RPA-CRISPR / Cas12a-based detection kit and detection method for visual detection of citrus brown spot bacteria

Abstract

The invention discloses a detection kit and a detection method for visually detecting citrus brown spot bacteria based on RPA-CRISPR / Cas12a. According to the scheme, an A.alternana visual rapid detection system based on an RPA-CRISPR / Cas12a technology is provided, the system can be carried out under the constant temperature condition of 37 DEG C, the detection lower limit is 10 <-3 > ng / mu L, the reaction time is only 40 min, the detection result can be visually reflected by means of a nucleic acid test strip, and the detection result can be compared with the prior art. The method has the advantages of high specificity, high sensitivity, short detection time, visualization and the like, is not limited by materials, sites and instruments, can detect target pathogenic bacteria from complex samples of various tissues of plants, and is simple and easy to use for farmer households and grassroots plant protection workers.

Description

Technical Field

[0001] The present invention relates to the fields of biotechnology and plant disease detection technology, and in particular to a detection kit and a detection method for visually detecting citrus brown spot pathogen based on RPA-CRISPR / Cas12a. Background Art

[0002] Citrus brown spot is one of the most serious fungal diseases caused by Alternaria alternata. In the early stage of the disease, small brown spots appear on young leaves and shoots. Then the spots gradually expand and yellow halos form around the spots, causing a large number of fallen leaves and dead branches. When infecting fruits, black sunken spots form on the fruit surface, causing young fruits to fall off. The pathogen remains in mature detached fruits and continues to cause disease. The main pathogen of citrus brown spot in China is Alternaria alternata pathotype tangerine. Citrus brown spot on tangerine and pomelo abroad is also caused by Alternaria gossypina, which has not been isolated and found in China. A. alternata mainly completes the disease cycle process with conidia, overwinters in the form of conidia or mycelium, and infects with new spores produced by overwintering spores or mycelium in the following year when the environmental temperature and humidity are suitable. The infected parts include young leaves, shoots, young fruits and mature fruits. At present, the main prevention and control measures for citrus brown spot are still physical treatment and chemical control. Therefore, it is necessary to develop more advanced rapid detection methods so that the disease can be detected in time at the beginning, and prevention and control measures can be taken to curb the spread of pathogens.

[0003] At present, the detection technologies used for A. alternata mainly include traditional morphological identification and molecular biological methods. Molecular biological methods include PCR (JE Marín et al. 2006), fluorescence quantitative PCR (Boris XCamiletti et al. 2023), loop-mediated isothermal amplification (LAMP) (Hamid Moghimi et al. 2015), hydrogel digital LAMP (Yang et al. 2023), RPA-CRISPR / Cas12a and RCA-enriched G-quadruplex / hemin DNAzyme combination method (Liu et al. 2023), etc. The traditional morphological identification method is time-consuming and laborious, and has high requirements on the professional skills of the detection personnel and the experimental environment, and is not suitable for the rapid detection of pathogens. The molecular detection technology based on PCR requires specialized instruments such as PCR instrument, gel imager, fluorescence quantitative PCR instrument, and has high detection cost, which is not suitable for rapid detection in the field. LAMP technology can react at a constant temperature of 60-65℃, but it requires the design of 4-6 primers. The primer design is complex and prone to false positives, and the accuracy cannot meet the needs of field testing.

[0004] Recombinase polymerase amplification technology exponentially amplifies nucleic acids under constant temperature conditions with the participation of multiple enzymes, and is known as a nucleic acid detection technology that can replace PCR (Kim et al. 2023). First, the complex of recombinase and oligonucleotide primer finds complementary sequences in double-stranded DNA, starts chain displacement reaction and initiates DNA synthesis, and exponentially amplifies the target on the template. Clustered regularly interspaced short palindromic repeats and CRISPR-associated proteins (clustered regularly interspaced short palindromic repeats-CRISPR associated enzyme systems), referred to as CRISPR-Cas systems, is a new type of nucleic acid detection technology that has been widely used in pathogen detection in recent years (Adiego-Perezet al. 2019). CRISPR / Cas12a mainly completes the reaction through three steps: recognition, cutting and repair. The Cas12a protein is guided by CRISPR RNA (crRNA) to recognize a specific protospacer adjacent motif (PAM). When CAS12a binds to it and cuts DNA, its trans cleavage activity is activated, and it can efficiently cut single-stranded DNA in the system (Lei Rong et al. 2022). Therefore, the detection conditions of the CRISPR / Cas12a system are determined by the addition of dsDNA containing different modification groups. The high sensitivity and specificity of Cas proteins also determine that the CRISPR-Cas system is a powerful tool for rapid pathogen detection.

[0005] Since the optimal reaction temperature of Cas12a is 37°C, which is close to the reaction temperature of RPA, this study combined the two, that is, after RPA specific amplification, CRISPR / Cas12a was used to verify the specific target sequence and detect it using fluorescence and test strips. The optimized RPA-CRISPR / Cas12a Alternaria detection system can provide a rapid detection method for field pathogen identification. Summary of the invention

[0006] In view of this, the object of the present invention is to propose a detection kit and method for visual detection of citrus brown spot pathogenic bacteria based on RPA-CRISPR / Cas12a, which is reliable, easy to operate, accurate in identification results, and rapid and sensitive.

[0007] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0008] A reagent for visually detecting citrus brown spot pathogen based on RPA-CRISPR / Cas12a, comprising crRNA and a primer pair for detecting citrus brown spot pathogen; the primer pair is RPA-F and RPA-R;

[0009] The nucleotide sequence of RPA-F is shown in SEQ ID NO.1, and the nucleotide sequence of RPA-R is shown in SEQ ID NO.2;

[0010] The crRNA is crRNA-1, crRNA-2 or crRNA-3;

[0011] The nucleotide sequence of crRNA-1 is shown in SEQ ID NO.3;

[0012] The nucleotide sequence of crRNA-1 is shown in SEQ ID NO.4;

[0013] The nucleotide sequence of crRNA-1 is shown in SEQ ID NO.5.

[0014] Based on the above, this scheme also provides a kit for visual detection of citrus brown spot pathogenic bacteria based on RPA-CRISPR / Cas12a, which comprises the reagents described above.

[0015] As a preferred embodiment, preferably, the kit described in this scheme also includes Cas12a and ssDNA fluorescent probe.

[0016] On the basis of the above, the present scheme also provides the use of the above-mentioned reagent or the above-mentioned kit in detecting citrus brown spot pathogen.

[0017] On the basis of the above, the present solution also provides the use of the above-mentioned reagent or the above-mentioned kit in the preparation of a product for detecting citrus brown spot pathogen.

[0018] On the basis of the above, this scheme also provides a detection method for visual detection of citrus brown spot pathogen based on RPA-CRISPR / Cas12a, and the detection method comprises the following steps:

[0019] (1) extracting nucleic acid from the sample to be tested;

[0020] (2) mixing the primer pair described above with the nucleic acid in step (1), performing RPA amplification, and obtaining an RPA amplification product;

[0021] (3) mixing the RPA amplification product described in step (2) with the crRNA, Cas12a, and ssDNA fluorescent probe described above, performing a CRISPR reaction, and reading the detection signal;

[0022] (4) Determine whether the sample to be tested contains citrus brown spot pathogen based on the detection signal.

[0023] The rapid detection methods currently related to this program area are mainly as follows:

[0024] (1) Loop-mediated isothermal amplification (LAMP) (Hamid Moghimi et al. 2015). This protocol requires a 60-min reaction at 65°C before detection. The detection must be observed at 260 nm fluorescence, and the detection sensitivity is 15 pg. The results are easily affected by the environment and aerosols to produce false positives, and can only be performed in the laboratory.

[0025] (2) Hydrogel digital LAMP (Yang et al. 2023). This method has a fast reaction speed and can detect Alternaria. Many types of Alternaria can be isolated from citrus, but only Alternaria alternata pathotypetangerine can cause disease on citrus. This method cannot specifically detect Alternaria alternata pathotypetangerine. Moreover, the results need to be observed under a fluorescence microscope, which cannot meet the needs of on-site diagnosis.

[0026] Currently, the only rapid detection method developed for citrus brown spot pathogen is the loop-mediated isothermal amplification method by Hamid Moghimi et al. (Hamid Moghimi et al. 2015).

[0027] By adopting the above technical solution, the present invention has the following beneficial effects compared with the prior art:

[0028] This protocol proposes a visual rapid detection system for the citrus brown spot pathogen Alternaria alternata pathotype tangerine based on RPA-CRISPR / Cas12a technology. The system can be carried out at a constant temperature of 37°C and the reaction conditions are simple. The detection limit is 1pg, and the sensitivity is improved compared with the previous method. In addition, the target gene used in this protocol is a unique gene of the citrus brown spot pathogen Alternaria alternata pathotype tangerine, which has extremely high specificity and will not produce a positive reaction to the non-pathogenic Alternaria alternata. The reaction time is only 40min, and the detection speed is fast. The test results can be intuitively reflected with the help of nucleic acid test strips. It has the advantages of strong specificity, high sensitivity, short detection time, visualization, etc., and is not limited by materials, sites and instruments. It can directly detect the target pathogen from citrus fruit skin samples, providing a simple and easy-to-use detection method for growers and grassroots plant protection workers. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 This is a schematic diagram of data comparison of different crRNA cutting efficiencies during crRNA screening in this embodiment;

[0031] Figure 2 This is a schematic diagram of the test results during RPA reaction optimization in this solution embodiment;

[0032] Figure 3 This is a schematic diagram of the results when the CRISPR / CAS12A cutting time is optimized in the embodiment of this scheme;

[0033] Figure 4 This is a schematic diagram of the results of the specificity of the RPA-CRISPR / Cas12a detection system in the embodiment of this scheme;

[0034] Figure 5 This is an illustration of the results of the sensitivity of the RPA-CRISPR / CAS12a detection system in the embodiment of this scheme. DETAILED DESCRIPTION

[0035] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. It is particularly noted that the following examples are only used to illustrate the present invention, but are not intended to limit the scope of the present invention. Similarly, the following examples are only partial embodiments of the present invention rather than all embodiments, and all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present invention.

[0036] Example 1 Strain isolation and primer design

[0037] 1.1 Strain Isolation

[0038] All test strains were inoculated onto PDA medium and cultured at 26°C for 5 days. Mycelia were collected and genomic DNA was extracted using the CTAB method. The DNA content and purity were determined using Nanodrop.

[0039] 1.2 Target gene selection and primer design

[0040] Based on the A. alternata reference genome in the NCBI database, the conserved gene ACTT3 related to ACT synthesis was selected as the target DNA sequence, and specific primers RPA-F / RPA-R, crRNA, fluorescent probe FQ and test strip probe FB were designed. Primers, crRNA and probes were synthesized by Zhejiang Shangya Biotechnology Co., Ltd., Nanjing GenScript Biotechnology Co., Ltd., and Guangzhou Aidi Gene Technology Co., Ltd., respectively.

[0041] During the pathogenic process, the pathogen secretes the host-specific toxin Alternaria citri toxin (ACT), which causes the host cell membrane to rupture and electrolytes to flow out, allowing the pathogen to further invade and colonize. Studies have shown that ACT toxin is a key pathogenic factor of the pathogen. When the ACT toxin cannot be synthesized, the strain loses its pathogenicity. The gene ACTT3 (AB176941.1) was screened out from the ACT synthesis gene of Alternaria alternata for BLAST analysis. The results showed that the gene was highly specific and was only expressed in A. alternata. When designing specific primers, the fragment must contain a PAM sequence (TTTN or NAAA), and the 20 bases immediately following the PAM sequence should also be specific. Taking the above factors into consideration, this study designed multiple pairs of primers. Through gel electrophoresis analysis, a pair of specific RPA primers, namely RPA-F / RPA-R, was finally screened. The amplified fragment length was 244bp. Combined with the CRISPR-Cas recognition site PAM, three crRNAs were designed. The relevant information is shown in Table 1.

[0042] Table 1. Material information table

[0043] Primer name Sequence (5′→3′) RPA-F CCAAGGCGAAGCGATGTTAAAGTCTAGCACA(SEQ ID NO.1) RPA-R CATACCCTATCAGTCGCGGGAGATAGAAGCT(SEQ ID NO.2) crRNA-1 UAAUUUCUACUAAGUGUAGAUCUUUUGUUAGAAGAGGAAUC(SEQ ID NO.3) crRNA-2 UAAUUUCUACUAAGUGUAGAUCCACUGGCGCCUUGUAUCCG(SEQ ID NO.4) crRNA-3 UAAUUUCUACUAAGUGUAGAUUAAAGCGAAGUGGCAAUACU(SEQ ID NO.5) ssDNA-FQ FAM- / TTATTATT / -BHQ1 ssDNA-FB FAM- / TTATTATT / -Biotin

[0044] Example 2 Establishment of a method for visually detecting citrus brown spot pathogen based on RPA-CRISPR / Cas12a

[0045] 2.1RPA amplification system

[0046] The RPA amplification kit purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd. was used. The amplification system was 50 μL: 29.4 μL A Buffer, 2 μL each of upstream and downstream primers (10 μmol / L), 5 μL DNA template, and 9.1 μL ddH2O were added to the dry powder reaction tube. 2.5 μL B Buffer was added to the tube cap. After mixing evenly, the reaction tube was placed at 37°C for reaction for 10–40 min.

[0047] 2.2 Establishment of CRISPR / Cas12a detection system

[0048] CRISPR / Cas12a fluorescence detection system: 10×Cleavage Buffer 3μL, 1μmol / LLabCas12aNuclease 1μL, 500nmol / L crRNA 2μL, Nuclease-free water 17.9μL, 2μmol / L ssDNA-FQ6μL, RPA reaction product 0.1μL. The reaction system was mixed evenly and placed in a multifunctional microplate reader (Thermo Scientific VarioskanTMLUX) at an incubation temperature of 37°C or a real-time fluorescence quantitative PCR instrument (Bio-Rad C1000 TouchTMThermal Cycler) for fluorescence intensity detection.

[0049] CRISPR / Cas12a test strip detection system: 10×Cleavage Buffer 3μL, 1μmol / LLabCas12aNuclease 1μL, 500nmol / L crRNA2μL, Nuclease-free water 17.9μL, 2μmol / L ssDNA-FB 6μL, RPA reaction product 0.1μL, mix the reaction system evenly and react at 37℃ for 10–30min, insert the binding pad end of the Cas12 / 13 special nucleic acid test strip (Guangzhou Aidi Gene Technology Co., Ltd.) into the reaction tube, and read the results. Under natural light, if only the test line or the quality control line and the test line have visible red bands, it is judged as a positive result; if the quality control line has a red band and the test line does not show color, it is judged as a negative result.

[0050] Example 3 Optimization of RPA-CRISPR / Cas12a detection system

[0051] 3.1 Screening of crRNA

[0052] The three designed crRNAs (crRNA-1, crRNA-2, and crRNA-3 shown in Table 1) were added to the CRISPR / Cas12a system respectively, and the cutting efficiency of different crRNAs in fluorescence detection was compared to screen out the optimal crRNA sequence. Water was used as a control, and the experiment was repeated three times.

[0053] The crRNA was screened by the RPA-CRISPR / Cas12a fluorescence detection system, and water was used as a negative control. Real-time fluorescence detection was performed using an ELISA reader ( Figure 1The results showed that the fluorescence signals of the three treatment groups were higher than those of the control group, and the fluorescence signal of crRNA1 was significantly higher than that of crRNA2 and crRNA3, indicating that the cutting efficiency of crRNA1 in this reaction system was higher, so crRNA1 was selected for subsequent experiments.

[0054] 3.2 Optimization of RPA reaction

[0055] First, the RPA reaction time was optimized and set to 5, 10, 15, 20, 25, and 30 min, respectively. After the reaction, 50 μL Tris saturated phenol / chloroform / isoamyl alcohol (25:24:

[0056] 1) DNA extract, after mixing and centrifugation, mixed with 6× Loading Buffer and spotted for agarose gel electrophoresis detection. The optimal reaction time was determined according to the strength of the electrophoresis band concentration, and the experiment was repeated three times; secondly, the RPA reaction temperature was optimized, and five RPA reaction temperatures were set, namely 33, 35, 37, 39, and 41°C, respectively. Other conditions remained the same. After the reaction, the treatment method was consistent with the optimization of the RPA reaction time. The optimal reaction time was determined according to the electrophoresis band concentration, and the experiment was repeated three times.

[0057] According to the results of agarose gel electrophoresis, it can be found that a large number of target fragments can be amplified after 10min, 15min, 20min, and 25min of RPA reaction, and the amount of amplified fragments increases with the extension of time. Considering the time consumed by RPA amplification and the clarity of subsequent CRISPR / Cas12a results, 15min, which is shorter and has sufficient amplified products, was selected as the RPA reaction time (see Figure 2 Subgraph A in .

[0058] Next, the RPA reaction temperature was optimized. The set temperatures were all effective for amplification. In the repeated results, it was found that the amplification product accumulated the most at 37°C, which was also the closest to human body temperature. Therefore, 37°C was selected as the RPA reaction temperature (see Figure 2 Subgraph B in .

[0059] 3.3 Optimization of CRISPR / Cas12a cutting time

[0060] The CRISPR cutting reaction time was set to 0, 10, 20, 25 and 30 minutes, and fluorescence detection and test strip detection were performed, with 3 replicates for each group of experiments. The optimal cutting time was screened based on whether the test strip detection line showed color at different reaction times.

[0061] The results showed that the fluorescence signal generated after 10 minutes of reaction was different from that of the control group; as the CRISPR / Cas12a cutting time increased, the color of the test strip detection line deepened ( Figure 3 ). When the CRISPR / Cas12a reaction time was 25 minutes, the test strip detection line band was very obvious, so the CRISPR / Cas12a cutting time was optimized to 25 minutes.

[0062] Example 4 Specificity verification of RPA-CRISPR / Cas12a detection system

[0063] The extracted DNA of all the test strains was used as a template, and the optimized RPA-CRISPR / Cas12a system was used for detection. ddH2O was used as a control, and the experiment was repeated three times. The specificity of the system was determined by whether the test strip detection line showed color.

[0064] The RPA-CRISPR / Cas12a test was performed using the DNA of all the tested strains as templates. The CRISPR / Cas12a test strips showed that only the test strip of A. alternata Z7 was positive, and the rest were negative ( Figure 4 ), indicating that the system established in this study can specifically detect A. alternata.

[0065] Example 5 Sensitivity evaluation of RPA-CRISPR / Cas12a detection system

[0066] The concentrations were 10, 1, and 10 –1 , 10 –2 , 10 –3 , 10 –4 ng / μL of A. alternata Z7 genomic DNA was used as a template, and the optimized RPA-CRISPR / Cas12a system was used for detection. ddH2O was used as a control, and the experiment was repeated three times. The detection limit of the system was determined based on the intensity of the fluorescence signal and whether the test strip detection line was colored.

[0067] The DNA of A. alternata Z7 with different dilution gradients was amplified by RPA primers and then tested by CRISPR / Cas12a. The results showed that 10, 1, 10 –1 , 10 –2 , 10 –3 ng / μL can produce obvious fluorescence signals (see Figure 5 The sub-figure A in Figure 1 shows a significant difference from the control group, while 10 –4The fluorescence signal generated by the test strips was very low, with no significant difference from the control group; the test results were consistent with the fluorescence detection, ranging from 10 ng / μL to 10 –3 ng / μL test strips were positive, 10 –4 No band was observed on the test strip test line in the ng / μL test group (see Figure 5 The results of sub-graph B) in Figure 1 are negative, indicating that the detection limit of the A. alternata Z7 detection system is 10 –3 ng / μL, with high sensitivity.

[0068] In summary, it can be seen that the visualized rapid detection technology designed in this scheme uses isothermal amplification RPA technology, which has the advantages of high efficiency, simplicity and ease of use, but its sensitivity is limited. By combining with the CRISPR / Cas12a system, it can significantly improve the sensitivity and increase the accuracy of molecular diagnosis. In addition, it is combined with lateral flow immunochromatography and other technologies, and has the characteristics of not requiring expensive equipment and the test results visible to the naked eye. Compared with similar foreign test detection methods, it is more suitable for on-site rapid detection in citrus orchards.

[0069] The above descriptions are only some embodiments of the present invention, and are not intended to limit the protection scope of the present invention. Any equivalent device or equivalent process transformation made using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A reagent for visual detection of citrus brown spot pathogen based on RPA-CRISPR / Cas12a, characterized in that: It includes crRNA and a primer pair for detecting citrus brown spot pathogen; the primer pair is RPA-F and RPA-R; Wherein, the nucleotide sequence of RPA-F is shown in SEQ ID NO.1, and the nucleotide sequence of RPA-R is shown in SEQ ID NO.2; The crRNA is crRNA-1, crRNA-2 or crRNA-3; The nucleotide sequence of crRNA-1 is shown in SEQ ID NO.3; The nucleotide sequence of crRNA-1 is shown in SEQ ID NO.4; The nucleotide sequence of crRNA-1 is shown in SEQ ID NO.

5.

2. A kit for visual detection of citrus brown spot pathogen based on RPA-CRISPR / Cas12a, characterized in that: It comprises the reagent according to claim 1.

3. The kit for visual detection of citrus brown spot pathogen based on RPA-CRISPR / Cas12a as claimed in claim 2, characterized in that: The kit also includes Cas12a and a ssDNA fluorescent probe.

4. Use of the reagent according to claim 1 or the kit according to claim 2 or 3 in detecting citrus brown spot pathogen.

5. Use of the reagent according to claim 1 or the kit according to claim 2 or 3 in the preparation of a product for detecting citrus brown spot pathogen.

6. A method for visually detecting citrus brown spot pathogen based on RPA-CRISPR / Cas12a, characterized in that: The detection method comprises the following steps: (1) extracting nucleic acid from the sample to be tested; (2) mixing the primer pair described in claim 1 with the nucleic acid in step (1), performing RPA amplification, and obtaining an RPA amplification product; (3) mixing the RPA amplification product described in step (2) with the crRNA described in claim 1, the Cas12a described in claim 3, and the ssDNA fluorescent probe, performing a CRISPR reaction, and reading the detection signal; (4) Determine whether the sample to be tested contains citrus brown spot pathogen based on the detection signal.

Images