Method for constructing heterozygote mouse model with IL-1f9K124A point mutation

Abstract

The invention relates to a method for constructing a heterozygote mouse model with IL-1f9K124A point mutation. The method comprises the following steps: step 1, acquiring Cas9mRNA (messenger ribonucleic acid), gRNA (guide ribonucleic acid) and oligo donor DNA (deoxyribonucleic acid); step 2, carrying out micro-injection on the Cas9mRNA, the gRNA and the oligo donor DNA obtained in the step 1 into a fertilized egg male pronucleus of a C57BL / 6J mouse, transplanting the fertilized egg after injection into the uterus of a pseudopregnant female mouse, and inoculating the born mouse in such a way as an F0-generation mouse; 3, performing genotype identification on the F0-generation mice through PCR amplification and sequencing, mating the identified F0-generation positive mice with C57BL / 6J mice, and breeding to obtain F1-generation mice; 4, performing genotype identification on the F1-generation mice through PCR amplification and sequencing to obtain F1-generation positive mice which are IL-1f9K124A point mutation heterozygote mice which can be stably inherited; and 5, carrying out imiquimod induction on the heterozygote mouse with IL-1f9K124A point mutation obtained in the step 4 to obtain the psoriasis mouse model. Compared with the prior art, the invention has obvious progress.

Description

Technical Field

[0001] The present invention relates to an IL-1f9 K124A Method for constructing a heterozygous mouse model of a point mutation, particularly involving a method for constructing an IL-1f9 K124A A method for constructing a mouse model by combining heterozygous mice with point mutations that simulate the reduction of 2-hydroxyisobutyrylation modification of IL-1f9 at position 124 and imiquimod induction. Background Art

[0002] Psoriasis is a common and recurrent chronic inflammatory skin disease. Its typical clinical manifestations are red papules or plaques covered with thick scales. Its pathological features are: hyperkeratosis, fusional parakeratosis, disappearance of the granular layer, thickening of the acanthosis, regular downward extension of the epidermal protrusions with the base at the same level, edema of the dermal papillae, vasodilation and abnormal proliferation, and infiltration of inflammatory cells. This seriously affects the quality of life of patients. Currently, the number of patients worldwide is as high as 125 million, and the prevalence of psoriasis in China is as high as 0.47%, which is a huge challenge for my country's public health. Although the current treatment measures are effective, they cannot achieve the goal of long-term relief.

[0003] Psoriasis is one of the diseases that are currently being studied in the field of dermatology, and the development of new drugs is particularly important. Animal models of psoriasis are important tools for the pathogenesis of psoriasis and the development of new drugs. Currently, the models used to study psoriasis include spontaneous mouse models, drug-induced models (such as mouse psoriasis models induced by topical application of imiquimod to the skin), genetically engineered mouse models, and allogeneic transplant mouse models.

[0004] Although there are many animal models of psoriasis, they all have shortcomings in fully simulating the characteristics of psoriasis:

[0005] ① Although spontaneous mouse models can show psoriasis skin manifestations in a relatively short period of time, such as acanthosis and increased vascular dilation in the dermis, they rarely show T cell and neutrophil infiltration, cannot reflect all the characteristics of psoriasis, and lack response to psoriasis treatment drugs. Therefore, this type of model is only suitable for the study of anti-proliferative drugs, and is not suitable for the pathogenesis of psoriasis and the study of new drugs;

[0006] ② The genetically engineered mouse model was constructed based on the psoriasis susceptibility gene, which is of great help in studying the pathogenesis of psoriasis. However, the manifestation of psoriasis lesions is greatly affected by later factors such as transcription and translation, and there are differences in the consistency of the lesion model, which limits the research on the progression and treatment of psoriasis.

[0007] ③ The allogeneic transplant animal model is a model in which the skin of psoriasis patients is transplanted onto immunodeficient mice. This type of animal model can more completely simulate the complex immunological and histopathological changes of psoriasis and is a suitable tool for studying the T cell pathogenesis of psoriasis and drug development. However, this type of mouse is more susceptible to infection due to severe immune defects, so the cost of raising it is relatively high. Therefore, the promotion and application of this type of model also has certain limitations. Summary of the invention

[0008] In order to solve the above-mentioned defects and deficiencies of the prior art, the inventor of this patent proposed the following solution after a lot of hard and creative work.

[0009] Posttranslational modification (PTM) of proteins is a mechanism for covalently modifying proteins produced by gene expression. These PTMs can change the structure and function of proteins, affect many pathways required to maintain physiological homeostasis, and thus participate in the pathogenesis of diseases. Lysine 2-hydroxyisobutyrylation (Khib), as an evolutionarily conserved protein posttranslational modification, exists in a variety of organisms and participates in some important metabolic processes. Studies have found that this highly conserved modification is widely present and significantly different between psoriasis lesions and non-lesions.

[0010] The inventors of this patent have devoted themselves to research and found that the 2-hydroxyisobutyrylation modification (Khib) of lysine at position 100 of IL-36G is significantly reduced in psoriasis skin lesions. IL-36G is an important cytokine involved in the pathogenesis of psoriasis. It was also found that the reduction in the modification level can promote the interaction between keratinocytes and T cells and neutrophils, promote the proliferation of keratinocytes and T cells, enhance the chemotaxis of T cells and neutrophils, and simulate the characteristics of psoriasis in many aspects such as cell proliferation and inflammatory infiltration.

[0011] Based on the research results, in order to solve the problems existing in the prior art, the inventors of this patent constructed a mouse psoriasis model by reducing the 2-hydroxyisobutyrylation modification of lysine at position 100 of IL-36G. The lysine at position 100 of human IL36G corresponds to the lysine at position 124 of mouse interleukin 1 family member 9 (IL-1F9). The lysine (K) at position 124 was mutated to alanine (A) through gene editing technology (CRISPR / Cas9) to simulate the reduction of lysine 2-hydroxyisobutyrylation modification, and the constructed IL-1f9 K124A The heterozygous mice with the point mutation are mice in which the 2-hydroxyisobutyrylation modification of lysine 124 of IL-1f9 is reduced. K124AImiquimod was used to induce psoriasis in point mutation mice, which had a shorter modeling time, more severe skin lesions and inflammatory cell infiltration, and was more consistent with human psoriasis in skin appearance and inflammatory response.

[0012] Further specific steps are as follows:

[0013] A type of IL-1f9 K124A Method for constructing a heterozygous mouse model of a point mutation, including:

[0014] The first step is to obtain Cas9 mRNA, gRNA and oligo donor DNA;

[0015] In the second step, the Cas9 mRNA, gRNA and oligo donor DNA obtained in the first step are microinjected into the male pronucleus of the fertilized egg of C57BL / 6J mice, and the injected fertilized eggs are transplanted into the uterus of pseudo-pregnant female mice. The mice born in this way are F0 generation mice;

[0016] The third step is to identify the genotype of the F0 generation mice by PCR amplification and sequencing, and to mate the identified F0 generation positive mice with C57BL / 6J mice to obtain F1 generation mice;

[0017] The fourth step is to identify the genotype of F1 mice by PCR amplification and sequencing. F1 positive mice are IL-1f9 that can be stably inherited. K124A Mice heterozygous for the point mutation.

[0018] Step 5: IL-1f9 obtained in step 4 K124A Mice heterozygous for the point mutation were treated with imiquimod to obtain a mouse model of psoriasis.

[0019] The steps of obtaining Cas9 mRNA include: target plasmid synthesis, enzyme digestion, purification, transcription, and RNA purification and recovery.

[0020] The gRNA is a wild-type base sequence including the IL-1f9 K124 site.

[0021] About 100 bases upstream and downstream of the IL-1f9 K124 mutation site and the sequence including the mutation base were selected as oligo donor DNA.

[0022] The oligo donor DNA sequence information is:

[0023] ATCCAGATAAATGCCTGTTTTGTAAGGAAGTTAATGGACACCCTACTTTGCTGCTA GCTGTCAGTGACCCAGAAAAATACCATTAAAAACTATGTTTCTTCTCTTACATTTTTAA.

[0024] The steps of genotyping the F0 generation mice by PCR amplification and sequencing in the third step include:

[0025] A sample is cut from the tail end of the F0 generation mouse, and then DNA is extracted. The DNA of the F0 generation mouse is amplified by PCR using gRNA, Cas9, upstream primer I and downstream primer II, and then the genotype of the PCR amplification product is identified using sequencing primers.

[0026] The upstream primer I is: Forward 5'-ACTGCCACCAGGTGTTCAAA-3'; the downstream primer II is: Reverse 5'-AGGGTAAAGGAGGGAGCTGA-3'.

[0027] The fifth step is to treat the IL-1f9 obtained in the fourth step K124A The psoriasis mouse model is obtained by inducing imiquimod in heterozygous mice with point mutations, further comprising: after depilating the backs of wild-type mice and heterozygous mice with IL-1f9K124A point mutations, imiquimod cream is applied to the depilated areas on the backs of the mice daily, with a dosage of 80 mg per day in a 2 cm×2 cm area, for 5 consecutive days.

[0028] Then wild-type mice and IL-1f9 K124A The heterozygous mice with the point mutation were induced with imiquimod. On the 5th day of imiquimod induction, the two groups of mice were anesthetized to death and the local skin lesions were taken and divided into two parts for identification:

[0029] One part of the specimens was fixed and paraffin sections were made. The paraffin specimens were stained with HE, and the other part of the skin lesion tissue was used for immunofluorescence staining of neutrophil and T cell marker proteins. The above two samples were compared and observed.

[0030] Compared with the prior art solutions, the present invention has at least the following beneficial effects:

[0031] ① This technology constructs a psoriasis mouse model based on the post-translational modification level, avoiding the influence of factors such as transcription and translation on the mouse phenotype, and to a certain extent reducing the influence of non-experimental factors on the results, ensuring the comparability of the results;

[0032] ② This technology is the first to construct a psoriasis mouse model starting from lysine 2-hydroxyisobutyrylation, which plays an important role in exploring the dihydroxyisobutyrylation modification of psoriasis;

[0033] ③ The modeling cycle of this technology is short. Obvious psoriasis skin manifestations can appear on the 5th day of imiquimod induction, while the modeling cycle in previous literature reports lasted about 2 weeks;

[0034] ④ The mouse model constructed in the present invention has more severe skin lesions and inflammatory cell infiltration, which is most consistent with the characteristics of skin lesions in patients with psoriasis and meets the requirements for animal models in the primary stage of psoriasis research. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 : Schematic diagram of the design strategy for constructing heterozygous mice with the K124A point mutation in the IL-1f9 protein;

[0036] in Figure 1 A is the process of artificial nuclease (Cas9) precisely cutting the IL-1f9 wild type allele located in exon 4 (exon4) under the guidance of gRNA; Figure 1 B is the process of homologous recombination (HR) of oligodonor DNA with a target point mutation at the cleavage site of the target gene (Targeted allele) IL-1f9; 1C is the point mutation allele of the target gene IL-1f9 after homologous recombination of the oligodonor DNA, and the base of the target point mutates from AAG to GCT; 1a in the figure is exon 1 (exon1); 2 is exon 2 (exon2); 4 is exon 4 (exon4); 5 is exon 5 (exon5); 6 is oligo donor deoxyribonucleotide (oligo donor DNA), which refers to the sequence of about 100 bases upstream and downstream of the mutated base at the IL-1f9 K124 site; HR, homologous recombination; *, mutation base (mutation).

[0037] Figure 2 :Schematic diagram of PCR identification strategy for F0 generation mouse genotype;

[0038] 2A: Using DNA extracted from the tail of wild-type mice as the sample, PCR was performed to amplify the gene sequence of wild-type mice using primers Ⅰ (forward primer) and Ⅱ (reverse primer) of the designed target gene IL-1f9.K124A DNA extracted from the tail of heterozygous mice with point mutations was used as a sample, and PCR amplification of IL-1f9 was performed using the designed target gene Ⅰ (forward primer, Forward) and Ⅱ (reverse primer, Reverse). K124A The wild-type and mutant sequences synthesized by PCR were sequenced using sequencing primers, and the sequencing results were compared and identified using the NCBI BLAST sequence comparison website.

[0039] Figure 3: Wild-type mice and IL-1f9 K124A Schematic diagram of skin lesion changes during imiquimod induction in heterozygous mice with point mutations;

[0040] in Figure 3-1 The skin manifestations of wild-type mice on the first day of imiquimod (IMQ) treatment; Figure 3-2 IL-1f9 K124A Skin manifestations of mice heterozygous for the point mutation on day 1 of IMQ treatment; Figure 3-3 This is the skin manifestation of wild-type mice on the 5th day of IMQ treatment; Figure 3-4 IL-1f9 K124A Skin manifestations of mice heterozygous for the point mutation on day 5 of imiquimod (IMQ) treatment.

[0041] Figure 4: Wild-type mice and IL-1f9 K124A Schematic diagram of HE staining observation of imiquimod-induced tissue sections of heterozygous mice with point mutations;

[0042] in Figure 4-1 This is a schematic diagram of HE observation of skin lesion tissue sections of wild-type mice on the 5th day after imiquimod (IMQ) treatment; Figure 4-2 IL-1f9 K124A Schematic diagram of HE observation of skin lesion tissue sections of heterozygous mice with point mutation on the 5th day after treatment with imiquimod (IMQ).

[0043] Figure 5: Wild-type mice and IL-1f9 K124A Schematic diagram of immunofluorescence staining of T cells in tissue sections induced by imiquimod in heterozygous mice with point mutations;

[0044] in, Figure 5-1a , 5-1b , 5-1c, 5-1d are schematic diagrams of immunofluorescence staining observation of T cells in skin lesions of wild-type mice on the 5th day after imiquimod (IMQ) treatment; Figure 5-1a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 5-1b The red fluorescence in the middle is marked by the T cell marker protein CD3. Figure 5-1c The green fluorescence in the middle is marked by the T cell marker protein IFN-γ. Figure 5-1d The fluorescence images taken by different fluorescence channels in the same field of view are merged;

[0045] Figure 5-2a , 5-2b , 5-2c, 5-2d are IL-1f9 K124A Schematic diagram of immunofluorescence staining observation of T cells in skin lesions of heterozygous mice with point mutations on the 5th day of imiquimod (IMQ) treatment; Figure 5-2a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 5-2b The red fluorescence in the middle is marked by the T cell marker protein CD3. Figure 5-2c The green fluorescence in the middle is marked by the T cell marker protein IFN-γ. Figure 5-2d To merge fluorescence images taken from different fluorescence channels in the same field of view.

[0046] Figure 6: Wild-type mice and IL-1f9 K124A Schematic diagram of immunofluorescence staining of neutrophils in tissue sections induced by imiquimod in heterozygous mice with point mutations;

[0047] in, Figure 6-1a , 6-1b , 6-1c, 6-1d are schematic diagrams of neutrophil immunofluorescence staining observation of skin lesions of wild-type mice on the 5th day after IMQ treatment; Figure 6-1a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 6-1b Red fluorescence is used to mark the neutrophil marker protein MPO. Figure 6-1c The green fluorescence in the middle is the marker protein TLR2 for neutrophils; Figure 6-1d To merge fluorescence images taken from different fluorescence channels in the same field of view.

[0048] Figure 6-2a , 6-2b , 6-2c, 6-2d are IL-1f9 K124A Schematic diagram of immunofluorescence staining observation of neutrophils in skin lesions of heterozygous mice with point mutations on the 5th day of IMQ treatment; Figure 6-2a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 6-2b Red fluorescence is used to mark the neutrophil marker protein MPO. Figure 6-2c The green fluorescence in the middle is the marker protein TLR2 for neutrophils; Figure 6-2d To merge fluorescence images taken from different fluorescence channels in the same field of view.

[0049] Figure 7 : The overall flow chart of the mouse model construction for psoriasis research of the present invention;

[0050] Figure 7Description: First, the synthesized Cas9 mRNA, gRNA and oligo donor DNA (7c) are microinjected into the male pronucleus of the fertilized egg of C57BL / 6J mice (7b) through a holding needle (7a); then, the successfully injected fertilized egg is transplanted into the uterus of a pseudopregnant mother mouse (7d); the pseudopregnant mother mouse with successful transplantation gives birth to F0 generation mice (7e) in about 20 days; the genotype of the mice is identified by PCR amplification and sequencing to obtain F0 generation positive mice; the identified F0 generation positive mice are mated with C57BL / 6J mice to breed F1 generation mice, and the genotype of the mice is identified by PCR synthesis and sequencing to obtain F1 generation positive mice (7f), which are stable heritable IL-1f9 K124A point mutation heterozygous mice (7f); and the F1 generation negative mice can be used as wild-type mice; finally, the stable heritable IL-1f9 K124A The psoriasis mouse model was obtained by inducing imiquimod (IMQ) in heterozygous mice with point mutation (7f).

[0051] Figure 8 : Comparison of sequencing results before and after mutation. Figure 1: 1a, exon 1; 2, exon 2; 4, exon 4; 5, exon 5; 6, oligo donor DNA, which refers to a sequence of about 100 bases upstream and downstream of the mutant base and the mutant base at the IL-1f9 K124 site; HR, homologous recombination; *, mutation; 7a, holding needle; 7b, male pronucleus; 7c, guide RNA (gRNA), artificial endonuclease messenger RNA (Cas9 mRNA), oligo donor DNA; 7d, pseudopregnant female mice; 7e, F0 generation mice, which refers to mice in which Cas9 Mice born after mRNA, gRNA and donor DNA were microinjected into the male pronucleus of C57BL / 6J mice and then transplanted into pseudo-pregnant female mice); 7f, F1 generation mice (F1 generation mice, refers to the F0 generation mice with positive PCR product sequencing obtained by mating with C57BL / 6J mice). DETAILED DESCRIPTION

[0052] The technical solution of the present invention is further described below with reference to the accompanying drawings and through specific implementation methods.

[0053] In order to better illustrate the present invention and facilitate understanding of the technical solution of the present invention, the specific implementation methods of the present invention are as follows:

[0054] Posttranslational modification (PTM) of proteins is a mechanism for covalently modifying proteins produced by gene expression. These PTMs can change the structure and function of proteins, affect many pathways required to maintain physiological homeostasis, and thus participate in the pathogenesis of diseases. Lysine 2-hydroxyisobutyrylation (Khib), as an evolutionarily conserved protein posttranslational modification, exists in a variety of organisms and participates in some important metabolic processes. Studies have found that this highly conserved modification is widely present and significantly different between psoriasis lesions and non-lesions.

[0055] The inventors of this patent have devoted themselves to research and found that the dihydroxyisobutyrylation modification (Khib) of lysine at position 100 of IL-36G is significantly reduced in psoriasis skin lesions. IL-36G is an important cytokine involved in the pathogenesis of psoriasis. It was also found that the reduction in the modification level can promote the interaction between keratinocytes and T cells and neutrophils, promote the proliferation of keratinocytes and T cells, enhance the chemotaxis of T cells and neutrophils, and simulate the characteristics of psoriasis in many aspects such as cell proliferation and inflammatory infiltration.

[0056] Based on the research results, in order to solve the problems existing in the prior art, the inventors of this patent constructed a mouse psoriasis model by reducing the 2-hydroxyisobutyrylation modification of lysine at position 100 of IL-36G. The lysine at position 100 of human IL36G corresponds to the lysine at position 124 of mouse interleukin 1 family member 9 (IL-1F9). The lysine (K) at position 124 was mutated to alanine (A) through gene editing technology (CRISPR / Cas9) to simulate the reduction of lysine 2-hydroxyisobutyrylation modification, and the constructed IL-1f9 K124A The heterozygous mice with the point mutation are mice in which the dihydroxyisobutyrylation modification of lysine 124 of IL-1f9 is reduced. K124A Imiquimod was used to induce psoriasis in point mutation mice, which had a shorter modeling time, more severe skin lesions and inflammatory cell infiltration, and was more consistent with human psoriasis in skin appearance and inflammatory response.

[0057] The main inventive concept is: first, using CRISPR / Cas9 technology and homologous recombination repair to introduce a target point mutation, mutating the 124th lysine of mouse IL-1f9 (alias: IL36G, Il1f9) protein to alanine, in order to simulate the low modification of 2-hydroxyisobutyrylation of 100th lysine of human IL36G, so as to obtain IL-1f9 K124A Mice heterozygous for the point mutation were then topically applied with imiquimod ointment to further induce a psoriasis mouse model.

[0058] The specific implementation methods of this patent are further described in detail as follows:

[0059] The first step is to obtain Cas9 mRNA, gRNA and oligo donor DNA;

[0060] For Cas9 mRNA:

[0061] The Cas9 mRNA described in the present invention can be obtained through public commercial channels, or can be synthesized by the following method.

[0062] The specific process of Cas9 mRNA synthesis is as follows:

[0063] 1. Synthesize the px330-T7-cas9 plasmid, which can be synthesized in the laboratory using existing technology or obtained through public commercial channels (e.g., Public Protein / Plasmid Library of plasmid synthesis companies, plasmid and protein shared library);

[0064] 2. Enzyme digestion:

[0065] The px330-T7-cas9 plasmid was digested with a single enzyme. The enzyme digestion system is as follows:

[0066]

[0067] 3. Purification:

[0068] (1) After the enzyme digestion reaction is completed, take 2 μl of the sample for gel electrophoresis to confirm whether the digestion is complete. Use the circular plasmid as a control.

[0069] (2) DNA purification and recovery experiment:

[0070] ① Add 200ul of anhydrous ethanol and slowly invert for 30 seconds until flocculent suspension appears;

[0071] ② Centrifuge the EP tube with ethanol added at 13000 rpm for 5 minutes;

[0072] ③After centrifugation, pour out the liquid, add 75% ethanol to wash (do not wash away the sediment at the bottom of the tube), pour out the ethanol after washing, and repeat this step twice;

[0073] ④ Dry the residual ethanol in the tube, add 50ul ddH2O, dissolve the DNA at 56℃, and measure the concentration after it is fully dissolved.

[0074] 4. Transcription:

[0075] This step is based on the ThermoFisher mMESSAGE mMACHINE TM The experiment was performed according to the instructions of T7 ULTRA transcription kit.

[0076] 5. RNA purification and recovery:

[0077] RNA purification and recovery is carried out using conventional and mature techniques in the art. The following methods may also be used:

[0078] According to ThermoFisher MEGAclear TM The experiment was performed according to the instructions of the transcript purification kit.

[0079] Finally, the transcribed Cas9 mRNA was obtained, and gel electrophoresis experiments were performed to observe the transcription quality and determine the concentration.

[0080]

[0081] The above method can be used to synthesize Cas9 mRNA with higher purity and better compliance with experimental requirements.

[0082] For gRNA:

[0083] The guide RNA (gRNA) is a wild-type base sequence including the IL-1f9 K124 site.

[0084] For oligo donor DNA:

[0085] About 100 bases upstream and downstream of the IL-1f9 K124 mutation site and the sequence including the mutation base were selected as oligo donor DNA.

[0086] Basic information of the mutated gene:

[0087] The name of the gene mutated in the above step (Ensembl number) is IL-1f9 (IL36G, Il1f9) (ENSMUSG00000044103).

[0088] Ensembl website link for mutation target gene:

[0089] http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000044103;r=2:24076488-24083580;t=ENSMUST00000057567

[0090] Transcript targeted by mutation (Ensembl number): IL-1f9(IL-36G,Il1f9)-201(ENSMUST00000057567.3)

[0091] Mutation site: K124A

[0092] SEQ ID NO.1: Wild-type genome sequence (i.e. before mutation) information is:

[0093] tacttttatagTCAGCGTGACTATCCTCCCATGCAAGTACCCAGAGTCTCTTGAACAGGACAAAGGGATTGCCATTTATTTGGGAATTCAGAATCCAGATAAATGCCTGTTTTGTAAGGAAGTTAATGG ACACCCTACTTTGCT GCTAAAG gtcagtgacccagaaaaataccattaaaaactatgtttcttctcttacatttttaatct;

[0094] The uppercase bases are exon4 sequences, the lowercase bases are intron sequences, the underlined and bold bases AAG are bases to be mutated, and the underlined bases are guide RNA (gRNA) sequences.

[0095] Among them, SEQ ID NO.2: guideRNA (gRNA) synthetic complete sequence:

[0096] mA*mC*mA*rCrCrTrArCrTrTrTrGrCrTrGrCrTrArArGrTrTrTrTrArGrArGrCrTrArGrArAr ArTrArGrCrArArGrTrTrArArArArTrArArGrGrCrTrArGrTrCrCrGrTrTrArTrCrArArCrTrTrGrArA rArArArGrTrGrGrCrArCrCrGrArGrTrCrGrGrTrGrCrT*mT*mT*mT

[0097] SEQ ID NO.3: oligo donor DNA sequence information (the bold and underlined GCT are the mutated bases):

[0098] ATCCAGATAAATGCCTGTTTTGTAAGGAAGTTAATGGACACCCTACTTTGCTGCTA GCT GTCAGTGACCCAGAAAAATACCATTAAAAACTATGTTTCTTCTCTTACATTTTTAA

[0099] In the second step, the Cas9 mRNA, gRNA and oligo donor DNA obtained in the first step are microinjected into the male pronucleus of the fertilized egg of C57BL / 6J mice. The specific steps are as follows:

[0100] 1. Mouse Preparation:

[0101] (1) Preparation of embryo donor mice: C57BL / 6J mice are selected as embryo donor mice because they have a good genetic background and embryological characteristics. Specific procedures: 5.0 IU of pregnant mare serum gonadotropin (PMSG) is injected intraperitoneally into mature C57BL / 6J female mice, usually at 13:00 to 14:00 in the afternoon, and 5.0 IU of human chorionic gonadotropin (hCG) is injected about 48 hours later, and the mice are immediately caged with male mice. The next morning, the vaginal plugs of the female mice are checked, and the female mice that have successfully mated will be used to recover the embryos. In order to obtain a better superovulation effect, female mice aged 3 to 6 weeks are generally selected. Male mice reach sexual maturity at about 8 weeks of age and can be used until their reproductive performance declines (6 to 8 months of age), at which time they are eliminated.

[0102] (2) Preparation of embryo transfer recipient mice: In order to obtain pseudo-pregnant female mice for embryo transfer recipients, male mice with vasectomized deferens are usually caged with naturally estrus female mice on the day before embryo transfer. Then, on the morning of the day of embryo transfer, the vasectomized female mice are removed and used as a standby. Pseudo-pregnant mice are generally inexpensive and have good maternal qualities, such as ICR or KM mice.

[0103] 2. Embryo Collection:

[0104] After killing the mice with thrombi, the abdominal cavity was opened and the fallopian tubes were carefully separated. Then the fallopian tubes were placed in M2 culture medium containing hyaluronidase. The newly discharged fertilized eggs (fertilized zygotes) were surrounded by cumulus cells and formed a "cloud" in the ampulla. The abdomen was torn open with watch forceps, and the "cloud" was squeezed out due to the pressure inside the fallopian tube. Under the action of hyaluronidase, the fertilized eggs gradually shed the cumulus cells, and then the fertilized eggs were transferred and washed once in M2 culture medium and transferred to the pre-balanced KSOM microdroplets for culture and injection.

[0105] 3. Microinjection:

[0106] The time for microinjection is generally chosen between noon and around 16:00 in the afternoon. At this time, the pronucleus of the mouse fertilized egg is in a stage of gradual expansion, which is easier to identify and inject. The obtained Cas9 mRNA, gRNA and oligodonor DNA are injected into the injection needle by the tail siphon method, and be careful not to produce bubbles. Use M2 to make a long droplet on a glass slide, and cover it with paraffin oil to make a micromanipulation drop. Use an oviduct to transfer a group of fertilized eggs to the operation drop. Observe under the microscope to make sure that the injection needle tip is not blocked and the DNA flow is smooth. Observe the fertilized egg (zygote) under a high-power microscope and select a zygote with two pronuclei and good morphology. Adjust the holding needle to a position adjacent to the zygote and adjust the pressure to fix it with negative pressure. The pronucleus is required to be on the central axis of the holding needle as much as possible. The holding needle is slightly negatively pressured to ensure that the zygote is firmly fixed, and the focus is fine-tuned to make the edge of the pronucleus clearest. Then move the injection needle to make the needle tip completely clear. Push the injection needle through the zona pellucida, enter the ovum cytoplasm and slowly approach the pronucleus. If the pronucleus swells, it means the injection is successful. At this time, the injection needle should be withdrawn immediately. After all the zygotes in the operation drop are injected, they should be placed in KSOM and cultured at 37°C for a period of time for the next embryo transfer.

[0107] 4. Transplant the injected fertilized eggs into the uterus of pseudo-pregnant female mice. Specific steps:

[0108] The mouse is weighed and anesthetized intraperitoneally. After anesthesia, the mouse is placed on a pad or paper for easy operation under a microscope. The ovaries, fallopian tubes, and part of the uterine horns are pulled out according to conventional surgical methods. The injected zygote is sucked into the transplant tube. Before sucking in the embryo, 2 to 3 small bubbles can be sucked out first, which can well control the in and out of the fluid and have an indicator of the success of the transplant. Clamp the fat pad of the ovary with blunt-tipped forceps and pull it out, and clamp it with a small vascular clamp to expose the ovary, fallopian tube, and part of the uterus to the outside of the body. Under the microscope, find the opening of the fallopian tube (fallopian tube fimbria) or the enlarged fallopian tube ampulla. These two parts are generally selected as the entrance for transplantation. Adjust the position of the mouse and the fallopian tube, insert the transplant needle into the fallopian tube fimbria, and gently blow the embryo into it. If bubbles are seen in the fallopian tube, it means that the transplantation is successful. In some cases, the position of the fallopian tube is not convenient for needle insertion. At this time, a small incision can be made near the upstream of the ampulla to insert the transplant needle. After successful transplantation, loosen the vascular clamp, restore the ovary, fallopian tube and uterus back to the body, and suture the body wall. After surgery, place the mouse in a clean cage and cover its eyes. It can be placed on a 37°C hot table until it wakes up.

[0109] 5. The mice born about 20 days after the fertilized eggs were transplanted from the mother mice are F0 generation mice. Their genotypes were identified through PCR amplification and sequencing to obtain F0 generation positive mice.

[0110] F0 generation mouse identification strategy (see Appendix Figure 2 ): Cut 0.5 cm from the end of the mouse tail, then extract DNA, and use gRNA, Cas9, upstream primer I and downstream primer II to PCR amplify the DNA of F0 generation mice. The specific principle is: gRNA finds the mutation site of the target gene, Cas9 cuts the mutation site, PCR amplifies with upstream primer I and downstream primer II, and then uses sequencing primers to identify the genotype of the PCR amplified product. Compare the wild-type genome sequence (Query) and the actual sequencing result after mutation (Subject) on the NCBI BLAST sequence alignment website, website address: http: / / blast.ncbi.nlm.nih.gov / Blast.cgi? PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LIN K_LOC=align2seq

[0111] Primer information: SEQ ID NO.4: Ⅰ (upstream primer): Forward 5'-ACTGCCACCAGGTGTTCAAA-3';

[0112] SEQ ID NO.5: II (downstream primer): Reverse 5'-AGGGTAAAGGAGGGAGCTGA-3'

[0113] PCR reaction system:

[0114] Reaction Component Volume(μl) Double deionized water (ddH2O) 8.05 2xPCR Buffer 10 Primer I (20 pmol / μl) 0.3 Primer II (20 pmol / μl) 0.3 KOD-Multi&Epi-* 0.35 Genomic DNA 1 Total volume 20

[0115] KOD-Multi&Epi-*(TOYOBO, Code No: KME-101)

[0116] PCR reaction conditions:

[0117]

[0118] SEQ ID NO.6: Sequencing primer: 5'-ACTGCCACCAGGTGTTCAAA-3'

[0119] SEQ ID NO.7: Wild-type genome sequence-Query,

[0120]

[0121] SEQ ID NO.8: Actual gene sequence after mutation - Subject:

[0122]

[0123] Comparison of sequencing results before and after mutation can be seen in Figure 8 .

[0125] The above gene sequence alignment results were obtained by comparing on the NCBI BLAST sequence alignment website, the website address is as follows: http: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LIN K_LOC=align2seq

[0126] In the third step, the identified F0 positive mice were mated with C57BL / 6J mice to obtain F1 mice. The genotype of the F1 positive mice was identified by PCR amplification and sequencing. The F1 positive mice were IL-1f9 that could be stably inherited. K124A Heterozygous mice with point mutations; and the F1 generation negative mice can be used as wild-type mice.

[0127] Since the cleavage rate of the fertilized egg is very fast in the early stage, the F0 generation mice obtained are chimeras and may not have the ability to stably inherit. It is necessary to mate the positive F0 generation mice screened out in the second step with C57BL / 6J mice to breed F1 generation mice, and identify their genotypes through PCR amplification and sequencing. The identification method is the same as in the second step. The positive F1 generation mice obtained are F1 generation mice with stable inheritance, namely IL-1f9 K124A point mutation heterozygous mice, and the negative F1 generation mice are regarded as wild-type mice.

[0128] Step 4: The IL-1f9 obtained in step 3 K124A The psoriasis mouse model was obtained by inducing imiquimod (IMQ) in heterozygous mice with point mutations.

[0129] The specific induction method is: in wild-type mice and IL-1f9 K124A After the back hair of heterozygous mice with point mutations was removed, imiquimod cream was applied to the hair removal area on the back of the mice every day, 80 mg / (2×2 cm 2 ·d) After 5 days of continuous application, obvious psoriasis lesions will appear on the back hair removal area. The changes of lesions during the modeling period are shown in the attached figure. Figure 3-1 and 3-2 As shown in the figure, there was no significant change in the hair loss area on the back of the two groups of mice in the first two days of modeling. K124A The skin of heterozygous mice with point mutations was slightly red, while that of wild-type mice was unchanged. On the 4th day, the mutant mice developed obvious erythema, some lesions were covered with scales, and the lesions were moderately raised, while the skin of wild-type mice was slightly red. Figure 3-3 and 3-4 As shown, on day 5, the mice were compared with wild-type mice (see Appendix Figure 3-3 ) compared to mutant mice (see Appendix Figure 3-4 ) The erythema deepens, the surface is covered with thick scales, and the lesions are significantly thickened, which is consistent with psoriasis-like changes.

[0130] To further verify the similarity of mouse skin lesions in histopathological manifestations with psoriasis lesions, HE staining and immunofluorescence staining were used to identify mouse skin lesions. K124A The heterozygous mice with the point mutation were anesthetized and killed, and the local skin lesions were taken and divided into two parts for identification:

[0131] A portion of the specimens were fixed and paraffin sections were made. The paraffin specimens were stained with HE and the pathological changes of the skin tissue, especially the thickness of the epidermis, were observed under a microscope. The results are shown in Figure 4. The epidermis of the skin of wild-type mice is thinner (see Figure 4). Figure 4-1 ), while IL-1f9 K124A Mice heterozygous for the point mutation (see Figure 4-2 ) The epidermis is significantly thickened, with parakeratosis and hyperkeratosis, an increase in the number of spinous cells, and epidermal processes extending downward, which are highly similar to the histopathological changes of skin lesions in patients with psoriasis.

[0132] Another part of the skin lesion tissue was used for immunofluorescence staining of neutrophil and T cell marker proteins, and the results showed that IL-1f9 K124A After imiquimod induction, the number of T cells (as shown in FIG5 ) and neutrophils (as shown in FIG6 ) in the dermis of heterozygous mice with point mutations increased significantly compared with wild-type mice, which is basically the same as the pathological changes of human psoriasis lesions.

[0133] Figure 4: Wild-type mice and IL-1f9 K124A Schematic diagram of HE staining of skin lesion tissue sections of heterozygous mice with point mutations after imiquimod induction. Figure 4-1 Schematic diagram of HE observation of skin lesion tissue sections of wild-type mice on the 5th day after IMQ treatment; Figure 4-2 IL-1f9 K124A Schematic diagram of HE observation of skin lesion tissue sections of heterozygous mice with point mutations on the 5th day after IMQ treatment; HE staining showed that the epidermis of the skin of wild-type mice was thinner, while that of mutant mice was significantly thickened, with incomplete keratinization and hyperkeratinization, an increase in the number of spinous cells, and epidermal processes extending downward.

[0134] Figure 5: Wild-type mice and IL-1f9 K124A Schematic diagram of T cell immunofluorescence staining observation of skin lesion tissue sections of heterozygous mice with point mutations after imiquimod induction;

[0135] in, Figure 5-1a , 5-1b , 5-1c, 5-1d are schematic diagrams of immunofluorescence staining observation of T cells in skin lesions of wild-type mice on the 5th day after imiquimod (IMQ) treatment; Figure 5-1a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 5-1b The red fluorescence in the middle is marked by the T cell marker protein CD3. Figure 5-1c The green fluorescence in the middle is marked by the T cell marker protein IFN-γ. Figure 5-1d The fluorescence images taken in different fluorescence channels of the same field of view are merged.

[0136] Figure 5-2a , 5-2b , 5-2c, 5-2d are IL-1f9 K124A Schematic diagram of immunofluorescence staining observation of T cells in skin lesions of heterozygous mice with point mutations on the 5th day of imiquimod (IMQ) treatment; Figure 5-2a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 5-2b The red fluorescence in the middle is marked by the T cell marker protein CD3. Figure 5-2c The green fluorescence in the middle is marked by the T cell marker protein IFN-γ. Figure 5-2d The fluorescence images taken by different fluorescence channels in the same field of view are merged. T cell immunofluorescence staining shows IL-1f9 K124A The CD3 and IFN-γ proteins in the skin lesions of point mutation mice were significantly increased compared with those in wild-type mice, indicating that IL-1f9 K124A After imiquimod induction, the number of T cells in the dermis of heterozygous mice with point mutations was significantly increased compared with that of normal mice.

[0137] Figure 6: Wild-type mice and IL-1f9 K124A Schematic diagram of neutrophil immunofluorescence staining observation of skin lesion tissue sections of heterozygous mice with point mutations after imiquimod induction;

[0138] in, Figure 6-1a , 6-1b , 6-1c, 6-1d are schematic diagrams of neutrophil immunofluorescence staining observation of skin lesions of wild-type mice on the 5th day after IMQ treatment; Figure 6-1a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 6-1b Red fluorescence is used to mark the neutrophil marker protein MPO. Figure 6-1c The green fluorescence in the middle is the marker protein TLR2 for neutrophils; Figure 6-1d The fluorescence images taken in different fluorescence channels of the same field of view are merged.

[0139] Figure 6-2a , 6-2b , 6-2c, 6-2d are IL-1f9 K124ASchematic diagram of immunofluorescence staining observation of neutrophils in skin lesions of heterozygous mice with point mutations on the 5th day of IMQ treatment; Figure 6-2a The blue fluorescence is the cell nucleus labeled by DAPI. Figure 6-2b Red fluorescence is used to mark the neutrophil marker protein MPO. Figure 6-2c The green fluorescence in the middle is the marker protein TLR2 for neutrophils; Figure 6-2d The fluorescence images taken by different fluorescence channels in the same field of view are merged. Immunofluorescence staining of neutrophils shows IL-1f9 K124A The MPO and TLR2 proteins in the skin lesions of heterozygous mice with point mutations were significantly increased compared with those in wild-type mice, indicating that IL-1f9 K124A After imiquimod induction, the number of neutrophils in the dermis of heterozygous mice with point mutations was significantly increased compared with that of wild-type mice.

[0140] Based on the previous research results, the present invention for the first time constructs a psoriasis mouse animal model based on the dihydroxyisobutyrylation modification level of the protein combined with imiquimod stimulation.

[0141] Compared with the prior art method for constructing a psoriasis mouse model, the present invention has the following advantages:

[0142] ① This technology constructs a psoriasis mouse model based on the post-translational modification level, avoiding the influence of factors such as transcription and translation on the mouse phenotype, and to a certain extent reducing the influence of non-experimental factors on the results, ensuring the comparability of the results;

[0143] ② This technology is the first to construct a psoriasis mouse model starting from lysine 2-hydroxyisobutyrylation, which plays an important role in exploring the dihydroxyisobutyrylation modification of psoriasis;

[0144] ③ The modeling cycle of this technology is short. Obvious psoriasis skin manifestations can appear on the 5th day of imiquimod induction, while the modeling cycle in previous literature reports lasted about 2 weeks;

[0145] ④ The mouse model constructed in the present invention has more severe skin lesions and inflammatory cell infiltration, which is most consistent with the characteristics of skin lesions in patients with psoriasis and meets the requirements for animal models in the primary stage of psoriasis research.

[0146] The applicant declares that the present invention illustrates the detailed process of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed process, that is, it does not mean that the present invention must rely on the above-mentioned detailed process to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of the methods and steps selected by the present invention, addition of auxiliary steps, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

[0147] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0148] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0149] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. IL-1f9 K124A Method for constructing a heterozygous mouse model of a point mutation, including: The first step is to obtain Cas9 mRNA, gRNA and oligo donor DNA; In the second step, the Cas9 mRNA, gRNA and oligo donor DNA obtained in the first step are microinjected into the male pronucleus of the fertilized egg of C57BL / 6J mice, and the injected fertilized eggs are transplanted into the uterus of pseudo-pregnant female mice. The mice born in this way are F0 generation mice; The third step is to identify the genotype of the F0 generation mice by PCR amplification and sequencing, and to mate the identified F0 generation positive mice with C57BL / 6J mice to obtain F1 generation mice; The fourth step is to identify the genotype of F1 mice by PCR amplification and sequencing. F1 positive mice are IL-1f9 that can be stably inherited. K124A Mice heterozygous for the point mutation.

2. The method of claim 1, further comprising: Step 5: IL-1f9 obtained in step 4 K124A Mice heterozygous for the point mutation were treated with imiquimod to obtain a mouse model of psoriasis.

3. The method of claim 1, further comprising: The gRNA is a wild-type base sequence including the IL-1f9 K124 site.

4. The method of claim 1, further comprising: About 100 bases upstream and downstream of the IL-1f9 K124 mutation site and the sequence including the mutation base were selected as oligo donor DNA.

5. The method of claim 1, further comprising: The steps of genotyping the F0 generation mice by PCR amplification and sequencing in the third step include: A sample is cut from the tail end of the F0 generation mouse, and then DNA is extracted. The DNA of the F0 generation mouse is amplified by PCR using gRNA, Cas9, upstream primer I and downstream primer II, and then the genotype of the PCR amplification product is identified using sequencing primers.

6. The method of claim 5, further comprising: The upstream primer I is: Forward 5'-ACTGCCACCAGGTGTTCAAA-3'; The downstream primer II is: Reverse 5'-AGGGTAAAGGAGGGAGCTGA-3'.

7. The method of claim 2, further comprising: The fifth step is to treat the IL-1f9 obtained in the fourth step K124A The psoriasis mouse model was obtained by imiquimod-induced induction in heterozygous mice with point mutations, further comprising: in wild-type mice and IL-1f9 K124A After hair removal on the back of heterozygous mice with point mutations, imiquimod cream was applied to the hair removal area on the back of the mice daily, with a dosage of 80 mg per day for a 2 cm × 2 cm area, and the application continued for 5 days.

8. The method of claim 1, further comprising: The oligo donor DNA sequence information is shown in SEQ ID NO.

3.

9. The method of claim 2, further comprising: Wild-type mice and IL-1f9 K124A The heterozygous mice with the point mutation were induced with imiquimod. On the 5th day of imiquimod induction, the two groups of mice were anesthetized to death and the local skin lesions were taken and divided into two parts for identification: One part of the specimens was fixed and paraffin sections were made. The paraffin specimens were stained with HE, and the other part of the skin lesion tissue was used for immunofluorescence staining of neutrophil and T cell marker proteins. The above two samples were compared and observed.

10. The method according to claim 1, The steps to obtain Cas9 mRNA include: Steps of target plasmid synthesis, enzyme digestion, purification, transcription, and RNA purification and recovery.

Images