60 by electroporation. Tetracycline (Tc, 15 μg / mL) was added to the medium required for transformant culture. Colony PCR verification was performed using primers pHY verification F and pHY verification R. The reaction system (20 μL) was as follows:

[0044]

[0045] After verification by colony PCR and product sequencing, the expected overexpression strain fmb60amiC was obtained.

[0046] Compared with the prior art, the application of the amiC gene in the present invention to increase the production of isocoumarin antibiotics has opened up new uses for the amiC gene. Specifically, by transforming and introducing the amiC gene into Bacillus subtilis producing Amicoumacins antibiotics, it is unexpectedly found that the amiC gene can increase the production of Amicoumacins antibiotics of the Bacillus subtilis producing Amicoumacins antibiotics.

[0047] In the present invention, Bacillus subtilis fmb60 is selected as the original strain, and the amiC gene is transferred and introduced to construct a strain fmb60amiC with high yield of Amicoumacins antibiotics. Compared with the original strain, the production capacity of Amicoumacins antibiotics of the genetically modified fmb60amiC strain is greatly improved, which provides strong support for large-scale industrial production; that is, a strain with high yield of Amicoumacins antibiotics is obtained by means of molecular biology, which expands a new method for increasing the yield of Amicoumacins antibiotics; and through further experimental verification, it is found that the amiC gene may positively regulate the biosynthesis of Amicoumacin antibiotics, which opens up research on new functions of the amiC gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0049] Figure 1 This is a flow chart of a method for increasing the production of isocoumarin antibiotics by overexpressing the amiC gene in an embodiment of the present invention;

[0050] Figure 2 is a flow chart of the experimental process in Example 2 of the present invention;

[0051] Figure 3 The agarose gel electrophoresis results in Example 2 of the present invention;

[0052] Figure 4 It is a graph showing the antibacterial test results in Example 3 of the present invention;

[0053] Figure 5 It is a statistical result diagram of the antibacterial experiment in Example 3 of the present invention;

[0054] Figure 6This is a PCR verification diagram of the amiC gene knockout strain in Example 5 of the present invention;

[0055] Figure 7 This is a graph showing the HPLC verification result of the effect of amiC gene deletion on the synthesis of Amicoumacin antibiotics in Example 5 of the present invention, wherein 1, 2, 3, 4, and 5 represent compounds 1-5, respectively;

[0056] Figure 8 These are the HPLC verification result graphs of the effect of the amiC gene deletion in Example 5 of the present invention on the synthesis of other antibiotics, wherein A is the HPLC verification result graph of the effect on Surfactins antibiotics, B is the HPLC verification result graph of the effect on Fengycins antibiotics; C is the HPLC verification result graph of the effect on Aurantinins antibiotics, wherein 1, 2, 3, 4, and 5 respectively represent the peaks of the detected antibiotics at those positions. DETAILED DESCRIPTION

[0057] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0059] The present invention first uses the inverse PCR technology and the one-step cloning method to construct the amiC overexpression vector pHY01-amiC, then the recombinant plasmid is first transferred into E. coli JUM110 for demethylation treatment, and finally transferred into Bacillus subtilis fmb60 by the electroporation method, thereby constructing a Bacillus subtilis strain fmb60amiC with high yield of Amicoumacins antibiotics. The mutant strain is identified by the colony PCR method; the antibacterial ability of the improved strain is evaluated by the antibacterial experiment; the yield of Amicoumacins antibiotics of the improved strain is analyzed by high performance liquid chromatography (HPLC). For the specific process, see Figure 1 .

[0060] The amicoumacin antibiotics in this article are isocoumarin compounds produced by microorganisms, including cyclosporin A (Bacilosarcin A), Bacilosarcin B, BacilmacinA, N-acetyl-isocoumarin antibiotic C (N-acetyI-amicoumacin C) and isocoumarin antibiotic C (amicoumacin C), which are produced by microorganisms mainly composed of Bacillus. Bacilosarcin A and Bacilosarcin B were discovered earlier, with a high frequency of discovery, in-depth activity research, and classic biogenic pathways, which can better reflect the characteristics of this class of compounds. Therefore, the amicoumacin antibiotics are collectively referred to in this article; among them, "Bacilosarcin A" is also referred to as "Compound 1" in this article, Bacilosarcin B is also referred to as "Compound 2", and Bacilmacin A is also referred to as "Compound 3"; N-acetyI-amicoumacin C is also referred to as "Compound 4", and amicoumacin C is also referred to as "Compound 5".

[0061] Unless otherwise specified, "fmb60" herein refers to "Bacillus subtilis fmb60".

[0062] Unless otherwise specified, "fmb60amiC" herein refers to "Bacillus subtilis fmb60 overexpressing the amiC gene".

[0063] Unless otherwise specified, "fmb60ΔamiC" or "fmb60-ΔamiC" herein refers to "mutant Bacillus subtilis fmb60 with amiC gene knocked out".

[0064] Unless otherwise specified, the reagents and materials in this article can be purchased from conventional channels.

[0065] Example 1. Construction of amiC gene overexpression vector pHY01-amiC

[0066] 1. Amplification of target gene and linearized plasmid fragments

[0067] Primers (first primer pair) were designed based on the amiC gene of Bacillus subtilis, which included an amiC upstream primer (The amiC gene fragment was obtained by PCR amplification using Bacillus subtilis fmb60 genomic DNA as a template. At the same time, a reverse PCR primer (the second primer pair) was designed, including a reverse PCR upstream primer (pHY300-F) and a reverse PCR downstream primer (pHY300-R), and a linear plasmid fragment pHT01 was obtained by amplification using the pHY300-PaprN plasmid as a template. After enzyme digestion verification and sequencing, it was stored at -20°C for future use.

[0068] The nucleotide sequence of the amiC gene is shown in SEQ ID NO: 1:

[0069]

[0070] The sequences of the primers are shown in Table 1 below, and the PCR reaction conditions for amplifying the amiC gene fragment and the reverse PCR are shown in Table 2 below.

[0071] Table 1. Primer sequences

[0072]

[0073] Table 2. PCR amplification system

[0074] 2 × PhantaMaxMasterMix 25μL 10 μM upstream primer 2μL 10 μM downstream primer 2μL DNA (fmb60 genomic DNA / pHY300-PaprN plasmid) 2μL <![CDATA[ddH2O]]> Make up to 50 μL

[0075] The PCR reaction conditions were: 98°C for 30 s; 98°C for 10 s, 60°C for 30 s, 72°C at 1 kb / min, 30 cycles; 72°C for 10 min. The amplified product was verified by agarose gel electrophoresis and GelRad staining, and the target gene fragment was recovered according to the instructions of the gel recovery kit.

[0076] 2. Ligation of linearized plasmid fragments and target genes

[0077] One Step Cloning Kit was used to connect the linear plasmid and the target gene. The connection was carried out using a 20 μL system as follows:

[0078]

[0079] After the reaction solution was reacted at 37°C for 30 min, a reaction mixture was obtained, and 10 μL of the reaction mixture was transformed into E. coli JM110 competent cells. The transformation method was referred to the competent cell instruction manual. Ampicillin (Amp, 50 μg / mL) was added to the medium required for transformant culture. Primers pHY verification F and pHY verification R were used for colony PCR verification. The reaction system (20 μL) was as follows:

[0080]

[0081]

[0082] After the recombinant plasmid pHY01-amiC was verified to be correct by colony PCR and product sequencing, the positive transformants were picked and expanded for culture to extract the demethylated plasmid for subsequent electro-transformation.

[0083] Example 2. Construction of Bacillus subtilis fmb60 overexpressing amiC gene and colony PCR verification

[0084] Bacillus subtilis fmb60 (Genomics-Inspired Discovery ofThree AntibacterialActiveMetabolites,Aurantinins B,C,and D from Compost-Associated Bacillussubtilis fmb60,Jie Yang,Xiaoyu Zhu,Mingming Cao,Changbao Wang,et al.) was used as the starting strain to prepare competent cells, and the obtained amiC gene overexpression vector pHY01-amiC was transformed into Bacillus subtilis fmb60 by electroporation. Tetracycline (Tc, 15 μg / mL) was added to the culture medium required for transformant culture, and colony PCR verification was performed using primers pHY verification F and pHY verification R, where the primers used are shown in Table 3 below.

[0085] Table 3

[0086] name Sequence (5'-3') pHY Verification F GAATGAAGCCATACCAAACGA(SEQ ID NO:6) pHY Verification R GATAACATCCGATCTACATGC(SEQ ID NO:7)

[0087] The reaction system (20 μL) for the above PCR verification is as follows:

[0088]

[0089] The experimental process is as follows Figure 2 The results of agarose gel electrophoresis experiments are shown in Figure 3 As shown, from Figure 3 It can be seen that after verification by colony PCR and product sequencing, the expected amiC gene-overexpressing Bacillus subtilis fmb60, namely fmb60amiC, was obtained.

[0090] Example 3. Antibacterial Experiment Verification

[0091] The strain fmb60amiC with overexpressed amiC gene obtained in Example 2 was subjected to antibacterial test by punching method, and the indicator strain used was Staphylococcus aureus CICC 23656. Melt the LB solid culture medium to room temperature without being hot, add 1 ml of bacterial suspension of the indicator strain and mix well, then pour into a sterile plate. After the culture medium solidifies, dig holes, and draw 200 μL of sterile fermentation supernatant of fmb60 and amiC gene overexpressed strain fmb60amiC into the holes, respectively, and place in a 37°C incubator for 24 hours. Observe whether there is an antibacterial zone around the hole, and measure the diameter of the antibacterial zone with a ruler. The results show that the antibacterial zones of fmb60 and fmb60amiC against Staphylococcus aureus are 18.79±0.19 mm and 26.99±0.49 mm, respectively, which is 1.44 times higher than that of fmb60. Figure 4-5 shown.

[0092] from Figure 4-5 It can be seen that compared with the original strain fmb60, the inhibition zone of fmb60amiC is significantly larger than that of the original strain fmb60, and the difference is significant.

[0093] Example 4. HPLC analysis of the yield of Amicoumacins antibiotics from fmb60amiC

[0094] The fmb60 and fmb60amiC strains were inoculated into LB liquid medium and cultured overnight at 37°C and 180rpm as seed liquid. Subsequently, the seed liquid was transferred to a 250mL conical flask containing 50mL Landy medium at an inoculation rate of 3%, and fermented at 33°C and 180rpm for 36h. After the fermentation was completed, the fermentation broth was centrifuged at 10,000×g for 15 minutes and the supernatant was collected. The pH value of the supernatant was adjusted to 2.0 using HCl and allowed to stand at 4°C overnight. After standing, it was centrifuged again at 10,000×g for 15 minutes, the precipitate was removed, and the supernatant was collected. The pH value of the supernatant was adjusted to 7.0 with NaOH, and then the supernatant was extracted twice with an equal volume of ethyl acetate, and the organic solvent layer was collected. After rotary evaporation at 45°C, the residue was dissolved in 1mL methanol, filtered with a 0.22μm filter membrane, and analyzed by high-resolution liquid chromatography (HPLC), wherein the chromatographic conditions of HPLC are as follows:

[0095] C18 column (5 μm, 4.6 × 250 mm id, Agilent Technologies, Palo Alto, CA, USA);

[0096] Injection volume: 20 μL;

[0097] Detection wavelength: 210nm;

[0098] Flow rate: 0.8 mL / min;

[0099] Mobile phase: Phase A is ultrapure water, phase B is acetonitrile; mobile phase gradient: 0-60min, phase B: 10-90%.

[0100] The results of HPLC analysis are shown in Table 4 below.

[0101] Table 4

[0102] strain Retention time (min) Peak area (mAU) fmb60 10-20 4297.862 fmb60amiC 10-20 6517.629

[0103] According to the peak area ratio in Table 4, the ratio of the production of Amicoumacins antibiotics in strain fmb60amiC to the production of Amicoumacins antibiotics in the original strain fmb60 was 1.5.

[0104] Therefore, after HPLC analysis, the production of Amicoumacins antibiotics in fmb60amiC increased by 1.5 times compared with the original strain fmb60.

[0105] Example 5. Effect of amiC gene deletion on the synthesis of Amicoumacin antibiotics

[0106] 1. Preparation of amiC gene deletion strain

[0107] Using B. subtilis fmb60 genomic DNA as a template, the upstream and downstream homologous arms of the C=N reductase gene were amplified, the upstream and downstream homologous arms of the gene to be knocked out were double-digested with EagI and BamHI, and T4 ligated with the pRN5101 plasmid vector part, and electroporated into Escherichia coli GB2005. The transformants were repeatedly screened in LB medium containing ampicillin (Amp concentration was 100 μg / mL), and the transformants were picked and cultured in LB liquid containing ampicillin (Amp concentration was 50 μg / mL) at 30°C and 950 rpm. The plasmids were extracted and sequenced, and no mutations occurred in the homologous arm part.

[0108] When verifying the double exchange colonies for PCR identification, the primers used are the internal primers of the gene to be knocked out and the primers at both ends of the gene to be knocked out. Figure 6 As shown in the figure, the length of the PCR amplification band of the amiC knockout mutant genome is about 800 bp shorter than the length of the PCR amplification band of the B. subtilisfmb60 genome using external primers, which is consistent with the PCR results of the internal primers. The amiC gene was successfully knocked out, and the correct knockout mutant fmb60ΔamiC was obtained in the experiment.

[0109] 2. Effect of amiC gene deletion on the synthesis of amicoumacin antibiotics

[0110] In order to analyze the effect of amiC gene on the biosynthesis of Amicoumacin antibiotics in the metabolic pathway of B. subtilis fmb60, this study used HPLC-MS combined technology and referred to relevant literature (Yang Jie, 2017) to detect and analyze the Amicoumacin antibiotics produced by B. subtilis fmb60 and fmb60ΔamiC strains (see Example 4 for specific chromatographic conditions). The results are as follows Figure 6 And as shown in Table 5.

[0111] Table 5

[0112]

[0113] from Figure 7 As can be seen from Table 5, in fmb60ΔamiC, the production of Amicoumacin antibiotics decreased by 4.26 times as a whole, with significant changes, among which Bacilosarcin A decreased the most. Based on this result, we further speculated that amiC can positively regulate the biosynthesis of Amicoumacins antibiotics.

[0114] 3. Effect of amiC gene knockout on the synthesis of other antibiotics in B. subtilis fmb60

[0115] In order to analyze whether the amiC gene in the metabolic pathway of B. subtilis fmb60 affects the biosynthesis of surfactin, fengycin and aurantinins antibiotics in addition to the effect on the biosynthesis of amicoumacin antibiotics, the surfactin, fengycin and aurantinins antibiotics produced by the fermentation of fmb60 and fmb60ΔamiC strains were detected and analyzed using HPLC technology and reference to the absorption spectral characteristics and peak time comparisons of these antibiotics in relevant literature. The test results are shown in Figures AC in Figure 8.

[0116] Among them, the chromatographic conditions of Surfactin antibiotics are as follows:

[0117] C18 chromatographic column (5 μm, 4.6×250 mm id, Agilent Technologies, Palo Alto, CA, USA); injection volume 20 μL; column temperature 35 °C;

[0118] Detection wavelength: 210nm;

[0119] Flow rate: 0.84 mL / min; detection time: 20 min.

[0120] Solvent: Phase B is acetonitrile plus 1% trifluoroacetic acid, and phase A is purified water plus 1% trifluoroacetic acid; mobile phase gradient: 0-9min, phase B: 60-93%, 9-20min, phase B: 93%.

[0121] The chromatographic conditions for Fengycin antibiotics are as follows:

[0122] C18 chromatographic column (5 μm, 4.6×250 mm id, Agilent Technologies, Palo Alto, CA, USA); injection volume 20 μL; column temperature 35 °C;

[0123] Detection wavelength: 205nm;

[0124] Flow rate: 0.6 mL / min; detection time: 60 min.

[0125] Solvent: Phase B is acetonitrile plus 1% trifluoroacetic acid, and phase A is purified water plus 1% trifluoroacetic acid; mobile phase gradient: 0-10min, phase B: 30-50%, 10-60min, phase B: 50-60%.

[0126] The chromatographic conditions for Aurantinin antibiotics are as follows:

[0127] C18 chromatographic column (5 μm, 4.6×250 mm id, Agilent Technologies, Palo Alto, CA, USA); injection volume 20 μL; column temperature 35 °C;

[0128] Detection wavelength: 210nm;

[0129] Flow rate: 0.8 mL / min; detection time: 60 min.

[0130] Solvent: Phase B is acetonitrile plus 1% trifluoroacetic acid, phase A is purified water plus 1% trifluoroacetic acid; mobile phase gradient: 0-60min, phase B: 10-90%.

[0131] Depend on Figure 8 As can be seen from A in the figure, the HPLC detection of the crude surfactin extract showed that the peak time of surfactin was between 13-20 min. Both fmb60 and the mutant strain fmb60ΔamiC were able to synthesize surfactin antibiotics. Compared with fmb60, the overall production of surfactin antibiotics decreased by 0.17 times after knocking out the amiC gene.

[0132] Depend on Figure 8As can be seen from B, the HPLC test of the crude Fengycin extract showed that the peak time of Fengycin was between 35-45 min. Both fmb60 and the mutant strain fmb60ΔamiC were able to synthesize Fengycin antibiotics with very low yields. Compared with fmb60, the overall yield of Fengycin antibiotics in the mutant strain with amiC knocked out decreased by 0.015 times.

[0133] Depend on Figure 8 As can be seen from C in the figure, the HPLC detection of the crude extract of Aurantinin showed that the correct peak time of Aurantinin was between 10-17.5 min. Both fmb60 and the mutant strain fmb60ΔamiC were able to synthesize Aurantinins antibiotics. Compared with fmb60, the overall production of Aurantinins antibiotics in the knockout mutant strain fmb60ΔamiC increased by 0.1 times.

[0134] The above experimental results indicate that the amiC gene may positively regulate the biosynthesis of Amicoumacins antibiotics, but cannot positively regulate the synthesis of other antibiotics.

[0135] In summary, the application of the amiC gene of the present invention in increasing the production of isocoumarin antibiotics has opened up a new use of the amiC gene. Specifically, by transforming and introducing the amiC gene into Bacillus subtilis producing Amicoumacins antibiotics, it was unexpectedly found that the amiC gene can increase the production of Amicoumacins antibiotics of the Bacillus subtilis producing Amicoumacins antibiotics.

[0136] In the present invention, Bacillus subtilis fmb60 is selected as the original strain, and the amiC gene is transferred and introduced to construct a strain fmb60amiC with high yield of Amicoumacins antibiotics. Compared with the original strain, the production capacity of Amicoumacins antibiotics of the genetically modified fmb60amiC strain is greatly improved, which provides strong support for large-scale industrial production; that is, a strain with high yield of Amicoumacins antibiotics is obtained by means of molecular biology, which expands a new method for increasing the yield of Amicoumacins antibiotics; and through further experimental verification, it is found that the amiC gene may positively regulate the biosynthesis of Amicoumacin antibiotics, which opens up research on new functions of the amiC gene.

[0137] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0138] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A biological material capable of increasing the yield of isocoumarin antibiotics, wherein the biological material contains an amiC gene capable of overexpression, and the nucleotide sequence of the amiC gene is shown in SEQ ID NO:

1.

2. The biomaterial according to claim 1, characterized in that The biological material is selected from an expression cassette including an amiC gene, a recombinant vector and a strain, wherein the strain is a Bacillus that produces isocoumarin antibiotics; Preferably, the Bacillus is selected from any one of Bacillus subtilis, Bacillus Velezii or Bacillus amyloliquefaciens; the Bacillus is preferably a strain fmb60amiC overexpressing the amiC gene.

3. Use of the amiC gene and the biomaterial according to claim 1 or 2 in increasing the yield of isocoumarin antibiotics or producing isocoumarin antibiotic-related products, wherein the nucleotide sequence of the amiC gene is shown in SEQ ID NO:

1.

4. The use according to claim 3, characterized in that: The biological material is selected from the group consisting of an expression cassette, a recombinant vector and a strain comprising the amiC gene; Preferably, the strain is a Bacillus that produces isocoumarin antibiotics, and the Bacillus is preferably selected from any one of Bacillus subtilis, Bacillus Velezii or Bacillus amyloliquefaciens.

5. The use according to claim 4, characterized in that: The strain is the strain fmb60amiC which overexpresses the amiC gene.

6. The use according to any one of claims 3 to 5, characterized in that The isocoumarin antibiotic related products include any one of isocoumarin antibiotic food additives, preservatives, antiseptics and medicines.

7. A method for preparing a high-yield strain of isocoumarin antibiotics or a method for increasing the yield of isocoumarin antibiotics, comprising transforming the amiC gene into a strain that produces isocoumarin antibiotics, and screening to obtain a strain that overexpresses the amiC gene, wherein the nucleotide sequence of the amiC gene is as shown in SEQ ID NO:

1.

8. The method according to claim 7, characterized in that The method is carried out by a method comprising the steps of: 1) Designing a first primer pair based on the nucleotide sequence of the amiC gene, and using the genomic DNA of the target Bacillus as a template to amplify the target fragment of the amiC gene; 2) Designing a second primer pair for inverse PCR, using the vector plasmid as a template, and amplifying a linear plasmid fragment; 3) connecting the target fragment of the amiC gene and the linear plasmid fragment to obtain a transformant; 4) Then the transformant is transferred into the target Bacillus, and the strain overexpressing the amiC gene is obtained.

9. The method according to claim 7 or 8, characterized in that: The strain is Bacillus, and the Bacillus is selected from any one of Bacillus subtilis, Bacillus Velezii or Bacillus amyloliquefaciens, preferably strain fmb60amiC.

10. The method according to any one of claims 7 to 9, characterized in that In step 1), the first primer pair comprises an amiC upstream primer and an amiC downstream primer, the nucleotide sequence of the amiC upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the amiC downstream primer is shown in SEQ ID NO: 3; or In step 2), the second primer pair includes an inverse PCR upstream primer and an inverse PCR downstream primer, the nucleotide sequence of the inverse PCR upstream primer is shown in SEQ ID NO:4, and the nucleotide sequence of the inverse PCR downstream primer is shown in SEQ ID NO:5.

Images