Method for rapidly obtaining genetic transformation root system of citrus rootstock and application of method

Abstract

The invention belongs to the technical field of plant genetic transformation, and particularly relates to a method for rapidly obtaining a citrus rootstock genetic transformation root system and application thereof. According to the genetic transformation method, agrobacterium rhizogenes K599 is used as a medium, an infection solution is transfected through a wound of a citrus plant, the infection solution can be quickly transfected into a stem segment of the citrus plant, and finally, the genetically transformed citrus plant can be quickly obtained in a high-pressure propagation mode. The method provided by the invention can effectively shorten the transformation system period, reduce the genetic transformation cost, improve the genetic transformation efficiency and avoid the generation of chimeras, and the materials can be repeatedly utilized.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic transformation, and particularly relates to a method for rapidly obtaining a genetically transformed root system of a citrus rootstock and an application thereof. Background Art

[0002] Citrus rootstocks play a vital role in improving the quality of citrus and enhancing its disease resistance and stress resistance, and the root system of the rootstock is the core part. During the growth and development of citrus, the citrus root system not only absorbs water and mineral nutrients from the soil to ensure that citrus obtains sufficient nutrients to support the healthy growth of citrus fields, but also provides mechanical support for fixing citrus to prevent lodging due to wind or water impact. The root system forms a complex mutually beneficial relationship with microorganisms in the soil, improves the effective utilization rate of nutrients, and enhances the disease resistance and stress resistance of citrus. In addition, the root system is also involved in the synthesis and storage of organic matter, regulates the metabolic process in citrus, and secretes chemicals to inhibit the growth of pathogens and pests, playing a protective role. In short, the citrus root system is irreplaceable in ensuring the healthy growth of citrus, improving stress resistance and promoting soil health.

[0003] Genetic transformation of citrus roots can significantly improve the quality of rootstocks without changing the genetic information of scion seedlings, thus opening up a huge space for the promotion and application of citrus. For example, rootstocks improved through genetic transformation of the root system can promote the healthy growth of scion seedlings, optimize nutrient absorption efficiency, and improve the flavor, sweetness, acidity and texture of fruits; at the same time, by introducing disease-resistant genes through genetic transformation of citrus roots, the rootstocks can have stronger disease resistance, reduce the use of pesticides, reduce production costs and environmental impacts, and improve fruit safety and market competitiveness; furthermore, the improved rootstock root system can better adapt to adverse environmental conditions such as drought, salinity, low temperature and high temperature, enhance the plant's resistance to stress, and expand the planting area of ​​citrus.

[0004] Traditional genetic transformation roots are mainly obtained through genetic transformation tissue culture mediated by Agrobacterium tumefaciens or Agrobacterium rhizogenes. Agrobacterium rhizogenes has more advantages than Agrobacterium tumefaciens in genetic root transformation, but the overall genetic transformation process is similar and must go through the following processes: material selection, pre-culture, co-culture, screening culture, and plant regeneration. The entire transformation process is time-consuming and is easily contaminated by bacteria and fungi during tissue culture. The transformation cycle of the genetically transformed rootstock root system obtained by this method is 2 to 3 years, which greatly increases the time cost for researchers.

[0005] High-pressure propagation boxes are a means of propagation for horticultural flower plants, but in citrus propagation, traditional methods such as seedling cultivation, grafting and cuttings are mainly used. So far, there has been no relevant research on the application of high-pressure propagation boxes in citrus genetic transformation. Summary of the invention

[0006] The object of the present invention is to provide a genetic transformation method for citrus plants, which can effectively shorten the transformation system cycle, reduce the genetic transformation cost, improve the genetic transformation efficiency, avoid the generation of chimeras and allow the materials to be reused.

[0007] The present invention provides a genetic transformation method for citrus plants, comprising the following steps:

[0008] making wounds on stems of citrus plant seedlings to obtain citrus plant seedlings with wounds;

[0009] Covering the wound of the citrus plant seedling with a hygroscopic material soaked with an infection solution, wherein the infection solution includes Agrobacterium rhizogenes K599 containing the genetically modified organism;

[0010] After covering for no less than 20 minutes, a high-pressure propagation box containing a plant culture matrix is ​​fixed at the wound position to obtain a citrus plant seedling with the high-pressure propagation box fixed thereon;

[0011] The citrus plant seedlings fixed with the high-pressure propagation box are cultured until roots grow out of the wounds to obtain rooted citrus plant stem segments.

[0012] Preferably, after roots grow out of the wound, the wound is cut off at the lower part of the hairy roots to obtain a rooted citrus plant stem segment;

[0013] The rooted citrus plant stem segments are transplanted to obtain genetically transformed citrus plants.

[0014] Preferably, the method of making wounds includes peeling bark or making deep wounds; the width of the peeled bark is 1 / 4 to 1 / 3 of the circumference of the ring bark, and the length of the peeled bark is 1 to 2 cm; the number of the deep wounds is 5 to 10, and the depth is to expose the wood part.

[0015] Preferably, after a high pressure propagation box containing a plant nutrient matrix is ​​fixed at the wound site, 1 to 2 mL of infection solution is added into the high pressure propagation box.

[0016] Preferably, the root length of the rooted citrus plant stem segment is ≥8 cm, and the number of root segments is ≥5.

[0017] Preferably, the citrus plant seedlings are ≥ 2 years old.

[0018] Preferably, at least one high-pressure propagation box is fixed to each citrus plant seedling.

[0019] Preferably, the hygroscopic material comprises paper and / or gauze.

[0020] Preferably, the citrus plant includes one or more of citron, orange, trifoliate orange and lemon.

[0021] The present invention also provides the application of the genetic transformation method described in the above technical solution in gene function verification.

[0022] Beneficial effects:

[0023] The invention provides a genetic transformation method of citrus plants, comprising the following steps: making a wound on the stem of a citrus plant seedling to obtain a citrus plant seedling with a wound; covering the wound of the citrus plant seedling with a hygroscopic material soaked with an infection liquid, wherein the infection liquid comprises Agrobacterium rhizogenes K599 to be genetically modified; after covering for no less than 20 minutes, fixing a high-pressure propagation box equipped with a plant culture matrix at the wound position to obtain a citrus plant seedling fixed with the high-pressure propagation box; culturing the citrus plant seedling fixed with the high-pressure propagation box until roots grow out of the wound to obtain a rooted citrus plant stem segment. The genetic transformation method of the invention uses Agrobacterium rhizogenes K599 as a medium, and the infection liquid is transduced through the wound of the citrus plant, so that the infection liquid can be quickly transfected into the stem segment of the citrus plant, and finally a genetically transformed citrus plant can be quickly obtained by high-pressure propagation. The method of the present invention has the advantages of effectively shortening the transformation system cycle, reducing the cost of genetic transformation, improving the efficiency of genetic transformation, avoiding the generation of chimeras, and allowing the material to be reused. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0025] Figure 1 is a map of the pCAMBIA-1380-HA vector in Example 1;

[0026] Figure 2 is the recombinant vector map of pCAMBIA-1380-SahA-HA in Example 1;

[0027] Figure 3 This is a diagram showing the transformation verification result of injecting the infection solution into tobacco in Example 1;

[0028] Figure 4The different steps and identification pictures of the genetic transformation method provided in Example 1; A is a seedling of more than 3 years old used for high-pressure propagation experiment; B is a transparent high-pressure propagation box, which can conveniently monitor the development of the root system; C is the direct identification of the transformed root system by fluorescence detection; D is to determine whether to transplant the root system after removing the soil; E is to further verify the transformation rate and transformation effect by fluorescence detection; F is to collect the transgenic roots for sequencing verification and treat the non-transformed roots according to the experimental purpose; G is to transplant when the transformed roots are more than 5 and the length is 8 cm; H is to transplant to hydrophobic and breathable soil for continued cultivation to directly obtain genetically transformed root plants of more than 3 years old;

[0029] Figure 5 Schematic diagram of the genetic transformation method in Example 1;

[0030] Figure 6 This is a gel image of PCR detection of transgenic roots in Example 1;

[0031] Figure 7 This is a graph of root growth in a 45-day high-pressure propagation box with different genetic transformation efficiencies in Example 2;

[0032] Figure 8 The three-year-old orange seedlings and fluorescence verification results in Example 5;

[0033] Fig. 9 The three-year-old trifoliate orange seedlings and fluorescence verification results in Example 6;

[0034] Fig.10 This is the GUS staining verification result of the CsSUC2 phloem-specific expression promoter in the transformed roots in Example 7;

[0035] Fig.11 The expression of fluorescent protein in transgenic roots under a microscope in Example 8. The scale is shown in the lower right corner of the figure, where (except the first row Figure 3 The scale bars of the first to second rows of images are 500 μm, and the scale bar of the third row of images is 75 μm;

[0036] Fig.12 The high pressure propagation and virus transmission in Example 9 were carried out simultaneously on 3-year-old trifoliate orange seedlings. DETAILED DESCRIPTION

[0037] The present invention provides a genetic transformation method for citrus plants, comprising the following steps:

[0038] making wounds on stems of citrus plant seedlings to obtain citrus plant seedlings with wounds;

[0039] Covering the wound of the citrus plant seedling with a hygroscopic material soaked with an infection solution, wherein the infection solution includes Agrobacterium rhizogenes K599 containing the genetically modified organism;

[0040] After covering for no less than 20 minutes, a high-pressure propagation box containing a plant culture matrix is ​​fixed at the wound position to obtain a citrus plant seedling with the high-pressure propagation box fixed thereon;

[0041] The citrus plant seedlings fixed with the high-pressure propagation box are cultured until roots grow out of the wounds to obtain rooted citrus plant stem segments.

[0042] The present invention makes wounds on the stems of citrus seedlings to obtain citrus seedlings with wounds. As an embodiment, the citrus plant described in this party can be one or more of citron, orange, trifoliate orange and lemon. In a specific embodiment, the citrus plant is citron, orange, trifoliate orange or lemon. As an embodiment, the citrus seedlings of the present invention can be ≥2 years old; as another embodiment, the citrus seedlings can be ≥3 years old; in a specific embodiment, the citrus seedlings are 3 years or 4 years old. As an embodiment, the method of making wounds in the present invention can be peeling bark or deep wounds to expose or extend to the wood. As an embodiment, the width of the peeled bark in the present invention can be 1 / 4 to 1 / 3 of the circumference of the ring, and the length of the peeled bark can be 1 to 2 cm. As an embodiment, the number of deep wounds in the present invention can be 5 to 10, and the depth is to expose the wood. As an embodiment, the present invention can make wounds in the middle of the stem of citrus plants. As an embodiment, the citrus plant seedlings of the present invention can be subjected to bark peeling at multiple sites, but the sites cannot be selected on the same side of the peeling points, mainly because it is easy to cause plant seedling death due to damaged nutrient transport. As an embodiment, the present invention can be subjected to bark peeling at 2 to 6 sites on a stem segment of a citrus plant seedling, obtaining 2 to 6 wounds, and the distance between two adjacent wounds can be more than 5 cm.

[0043] Figure 1 , containing the green fluorescent protein GFP gene with endoplasmic reticulum-specific enhanced expression, it is possible to judge whether the root system has been successfully transformed by fluorescence, which makes detection more convenient and suitable for large-scale agricultural production. As an embodiment, the hygroscopic material of the present invention may be paper and / or gauze; in a specific embodiment, the hygroscopic material is absorbent paper. As an embodiment, the covering time of the present invention is not less than 20 minutes. The present invention can effectively transfect the root-generating Agrobacterium K599 into the stem segments of citrus seedlings by covering the wound with the infection liquid using a hygroscopic material, thereby improving the genetic transformation efficiency. The present invention does not specifically limit the type of the gene, and any gene can be transformed using the genetic transformation method of the present invention.

[0044] After covering for no less than 20 minutes, the present invention fixes a high-pressure propagation box containing a plant culture matrix at the wound position to obtain a citrus plant seedling fixed with a high-pressure propagation box. As an embodiment, the plant culture matrix of the present invention can be vermiculite and / or nutrient soil; the plant culture matrix can be a sterilized plant culture matrix. The present invention does not specifically limit the source of the plant culture matrix, and a conventional plant culture matrix in the art can be used. As an embodiment, the high-pressure propagation box of the present invention can be a transparent high-pressure propagation box or an opaque black high-pressure propagation box, more preferably a transparent high-pressure propagation box. As an embodiment, at least one high-pressure propagation box is fixed on each citrus plant seedling of the present invention to improve the transformation efficiency. As an embodiment, each high-pressure propagation box fixes a wound. As an embodiment, after fixing a high-pressure propagation box containing a plant nutrient matrix at the wound position, the present invention can add 1 to 2 mL of infection liquid into the high-pressure propagation box. The present invention can further improve the genetic transformation efficiency by supplementing a suitable infection liquid.

[0045] After obtaining the citrus plant seedling fixed with the high-pressure propagation box, the present invention cultivates the citrus plant seedling fixed with the high-pressure propagation box until roots grow out of the wound to obtain the rooted citrus plant stem segment. As a specific embodiment, the temperature of the cultivation in the present invention can be 25-30°C; as another embodiment, the temperature of the cultivation can be 26-28°C. As an embodiment, the humidity of the cultivation in the present invention can be 80%. As an embodiment, the light-dark cycle of the cultivation in the present invention can be 16h light and 8h dark. As an embodiment, the cultivation condition in the present invention can be to moisturize the high-pressure propagation box. As an embodiment, the root length of the rooted citrus plant stem segment in the present invention can be ≥8cm, and the root can be ≥5. As an embodiment, after the wound in the present invention grows roots, it can be cut at the lower part of the hairy root to obtain the rooted citrus plant stem segment, and the remaining part of the citrus plant material can continue to be cultivated to grow into a new plant material for the next transgenic root-generating Agrobacterium infection.

[0046] After obtaining the rooted citrus plant stem segment, the present invention preferably transplants the rooted citrus plant stem segment to obtain a genetically transformed citrus plant. The present invention does not specifically limit the transplanting method, and a conventional transplanting method in the art can be used. The present invention can perform a grafting operation before or after high-pressure propagation to meet different experimental requirements. The obtained genetically transformed root system plant can be grafted with a cultivated variety to meet the needs of seedling cultivation.

[0047] The genetic transformation method provided by the present invention has the following advantages:

[0048] 1. The transformation method is simpler, and there is no need to consider the contamination problem of the Agrobacterium-mediated genetic transformation process, which is conducive to scientific research on gene function in citrus;

[0049] 2. The breeding cycle is faster. The seedlings with genetically transformed roots can be sold after colonization, which effectively shortens the breeding cycle by more than 2 years. The production and sales of rootstock seedlings shorten the time and input costs (breeding period, breeding land, management, water, fertilizer and pesticide input), and can be used for the promotion of citrus rootstock-related gene function research and application;

[0050] 3. Detection is more convenient. Through the transparent high-pressure propagation box, the root development and transformation can be grasped by fluorescence detection method, which is suitable for large-scale agricultural production;

[0051] 4. High-pressure propagation and grafting can be carried out at the same time, meeting the needs of variety expansion (genetic transformation into rootstock, which can be grafted with different varieties) and shortening the breeding cycle; genetically transformed root systems obtained by genetic transformation of rootstocks can provide quality nutrition, disease and pest resistance for grafted varieties, and the harvested fruits do not belong to the category of genetically modified fruits; it is beneficial to the promotion and production of citrus seedlings;

[0052] 5. For the study of virus and bacterial diseases, the virus can be transferred by grafting and genetic transformation of roots can be carried out simultaneously to meet the needs of large-scale disease resistance gene screening;

[0053] 6. Seedlings that have not been successfully genetically transformed can be used repeatedly, and multiple high-pressure propagation points (2 to 6) can be carried out on the same seedling to effectively increase the efficiency of genetic transformation;

[0054] 7. Contains all the advantages of rooting induced by Agrobacterium rhizogenes cuttings.

[0055] Based on the above advantages, the present invention also provides the application of the genetic transformation method described in the above technical solution in gene function verification.

[0056] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0057] The sources of the biomaterials used in the following examples and comparative examples are:

[0058] p1380-HA vector (containing the green fluorescent protein GFP gene for endoplasmic reticulum-specific enhanced expression, see the vector map Figure 1 ), the strain used was K599 rhizogenes competent Agrobacterium (Weidi Biotechnology), kanamycin Kana (Beijing Coolaibo), streptomycin Str (Beijing Coolaibo), AS (acetosyringone, purchased from Beijing Coolaibo, prepared into 200mM stock solution with DMSO), MES (1M), MgCl2 (1M), YEP medium (Beijing Coolaibo), fluorescence detection equipment (LUYOR-3415RG dual-wavelength fluorescent protein excitation light source). YEP liquid medium formula: yeast extract powder 10g / L, peptone 10g / L and sodium chloride 5g / L. YEP solid medium formula: add 15g / L agar on the basis of YEP liquid medium.

[0059] MES solution formula: 0.39 g MES and 0.406 g MgCl2 are dissolved in 200 mL of sterile double distilled water, pH 5.6, and AS is added before use.

[0060] The concentration of AS1000x stock solution is 200 mM, and the preparation method is as follows: 392 mg of AS powder is directly dissolved in 10 mL of DMSO, and the filter membrane is sterilized and then divided into portions for cryopreservation.

[0061] Example 1

[0062] A genetic transformation method for citron, comprising the following steps:

[0063] 1. Construction of recombinant plasmid:

[0064] Take SahA (NCBI: CP159585.1) as an example:

[0065] Background description of target gene SahA: Many pathogenic bacteria targeting citrus, including Pseudomonas putida, Pseudomonas cepacia, Ralstonia solanacearum, Pseudomonas stutzeri, etc., have the ability to secrete salicylate hydroxylase, which plays a key role in plant pathogens. These pathogens can secrete salicylate hydroxylase into plants, thereby inhibiting the production and accumulation of endogenous salicylic acid in plants, thereby weakening the plant's defense mechanism. In the genome sequence analysis of Bacillus phloem to which Huanglongbing fungus belongs, it was found that this type of pathogen contains genes encoding salicylate hydroxylase. This type of salicylate hydroxylase SahA was also found in the reported Huanglongbing fungus genome sequence.

[0066] Compared with the healthy control group, citrus plants infected with Huanglongbing showed increased susceptibility to citrus canker and non-pathogenic bacteria, suppressed expression of disease resistance-related genes, and reduced salicylic acid content. These phenomena suggest that salicylate hydroxylase may play a key role in the pathogenic mechanism of pathogens, indirectly affecting the immune response and physiological state of plants by reducing the level of salicylic acid in plants. However, there is currently a lack of direct evidence as to whether Huanglongbing bacteria directly inhibit the endogenous salicylic acid content of citrus through SahA, thereby affecting root growth. Further scientific research is needed in this area to reveal the complex interaction mechanism between pathogens and host plants, and to provide new theoretical basis and strategies for the prevention and control of citrus diseases.

[0067] In order to further explore the pathogenic mechanism of citrus Huanglongbing, especially the role of the SahA gene encoded by the pathogen, the role of the SahA gene was studied through genetic transformation. The following genetic transformation method is explained using the SahA gene as an example.

[0068] DNA was extracted from leaves of citrus plants infected with Huanglongbing and used as a template for subsequent PCR amplification. The SahA gene was amplified using the specific primers in Table 1.

[0069] Table 1 SahA amplification primer sequences

[0070] Primer name Primer sequence (5'→3') serial number SahA-F AGAACACGGGGGACATGATAATCGGAGCAG SEQ ID NO.1 SahA-R caggaacgtcgtatgggtaTTCGGGTATTTTATATTGATAG SEQ ID NO.2

[0071] The pCAMBIA-1380-HA vector (vector map as shown in Figure 1) was cleaved with two restriction endonucleases, Xba I and Sal I. Figure 1 The vector after enzyme digestion was connected with the SahA gene by homologous recombination, and the connection reaction system was shown in Table 3. The recombinant plasmid maps after connection were shown in Table 3. Figure 2 shown.

[0072] Table 2 Enzyme digestion system (Takara)

[0073] Reagents Usage amount (μL) Cutsmartbuffer (with enzyme) 3 XbaI(Code No.1093S) 1 SalI(Code No.1080S) 1 pCAMBIA-1380-HA 25

[0074] Table 3 Homologous recombination reaction system (Trans)

[0075]

[0076] Finally, the recombinant plasmid was transferred into DH5@E. coli competent cells and spread on LB medium with kanamycin (Kana, 50 mg / mL) resistance, cultured at 37°C for 16 h, and a single clone of E. coli strain was picked to amplify the plasmid for sequencing.

[0077] The plasmids pCAMBIA-1380-SahA-HA and pCAMBIA-1380-HA were respectively transferred into K599 rhizogenes competent cells by electroporation. Monoclonal strains were picked from YEP medium resistant to streptomycin (Str, 100 mg / mL) and kanamycin (Kana, 50 mg / mL) and placed in 700 μL YEP+kana+Str liquid medium. The culture was shaken at 28°C and verified by PCR. The obtained bacterial solution (infection solution) was injected into tobacco for transformation verification. The results are shown in Figure 2. Figure 3 shown.

[0078] Since pCAMBIA-1380-HA carries a GFP fluorescent tag, green fluorescence can be observed using a handheld fluorescent lamp 2 days after injection into tobacco. Figure 3 This indicated that pCAMBIA-1380-SahA and pCAMBIA-1380-HA had been successfully transformed into K599 Agrobacterium rhizogenes.

[0079] 2. Preparation of infection solution:

[0080] The strain successfully sequenced in step 1 was propagated in 100 mL YEP+kan+Str liquid medium until OD 600 The strain was enriched by centrifugation, the supernatant was removed, and the Agrobacterium was resuspended in the prepared MES + acetosyringone (Acetosyringone, AS, 200mM) to make the OD 600 Reach 0.8-1.0. Place in dark place for 4 hours to obtain transgenic K599 Agrobacterium rhizogenes infection solution.

[0081] 3. In situ infiltration of stock stem:

[0082] Wound treatment was performed on the middle section of the stem of the purchased 3-year-old citron seedlings by peeling off part of the bark (not girdling, one-third of the size, 1-2 cm in height) or making 5-10 deep cuts to expose or extend to the white wood. The infiltration solution was fully soaked with absorbent paper, and each piece of absorbent paper absorbed 4-6 mL of the infiltration solution. The absorbent paper was covered on the wound and tied tightly so that the infiltration solution could fully contact the wound part and remain soaked for at least 20 minutes.

[0083] 4. High-pressure breeding:

[0084] Remove the absorbent paper, fix the high-pressure propagation box at the wound position, place the treated wound in the middle, and fill the box with sterilized nutrient soil (PINDSTRUP, 0-6 mm). Use a syringe to inject 2 mL of the impregnation solution into the high-pressure propagation box along the wound side, fasten the high-pressure propagation box and cover the top with a waterproof film to prevent water from entering during water and fertilizer management and affecting the transformation effect.

[0085] 5. Genetic transformation root induction

[0086] Place the treated seedlings in a constant temperature greenhouse: 26℃, 80% humidity, 16 hours light / 8 hours dark cycle. Prevent water from entering the ball to dilute the bacterial concentration within one week after high pressure propagation. After one week, remove the waterproof film and water the ball regularly. Pay attention to regularly check the environment in the high pressure propagation box to avoid excessive drought and transformation failure.

[0087] After 15 days of high-pressure propagation and transformation, there are obvious root callus or young roots. Because the vector pCAMBIA-1380-HA vector carries the green fluorescent protein GFP fluorescent tag, the green fluorescence can be observed at the newly grown hairy roots with a handheld excitation light to determine the transformation effect. Figure 4 As shown. At this time, kanamycin (Kana, 100 mg / mL) can be used to infiltrate the wound site at the early stage of callus formation to improve the transformation efficiency. At the same time, according to the purpose of rootstock root transformation, the non-transformed roots can be removed.

[0088] 6. Propagation and application of genetically transformed root systems

[0089] When the length of the genetically transformed root system in the high-pressure propagation box is more than 8 cm and the number of root branches reaches more than 5, the hairy roots can be cut off at the bottom and the genetically transformed root system and the upper stems and leaves can be transplanted as a whole (such as Figure 5 The remaining citron can be further cultured to grow into new plant materials for the next infection with transgenic Agrobacterium rhizogenes, thus realizing material recycling and reducing the transformation cycle and cost.

[0090] 7. Identification of genetically transformed root systems:

[0091] When the root system develops to 10 cm and lateral roots are formed, the genetically transformed roots can be collected for nucleic acid extraction, and the correctness of the genetic transformation can be verified by PCR amplification and sequencing.

[0092] The steps of the PCR sequencing method for the target gene SahA to detect transgenic roots are as follows: A) After DNA is extracted from the transgenic roots, the target gene SahA (1293 bp) size band is amplified using the vector primer F / R-1380HA-EV, and the empty vector is 181 bp, such as Figure 6 As shown in A. To complete the gene sequencing, the obtained PCR product was constructed on pEASY-Blunt (Trans, CB01), and then transferred into DH5@ and the extracted plasmid was used as a template to obtain the pEASY-Blunt vector universal primer M13F / R. The obtained gel image is shown in Figure 6 As shown in B, the position of the band is consistent with the size of SahA, and the plasmid was extracted and sent for sequencing.

[0093] The primer sequences of the vector primer F / R-1380HA-EV are: F-1380HA-EV: 5'-CAATCCCACTATCCTTCGCA-3' (SEQ ID NO.3); R-1380HA-EV: 5'-catcatacggatatagggat-3' (SEQ ID NO.4). The primer sequences of the pEASY-Blunt vector universal primer M13F / R are: M13F: 5'-GTAAAACGACGGCCAGT-3' (SEQ ID NO.5); M13R: 5'-CAGGAAACAGCTATGAC-3' (SEQ ID NO.6).

[0094] In addition, handheld observation equipment (such as LUYOR-3410 high-intensity ultraviolet lamp) was used to inspect, observe and sample the green fluorescent roots (transgenic roots), and non-green fluorescent roots (non-transgenic roots) of the same high-pressure propagation bulb were taken, and experimental verification was carried out by means of qPCR and Western Blot.

[0095] 8. Grafting operation can be performed before or after high-pressure propagation to meet different experimental needs.

[0096] Comparative Example 1

[0097] Genetic transformation was performed using the method in Example 1, with the only difference being that the Agrobacterium rhizogenes in step 1 was replaced with ATCC15834.

[0098] Comparative Example 2

[0099] Genetic transformation was performed using the method in Example 1, with the only difference being that the Agrobacterium rhizogenes in step 1 was replaced with C58C1.

[0100] Comparative Example 3

[0101] Genetic transformation was performed using the method in Example 1, with the only difference being that the Agrobacterium rhizogenes in step 1 was replaced by Ar.Qual.

[0102] The transformation rate results of the transformation induced by different Agrobacterium rhizogenes strains in Example 1 and Comparative Examples 1 to 3 were statistically analyzed, wherein the statistical time of the transformation rate was 1 to 2 months after high pressure propagation. The results are shown in Table 4.

[0103] Table 4 Comparison of transformation rates of different Agrobacterium rhizogenes strains

[0104] Trial Groups Strain name genotype Conversion Rate % Comparative Example 1 ATCC15834 AgrobacteriumrhizogenespRi15834(agropinetype) 56.67％ Comparative Example 2 C58C1 AgrobacteriumrhizogenespRiA4b(agropinetype) 44％ Example 1 K599 AgrobacteriumrhizogenespRi2659(agropinetype) 82.5％ Comparative Example 3 Ar.Qual AgrobacteriumrhizogenesArQualRi(agropinetype) 57.5％

[0105] From the results in Table 4, it can be seen that the transformation rate of K599 strain is the highest.

[0106] Example 2

[0107] Taking citron (Citrusmedica L.) as the research object, this example conducted a large-scale gene co-transformation experiment, aiming to explore the effects of different genes on plant physiological responses. In the experiment, in addition to the empty vector control, a total of 24 different genes were transformed in this example. Except for the different transformed genes, the other method steps were the same as Example 1. After 15 to 20 days of transformation treatment, healthy callus tissue was formed at the transformation site, and new roots sprouted from the callus tissue. This phenomenon marked the initial success of the transformation process. As the experiment progressed, the roots grew well and neatly in 45 days. The results of the statistical transformation rate are shown in Table 5, where SDE represents Sec-dependent secretion system effector (Sec-dependent effector) and Las represents Huanglongbing fungus. The root transformation degree diagram taken 45 days after transformation is shown in Table 5. Figure 7 shown.

[0108] Table 5 Statistics of genetic transformation efficiency of different genes

[0109] SDEnumber Protein ID (NCBI) Total number of balls Number of roots Successful conversions Las15 WP_015824940.1 6 6 6 Las17 WP_015824938.1 6 6 6 Las18 WP_012778429.1 8 7 7 Las19 WP_015452986.1 7 7 7 Las20 WP_015453017.1 6 5 5 Las21 WP_244392125.1 7 7 7 Las23 WP_012778434.1 7 7 7 Las24 WP_040055304.1 8 8 8 Las25 WP_015824948.1 6 6 6 Las26 WP_015452879.1 6 5 3 Las27 WP_012778603.1 6 4 4 Las28 WP_012778634.1 6 4 4 Las29 WP_012778645.1 6 5 5 Las30 WP_015452616.1 8 8 8 Las31 WP_015452630.1 8 8 8 Las32 WP_015452419.1 7 7 7 Las33 WP_012778374.1 7 5 5 Las34 WP_015452743.1 7 7 7 Las36 WP_015452812.1 7 6 6 Las37 WP_015452988.1 7 6 6 Las38 WP_015452848.1 6 4 4 SDE1 WP_015452985.1 5 5 5 SDE15 WP_015452737.1 7 7 7 SDE70 WP_015452552.1 7 7 7 p1380-HA —— 6 6 6 Summary 167 153 151

[0110] The data in Table 5 provide important references for subsequent gene function analysis. Taking the co-transformation experiment of Las 15 gene as an example, it was found that 6 high-pressure propagation boxes were transformed, all 6 boxes successfully rooted, and under high-intensity ultraviolet light, it was confirmed that there were transgenic roots in each box, showing 100% rooting and transgenic root formation rate.

[0111] Further, the overall transformation efficiency of the high-pressure propagation boxes was statistically analyzed in this example. Among a total of 167 high-pressure propagation boxes, 153 were successfully transformed and rooted, and the calculated rooting rate was 91.62%, indicating the high efficiency of the transformation method and transformation system of the present invention. Among these 153 high-pressure propagation boxes that were successfully transformed, 151 successfully obtained transgenic root systems, and the transformation rate was as high as 94.69%, which further demonstrated the effectiveness of the gene co-transformation method.

[0112] However, among the 151 successfully transformed transgenic roots, approximately 20 roots contained chimeras, i.e., heterogeneous green roots observed under visible ultraviolet light. Taking this into account, the final transformation rate was adjusted to 85.62%, which more accurately reflects the actual distribution of the transgene in the root system. Figure 7 The images in the figure also intuitively reflect the transformation effect and expression level of different genes in the plant root system, providing visual evidence of transformation efficiency. This series of experiments not only demonstrates the potential of high-pressure propagation transformation technology in citrus genetic transformation, but also provides rich materials for subsequent gene function research.

[0113] Example 3

[0114] The genetic transformation was carried out using the method in Example 1, with the only difference being that the citron stem segments in Example 1 were replaced with 2-3 year old citrange stem segments.

[0115] Comparative Example 4

[0116] A method for genetic transformation of stem segments mediated by Agrobacterium infection, comprising the following steps:

[0117] 1. The Agrobacterium rhizogenes sequenced successfully in step 1 of Example 3 was inoculated into YEP liquid medium (kan and Str were added to YEP liquid medium, the concentration of kan in the medium was 50 mg / L, and the concentration of Str in the medium was 100 mg / L), and cultured at 200 r / min in the dark at 28°C until the logarithmic phase (OD 600 =1.0); dilute the bacterial solution 10 times and culture it again under the same conditions as above to a concentration of OD 600 =0.5, transfer the bacterial solution to a 50 mL centrifuge tube and centrifuge at 5000 rpm for 10 minutes at room temperature, discard the supernatant and resuspend the bacterial solution with an equal volume of MS medium;

[0118] 2. Cut 2 cm stem segments from the epicotyls of the transformed seedlings under sterile conditions and soak them in the MS suspension described in step 1 for 20 minutes;

[0119] 3. After taking out, use sterile filter paper to absorb the residual bacterial liquid, and place it in MS co-culture medium for dark treatment for 2 days at a temperature of 26-28°C;

[0120] 4. Transfer the infected stem segments to the induction medium in the dark for 5 days, then light cycle 16h / d, temperature 26-28℃;

[0121] 5. The generated transformed buds are transferred to the rooting medium for further cultivation to obtain genetically transformed root systems;

[0122] The formula of the culture medium is as follows:

[0123] MS liquid culture medium: MS + 30 g / L sucrose, pH = 5.8.

[0124] MS co-culture medium: MS+30g / L sucrose+2mg / L BA+0.5mg / L IAA+1mg / L 2,4-D solution+100μM AS, placed in a large-diameter culture dish for co-culture.

[0125] Induction medium: MS + 30 g / L sucrose + 2 mg / L BA + 0.5 mg / LI AA + 1 mL timentin (250 mg / L) + 1 mL kanamycin (100 mg / L), use a small-diameter culture dish.

[0126] Rooting medium: PM11731 / 2MT rooting medium base salt (1 / 2 macroelements, containing vitamins and hormones) (Beijing Coolaibo, PM1173-50L).

[0127] Comparative Example 5

[0128] The transgenic root system was obtained by the method described in Example 1 of Chinese patent CN114657207A, the only difference being that the citron was replaced by a 2-3 year old citrange.

[0129] The period and conversion rate of 3-year-old seedlings obtained by the methods of Example 3, Comparative Example 4 and Comparative Example 5 were measured, wherein the conversion rate of Comparative Example 4 was calculated based on the proportion of positive seedlings obtained in the number of epicotyls, and the conversion rate of Comparative Example 5 was calculated based on the proportion of transgenic roots obtained in the number of cuttings; and the conversion rate of Example 1 was calculated based on the proportion of transgenic roots obtained in the number of high-pressure propagated plants. The results are shown in Table 6.

[0130] Table 6 Comparison of the rootstock genetic transformation methods in Example 3 and Comparative Examples 4-5 (taking Citrus aurantium as an example)

[0131]

[0132] It can be concluded from Table 6 that compared with other Agrobacterium rhizogenes citrus genetic transformation methods, the high-pressure propagation-mediated genetic transformation in Example 3 has the advantages of short seedling cycle, high transformation rate, and easy rooting.

[0133] Example 4

[0134] The genetic transformation was carried out using the method in Example 1, with the only difference being that the three-year-old citron seedlings in step 3 were replaced with three-year-old lemon seedlings.

[0135] Example 5

[0136] Genetic transformation was performed using the method in Example 1, with the only difference being that the three-year-old citron seedlings in step 3 were replaced with three-year-old orange seedlings ( Figure 8 ).

[0137] Example 6

[0138] Genetic transformation was performed using the method in Example 1, with the only difference being that the three-year-old citron seedlings in step 3 were replaced with three-year-old trifoliate orange seedlings ( Fig. 9 ).

[0139] The rooting rate and transformation rate of the genetically transformed seedlings in Example 1 and Examples 4 to 6 were measured. The results are shown in Table 7.

[0140] Table 7 Rooting rate and transformation rate of genetically transformed seedlings in Example 1, Example 4 and Example 5

[0141] Rootstock variety Rooting rate% Conversion Rate % CitrusmedicaL. 95％ 82.22％ Lemon Citruslimon (L.) Burm.f. 93％ 80.35％ Citrus sinensis Osb.×Poncirustrifoliata(L.)Raf. 72％ 54.33％ Poncirus trifoliata (L.) Raf 69％ 50.26％

[0142] It can be concluded from Table 7 that the genetic transformation method of the present invention can be used for most citrus rootstock varieties and has high adaptability to the genetic transformation of citrus.

[0143] Example 7

[0144] Genetically transformed roots can be used for gene function studies, such as verification of promoter-specific expression sites. GUS genes driven by different promoters can be stably expressed in roots and then verified by GUS staining. The specifications of the reagents or kits used are as follows: Gus staining kit: Coolaber, Cat: SL7160-50 mL; polylysine adhesion slides: Solarbio, Lot: No.20210818; Neutral Balsam Mounting Medium: Sangon Biotech, Cat: E675007-0100; 10×PBS (working solution pH 7.2-7.4): Coolaber, Cat: SL6110-500mL.

[0145] The research plan is as follows:

[0146] 1. Fixation and staining: Wash the transgenic roots of p1380-CsSUC2-GUS and p1380-35s-GUS that were propagated under high pressure, cut into small sections of about 5 mm, and fix them in 90% acetone in an ice bath for 30 minutes. Dilute 10×PBS to 1×, rinse three times with 1×PBS, and immediately pour it out after the first simple rinse. The next two rinses last for 5 minutes each. Pour out the 1×PBS, add Gus staining solution (Gus staining kit), put it in an ice box, and evacuate it in an ice bath in a vacuum dryer (-0.08Mpa) for 30 minutes, slowly release the air, replace with new staining solution, and color at 37°C overnight;

[0147] p1380-CsSUC2-GUS was obtained by inserting the Gus gene into pCambia-1380-HA; p1380-35s-GUS was obtained by replacing the 35s strong promoter of pCambia-1380-HA with the CsSUC2 phloem-specific expression promoter (the gene sequence number of sweet orange V2.0 in the CitrusPan-genome2breeding Database (hzau.edu.cn) is Cs3g_pb018230.1); the structures of p1380-Cs SUC2-GUS and p1380-35s-GUS are shown in the figure below: Fig.10

[0148] 2. Dehydration, transparency, and wax immersion of materials: Soak the fixed materials in 70% ethanol, 85% ethanol, 95% ethanol, 100% ethanol, and 100% ethanol for 1 hour at each level for gradient dehydration; change the materials to 75% ethanol + 25% xylene, 50% ethanol + 50% xylene, 25% ethanol + 75% xylene, 100% xylene, and 100% xylene for 30 minutes at each level for transparency; change the materials to 50% xylene + 50% paraffin, soak at 60°C overnight, change to pure paraffin the next day, and place at 60°C for 2 to 3 days, changing the paraffin every 12 hours (once in the morning and once in the evening);

[0149] 3. Embedding and sectioning: For embedding materials, the embedding machine needs to be turned on and preheated 3 hours in advance before use. Be careful not to damage the materials during the embedding process. Use a microtome to slice the slices with a thickness of 10μm. Stick the sliced ​​slices on a poly-lysine adhesive slide, add water to unfold them, then use filter paper to absorb the excess water, and place them on a 42℃ stand for drying. After all the embedding materials are cut, transfer the slices to a 42℃ oven for drying for 3 days.

[0150] 4. Dewaxing, sealing, and photographing: Place the slide with the material in the following order: 100% xylene (15 min) → 100% xylene (15 min) → 50% xylene + 50% ethanol (5 s) → 100% ethanol (5 s) → 100% ethanol (5 s) → 95% ethanol (5 s) → 85% ethanol

[0151] (5s)→70% ethanol (5s)→50% ethanol (5s)→30% ethanol (5s)→10% ethanol (5s)→ddH2O (5s)→safranin dye (2min)→ddH2O (5s), then soak in 10%, 30%, 50%, 70%, 85%, 95%, 100%, 100% ethanol gradient (5s for each level), 50% xylene + 50% ethanol (5s), 100% xylene (5s) (can be temporarily stored in xylene), and seal with neutral gum sealing medium. After the neutral gum solidifies, observe and take pictures under a microscope. Fig.10 Figures a and b show the expression patterns of the GUS gene in transgenic roots driven by the CsSUC2 and CaMV35s promoters, where a indicates that the CsSUC2 promoter specifically induces the expression of the GUS gene in the phloem; b indicates that the strong CaMV35s promoter causes the GUS gene to be widely expressed in various tissues of the root system. The above results verify the specificity of the promoter at a specific expression site.

[0152] according to Fig.10 The results in the above show that genetically transformed root systems can be used for gene function studies, such as verification of promoter-specific expression sites. They are also applicable to various tags, such as GUS and GFP tags.

[0153] Example 8

[0154] The transformed root samples obtained in Example 5 were sliced ​​and observed under a laser confocal microscope for fluorescence. Fig.11 .

[0155] Depend on Figure 8 It can be seen that green fluorescent protein is highly expressed in the transformed root system, but not in the dead cells on the root surface and the vascular tubes in the pith. Since orange cannot be transformed by Agrobacterium instantaneously, it is relatively complicated to perform subcellular localization of proteins on orange. The method provided by the present invention provides a rapid method for studying gene function or subcellular localization.

[0156] Example 9

[0157] A method similar to the genetic transformation method in Example 6, except that the cutting of 3 sites in each seedling ( Fig.12 ), and one of the high-pressure propagation boxes was inoculated with the Huanglongbing pathogen, according to the method [Hilf ME, Lewis RS. Transmission and Propagation of'Candidatus Liberibacter asiaticus'byGrafting with Individual Citrus Leaves. Phytopathology. 2016 May; 106(5):452-8.doi:10.1094 / PHYTO-09-15-0221-R. Epub 2016 Apr 1.PMID:26807818.] or [Lopes SA, Frare GF. Graft Transmission and Cultivar Reaction of Citrus to'Candidatus Liberibacter americanus'. Plant Dis. 2008 Jan; 92(1):21-24.doi:10.1094 / PDIS-92-1-0021.PMID:30786360.].

[0158] Infecting Huanglongbing branches by grafting is an important method for conducting scientific research on the infection of Huanglongbing bacteria. By grafting branches infected with Huanglongbing bacteria, the presence of pathogens can be detected on the leaves of the grafted rootstock in about March, but the time period of this process is relatively long, and the success of grafting is closely related to the transmission of the virus. Therefore, the traditional operation of genetic transformation methods is: 1) obtaining genetic transformation materials and verifying the genetic transformation materials; 2) grafting and transmitting the virus, and verifying it by real-time quantitative PCR in about 3 months; 3) conducting relevant research verification based on phenotype or bacterial load differences. However, this experimental method can be used to graft and transmit the virus of Huanglongbing bacteria at the beginning of high-pressure propagation. The complete development cycle of the roots is about 3 months, which is consistent with the transmission time. Step 1) can be omitted and the grafting and transmission of the virus and the acquisition of genetic transformation materials can be carried out simultaneously, which can effectively shorten the time of grafting and transmission of the virus.

[0159] It can be concluded from the above examples that the genetic transformation method of the present invention can effectively shorten the transformation system cycle, reduce the genetic transformation cost, improve the genetic transformation efficiency, avoid the generation of chimeras and the materials can be reused.

[0160] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for genetic transformation of citrus plants, characterized in that: The steps include: making wounds on stems of citrus plant seedlings to obtain citrus plant seedlings with wounds; Covering the wound of the citrus plant seedling with a hygroscopic material soaked with an infection solution, wherein the infection solution includes Agrobacterium rhizogenes K599 containing the genetically modified organism; After covering for no less than 20 minutes, a high-pressure propagation box containing a plant culture matrix is ​​fixed at the wound position to obtain a citrus plant seedling with the high-pressure propagation box fixed thereon; The citrus plant seedlings fixed with the high-pressure propagation box are cultured until roots grow out of the wounds to obtain rooted citrus plant stem segments.

2. The genetic transformation method according to claim 1, characterized in that After roots grow out of the wound, the lower part of the hairy roots is cut off to obtain rooted citrus plant stem segments; the rooted citrus plant stem segments are transplanted to obtain genetically transformed citrus plants.

3. The genetic transformation method according to claim 1, characterized in that The method for making wounds comprises peeling bark or making deep wounds; the width of the peeled bark is 1 / 4 to 1 / 3 of the circumference of the ring barking, and the length of the peeled bark is 1 to 2 cm; the number of the deep wounds is 5 to 10, and the depth is enough to expose the wood.

4. The genetic transformation method according to claim 1, characterized in that After fixing a high-pressure propagation box containing a plant nutrient matrix at the wound site, add 1 to 2 mL of infection solution into the high-pressure propagation box.

5. The genetic transformation method according to claim 1, characterized in that The root system length of the rooted citrus plant stem segment is ≥8 cm, and the number of root segments is ≥5.

6. The genetic transformation method according to claim 1, characterized in that The citrus plant seedlings are ≥2 years old.

7. The genetic transformation method according to claim 1, characterized in that At least one high-pressure propagation box is fixed on each citrus seedling.

8. The genetic transformation method according to claim 1, characterized in that The absorbent material comprises paper and / or gauze.

9. The genetic transformation method according to any one of claims 1 to 8, characterized in that The citrus plant includes one or more of citron, orange, trifoliate orange and lemon.

10. Use of the genetic transformation method according to any one of claims 1 to 9 in gene function verification.

Images