Primer group, kit, method and application for amplifying I-type dengue virus genome

Abstract

The invention provides a primer group, a kit and a method for targeted amplification of a type I dengue virus genome, and application of the primer group, the kit and the method, relates to dengue virus detection, and belongs to the technical field of genome detection. The universal primer group for amplifying the I-type dengue virus genome is designed, targeted amplification can be performed on the I-type dengue virus genome, sequencing and sequence splicing are performed by utilizing a three-generation sequencing platform after a library is constructed, and the I-type dengue virus genome is obtained. The method provided by the invention can amplify all I-type dengue virus subtypes, and has the advantages of large flux, low cost and simple sequence splicing.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection, relates to type I dengue virus genome detection, and specifically relates to a primer set, a kit, a method and an application thereof for targeted amplification of type I dengue virus genome. Background Art

[0002] Dengue fever is a viral infectious disease caused by dengue virus, mainly transmitted by Aedes mosquitoes, and seriously endangers human health. Dengue virus belongs to the genus Flavivirus of the family Flaviviridae. Its genome is a single-stranded positive-strand RNA with a total length of about 11kb. Both ends are non-coding regions. The internal coding region encodes three structural proteins (C, prM / M and E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5). DENV can be divided into four serotypes based on the envelope protein E, namely DENV-1, DENV-2, DENV-3 and DENV-4. Each serotype is further subdivided into multiple genotypes based on differences in nucleotide sequences. For example, type I dengue virus includes five genotypes: genotypes I, II, III, IV and V.

[0003] Obtaining the full genome sequence of dengue virus type 1 is an important basis for molecular virology research on dengue virus type 1. It plays an important role in studying the evolution, spread and distribution of the virus in a specific population or region, identifying new subtypes, and developing diagnostic reagents and vaccines. The sequencing method is still the most accurate method for identifying virus variants. Only through full-length sequencing can the chimeric pattern of a variant virus strain be accurately identified. Currently, commonly used technologies for obtaining viral gene sequences include PCR-Sanger sequencing and second-generation sequencing technology.

[0004] (1) PCR-Sanger sequencing: PCR amplification is performed using primers covering the entire genome fragment region, and then Sanger sequencing (first-generation sequencing) is performed on the large number of fragments obtained one by one to obtain the fragment sequence and then assemble it. This technology is cumbersome, labor-intensive, and has a long operation cycle; taking dengue virus type I as an example, the genome is about 11kb long, and Sanger sequencing can obtain a fragment of about 0.8kb in one time. It takes more than ten sequencings to obtain the full length.

[0005] (2) Second-generation sequencing: It has the characteristics of high sequencing throughput, fast sequencing speed and high sensitivity. The application of second-generation sequencing technology to deep sequencing of dengue virus type I helps to accurately analyze virus mutations at the genomic level. In recent years, metagenomic second-generation sequencing technology has emerged. It can detect all viral sequences in a sample without the help of primers or probes, and can detect new viruses. However, it currently faces technical problems such as low data utilization, high detection cost and large amount of data required to assemble the genome. If metagenomic sequencing is performed directly from clinical blood samples, there are still a lot of host gene interference problems.

[0006] The third generation sequencing technology refers to single molecule sequencing technology, which is mainly divided into two major technology camps: the first camp is single molecule fluorescence sequencing, and the representative technologies are SMS technology of Helicos in the United States and SMRT technology of Pacific Bioscience in the United States. Deoxynucleotides are fluorescently labeled, and the microscope can record the intensity changes of fluorescence in real time. When the fluorescently labeled deoxynucleotide is incorporated into the DNA chain, its fluorescence can be detected on the DNA chain at the same time. When it forms a chemical bond with the DNA chain, its fluorescent group is removed by DNA polymerase and the fluorescence disappears. This fluorescently labeled deoxynucleotide does not affect the activity of DNA polymerase, and after the fluorescence is removed, the synthesized DNA chain is exactly the same as the natural DNA chain. The second camp is nanopore sequencing, and the representative company is Oxford Nanopore in the United Kingdom. The new nanopore sequencing method (nanopore sequencing) uses single molecules to pass through the nanopore one by one to achieve sequencing. Because the diameter of the nanopore is very small, only a single nucleic acid polymer is allowed to pass through, and the charged properties of the single ATCG base are different. The difference in electrical signals can detect the type of bases that pass through, thereby achieving sequencing. As a new generation of sequencing technology, the third-generation sequencing technology has the significant advantage of being able to perform long-fragment sequencing. Therefore, it shows outstanding advantages in whole genome sequencing.

[0007] Prior art CN116463457A discloses a primer set for amplifying the genome of serotype I dengue virus (DENV-1). The primer set includes primer pair 1 to primer pair 16, each pair of primers consists of a forward primer and a reverse primer, and also discloses a targeted amplification kit for rapid amplification of dengue virus type 1 containing the primer set. The technical disadvantages are that the number of primers is large, the average sequencing depth is low, and the accuracy is not high.

[0008] Prior art CN113564281A provides a multiple types of dengue virus primer sets based on PCR method, wherein the multiple types of dengue virus primer sets include at least two or more of dengue virus type I primer set, dengue virus type II primer set, dengue virus type III primer set, and dengue virus type IV primer set; the dengue virus type I primer set is composed of a first primer set and a second primer set, the dengue virus type II primer set is composed of a third primer set and a fourth primer set, the dengue virus type III primer set is composed of a fifth primer set and a sixth primer set, and the dengue virus type IV primer set is composed of a seventh primer set and an eighth primer set. The invention uses two or more of dengue virus type I primer set, dengue virus type II primer set, dengue virus type III primer set, and dengue virus type IV primer set in the kit. The technical disadvantage is that the genome coverage is low, different annealing temperatures are required for different primer pairs, and the steps are cumbersome. Summary of the invention

[0009] The present invention aims at the problems of low genome coverage, large number of primers and complicated steps in the prior art, and provides a primer set, a kit and a method and application thereof for targeted amplification of type I dengue virus genome. The primer set provided by the present invention can perform targeted amplification of type I dengue virus genome, can amplify all type I dengue virus subtypes, and can be sequenced by third-generation sequencing technology, with high gene coverage, large throughput, low cost and simple sequence splicing.

[0010] To achieve the above purpose, the technical solution adopted by the present invention is as follows: In one aspect, the present invention provides a primer set for amplifying a dengue virus type I genome, the primer set comprising a nucleic acid sequence as shown in SEQ ID NO.1-20: SEQ ID NO.1: TCAGGCCAAGGACCCATGAA; SEQ ID NO.2: AGCTTGAGGTGTTATGGTTGCA; SEQ ID NO.3: GGAAGCAGCATAGGGAAAATGTT; SEQ ID NO.4: AGAGATGGTCCTCGATTTCCACA; SEQ ID NO.5: CAGAAAACAAAATCTGGGGAAGGA; SEQ ID NO.6: TGTTCACTCTTCACTGCTGTTGT; SEQ ID NO.7: GGAGAGGAAGAATTGGAAGGAACC; SEQ ID NO.8: CCATCCCTTGTCAAGTCCCAT; SEQ ID NO.9: CACCTGAGAAATGTGACACCCT; SEQ ID NO.10:TCCCCCTGGAATCTTTGATATGTC; SEQ ID NO.11: AGATGTCCAACACAAGGAGAAG; SEQ ID NO.12: CCCTATTCCTATTTTCATGGTCCA; SEQ ID NO.13: TGGAGGACCAATATCTCAGCACA; SEQ ID NO.14: TGTTCTGCTTCTTCTTCCCAGG; SEQ ID NO.15: AGTTGGAGCCATAGCCCTAGA; SEQ ID NO.16: CACTCTTTTCTCTCTCCGGCTC; SEQ ID NO.17: GCTTCAGCCTGGACCCTCTA; SEQ ID NO.18: TGGTTTCCTCTGAGCCATGG; SEQ ID NO.19: TGGTACATGTGGTTGGGAGC; SEQ ID NO. 20: TCACTTGGTTTATGGCCACTTGT.

[0011] Preferably, the primer set is divided into two primer pools, namely primer pool 1 and primer pool 2; the primer pool 1 consists of the nucleic acid sequences shown in SEQ ID NO.1-10, and the primer pool 2 consists of the nucleic acid sequences shown in SEQ ID NO.11-20.

[0012] On the other hand, the present invention provides a method for amplifying the type I dengue virus genome, wherein the method comprises using the above primer set to amplify the type I dengue virus genome.

[0013] Preferably, the method comprises the following steps: S1. Obtaining RNA of dengue virus type I from a sample; S2, reverse transcription of RNA into cDNA; S3, using the cDNA as a template and the above primer set for amplification to obtain an amplified product; S4. After library construction, sequencing was performed and the sequencing data were analyzed to obtain the complete genome of dengue virus type I.

[0014] Preferably, the sample in step S1 includes a body fluid sample, an artificial culture sample or a vector.

[0015] Preferably, the body fluid sample includes whole blood, serum, plasma, dried blood spots, semen or urine, etc., the artificial culture sample includes type I dengue virus culture cultured in an artificially configured culture medium, and the vectors include mosquitoes, which can carry and spread dengue virus.

[0016] Specifically, the sample is serum.

[0017] Preferably, when the above primer set is used for amplification in step S3, the primer pool 1 and the primer pool 2 are used for amplification respectively, and then the amplification products of the two groups are collected.

[0018] Preferably, the library construction in step S4 includes PCR product purification, end repair, barcode connection and sequencing adapter connection & purification.

[0019] Preferably, the sequencing in step S4 is the third generation sequencing. Only by full-length sequencing can the chimeric pattern of a mutant virus strain be accurately identified and the subtype of the virus strain be distinguished; and the advantage of the third generation sequencing is long-fragment sequencing, which can more accurately sequence the mutation sites, repetitive structures and high GC regions of complex DNA, and sequence splicing is simpler.

[0020] Preferably, the sequencing is performed by using a specific third-generation sequencer and its supporting reagents and instructions to sequence and assemble the library after library construction. The library construction before sequencing needs to be compatible with the specific third-generation sequencing method, such as the barcode connection and sequencing adapter connection & purification steps need to match the third-generation sequencing method used later.

[0021] On the other hand, the present invention provides a kit for amplifying the genome of type I dengue virus, the kit comprising the above-mentioned primer set.

[0022] Preferably, the kit further comprises a buffer, a reverse transcriptase and a DNA amplification enzyme.

[0023] Preferably, the reverse transcriptase is used for reverse transcription of RNA to obtain cDNA, which is then amplified by PCR.

[0024] Preferably, the DNA amplification enzyme is used for PCR amplification.

[0025] Preferably, the buffer is a general term for a variety of buffer solutions, including reverse transcription buffer, PCR amplification buffer and diluents of related reagents, etc.

[0026] On the other hand, the present invention provides the use of the above primer set or the above kit in amplifying the dengue virus type I genome.

[0027] Preferably, the application is a non-disease diagnosis or treatment application, such as obtaining the full genome sequence of dengue virus type I to study the evolution, transmission and distribution of the virus in a specific population or region, identify new subtypes or epidemic recombinant types, and develop diagnostic reagents and vaccines.

[0028] Compared with the prior art, the present invention has the following beneficial effects: The present invention designs a new universal primer set for targeted amplification of dengue virus type I genome, which can perform targeted amplification of dengue virus type I genome to obtain dengue virus type I genome. The method provided by the present invention can amplify all dengue virus type I subtypes, has high genome coverage, high throughput, low cost, and simple sequence splicing. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Sequencing read length distribution.

[0030] Figure 2 Phylogenetic tree analysis. DETAILED DESCRIPTION

[0031] It is worth noting that the raw materials used in the present invention are all common commercially available products, and their sources are not specifically limited.

[0032] Example 1: Extraction of sample RNA RNA was extracted from clinical serum samples of patients with dengue virus type I using the QIAamp Viral RNA Minikit (Shanghai Qiagen, Cat. No. 52904) according to the kit instructions.

[0033] Example 2: Reverse transcription and PCR amplification 1) LunaScript™ RT SuperMix Kit was used for reverse transcription and synthesis of cDNA. The configuration system is shown in Table 1.

[0034] Table 1 Reverse transcription reaction system

[0035] The reverse transcription reaction procedure is as follows: 25℃ 2min, 55℃ 10min, 95℃ 1min.

[0036] 2) Use Q5® Hot Start High-Fidelity 2X Master Mix for PCR amplification. The configuration system is shown in Table 2.

[0037] Table 2 PCR reaction system

[0038] The specific primer sequences and compositions of primer pool 1 and primer pool 2 are shown in Table 3.

[0039] Table 3 Description of primer sets

[0040] The reaction procedure is as follows: 98℃ 30sec; 35 cycles of 98℃ 15sec, 61℃ 2min, 65℃ 3min; keep warm at 4℃.

[0041] Example 3: PCR product purification Note: 1. Ampure XP Beads (Becman, Catalog No. A63880) need to be equilibrated at room temperature for more than 30 minutes in advance, and then fully mixed and resuspended before use; 2. 80% ethanol needs to be prepared and used immediately. Do not use reagents that have been stored for too long.

[0042] 1) Combine 25 μL of amplification products corresponding to primer pool 1 and primer pool 2 in Example 2 into a 1.5 mL Eppendorf EP tube; 2) Add 50 μL of resuspended Ampure XP Beads to each EP tube and mix the beads and sample thoroughly by flicking the EP tube; 3) Incubate at room temperature for 5 min in a shaking incubator (Eppendorf, model ThermoMixer C); 4) Transfer the EP tube to the magnetic stand and let it stand for 2 minutes until the magnetic beads are attracted to one side of the magnetic stand or the mixed solution becomes clear; 5) Carefully discard the supernatant, taking care not to touch the magnetic beads; 6) Prepare 80% ethanol using nuclease-free water (Bao Bio, Cat. No. 9012). Prepare 500 μL of ethanol per sample. Add 200 μL of the prepared 80% ethanol. Be careful not to blow away the magnetic beads. After rotating the EP tube or letting it stand for a while, carefully remove and discard the ethanol. Be careful not to touch the magnetic beads during the operation. 7) Repeat the cleaning step; 8) Split the sample on a magnetic rack until the magnetic beads are completely adsorbed on one side. Use a pipette to carefully discard the remaining liquid, avoiding contact with the magnetic beads. 9) Open the EP tube cover and let it stand for 30s-60s. Do not over-dry. 10) Resuspend the precipitated magnetic beads in 15 μL of nuclease-free water, flick to mix, incubate at room temperature for 5 min, centrifuge, and place on a magnetic rack until the magnetic beads are attracted to one side of the magnetic rack or the mixture becomes clear; 11) Transfer the supernatant to a clean 1.5 mL EP tube, making sure no magnetic beads are transferred to the tube; 12) Take 1 μL of sample and use Qubit fluorometer (Thermo, model Qubit2.0) to quantify DNA concentration. If the sample in this step needs to be stored, store it in a -20℃ refrigerator for subsequent experiments.

[0043] Example 4: End repair 200 ng of the purified product of each sample was used to prepare the reaction solution according to Table 4, and the end repair was performed using the NEBNext End repair Module / NEBNext dA-tailing Module kit.

[0044] Table 4 End repair reaction system

[0045] Incubate at 20°C for 20 min, 65°C for 10 min, and 4°C for at least 1 min.

[0046] Example 5: Barcode connection This example uses the NEB Blunt / TA Ligase Master Mix kit and its instructions.

[0047] 1) Select the corresponding barcode for each sample as the basis for sample identification. A maximum of 24 barcodes can be added at the same time. The configuration of the barcode connection reaction system is shown in Table 5. Mix the reagents by flicking your finger. Use a PCR instrument and incubate at 20℃ for 20min, 65℃ for 10min, and 4℃ for at least 1min. Table 5 Barcode ligation reaction system

[0048] 2) Add 2 μL EDTA to each reaction tube and mix thoroughly to terminate the reaction; 3) Pool all incubated samples into a new 1.5mL Eppendorf DNA LoBind tube and calculate the total volume (Note: for example, for 24 samples, the total volume = 20*24 = 480μL); 4) Add 192 μL AMPure XP beads to 480 μL barcoded sample, flick to mix, and incubate at room temperature for 5 min on a shaking incubator (Note: the ratio of magnetic beads is 0.4×, 192 μL is the total amount required for 24 samples, please calculate the amount of other samples yourself); 5) The cleaning step refers to the product purification step in Example 3, and the sample is dissolved using 35 μL of nuclease-free water.

[0049] 6) Take 1 μL of sample and use Qubit fluorometer to quantify the eluted sample. The target recovery concentration is about 5 ng / μL.

[0050] Example 6: Sequencing Adapter Ligation & Purification This example uses the NEBNext Quick Ligation Module kit.

[0051] 1) Reagent preparation: Thaw SB and SFB at room temperature, vortex and spin, and place on ice for later use. Check whether there is any precipitate in each tube of reagent. Take out AL buffer and dissolve at room temperature, flick to mix AL Ligase and sequencing connector Native Adapter (NA), spin, and place on ice for later use; 2) Take the mixed barcode DNA and connect the Native Adapter (NA) according to the reagents shown in Table 6. Mix the reagents by flicking gently. Do not vortex or pipette. Table 6 Linker ligation reaction system

[0052] 3) Mix the sample and centrifuge immediately, then incubate at room temperature for 20 minutes; 4) Before using AMPure XP beads, be sure to vortex and mix thoroughly. Add 20 μL of resuspended AMPure XP beads to the sample, flick to mix thoroughly, and incubate at room temperature for 10 minutes on a shaking incubator. 5) Separate the incubated sample tubes and place them on a magnetic rack until all the magnetic beads are adsorbed to one side of the magnetic rack and the solution is clear and colorless. Aspirate the supernatant, being careful not to touch the magnetic beads. 6) Add 125 μL Short Fragment Buffer (SFB), flick the sample to mix, centrifuge briefly and place on a magnetic rack. When the magnetic beads are completely adsorbed to one side of the magnetic rack and the solution is clear, remove the supernatant. 7) Repeat the previous step; 8) Place the sample in a centrifuge and spin it briefly, then put the EP tube back on the magnetic rack. Use a pipette to suck out the remaining liquid; 9) Remove the samples from the magnetic rack and resuspend each sample in 15 μL Elution Buffer (EB). Incubate at room temperature for 5 minutes; 10) Place the EP tube back on the magnetic rack until the eluent becomes clear and colorless; 11) Aspirate 15 μL of the clear supernatant and transfer it to a new 1.5 mL EP tube; 12) Take 1 μL of sample and use Qubit fluorometer to quantify the eluted sample; 13) Place the prepared library on ice for later use.

[0053] Example 7: Library chip loading and sequencing start 1) This example uses the Oxford Nanopore sequencer M1Kc and its supporting reagents (including SQB, LB and EB, etc.) and instructions. The library is prepared according to Table 7, and about 40ng-50ng of the final prepared library is loaded into the chip.

[0054] Table 7 Composition of the on-machine library

[0055] 2) Add 30 μL Flush Tether (FLT) to a whole tube of Flush Buffer (FB) and mix well to prepare the library loading mixture.

[0056] 3) Open the sequencing chip SpotON sample to remove air bubbles, pipette 800μL of library loading mixture into the PrimingPort hole, and let it stand at room temperature for 5 minutes. Wash and blow to mix the sequencing library suspension, add it drop by drop into the SponON sample hole, and cover the SpotON sample hole and Priming Port hole.

[0057] 4) Install the chip into the sequencer card slot, connect the data cable to the computer and start the sequencing control software. Select the appropriate sequencing model, chip, reagent kit and other related information parameters from the menu and start sequencing.

[0058] Example 8: Sequence analysis and assembly The fast5 file generated by sequencing in Example 7 is used for base recognition by the Guppy software fast mode that comes with the device, and the current signal is converted into the corresponding base, while the adapter sequence and barcode sequence are removed. After base recognition, it is converted into FASTQ format. Bioinformatics analysis is used to filter sequences with a read length less than 200bp and longer than the reference genome (dengue virus type 1, Accession Number: NC_001477.1, length 10735bp); sequences with an average sequencing quality value of less than 8 are filtered. The sequencing read length distribution results are as follows: Figure 1 As shown, it can be seen that the sequencing read length is concentrated around 1200bp.

[0059] The filtered sequence was aligned to the reference genome and variants were detected, and finally a consensus sequence and VCF format file were generated. The sequencing coverage and sequencing depth of the genome were calculated based on the bam file of the alignment results. The average sequencing depth of the genome obtained by sequencing was 15428×, the coverage greater than 10× was 98.12%, and the length of the genome obtained was 10651bp. The genome sequence was submitted to NCBI for BLAST analysis. The results showed that the first 100 alignment results displayed were all dengue virus type I sequences and the similarity of the alignment results was 99.18%-98.02%, and the E-value was 0. Among them, the dengue virus type I gene sequence with Genbank accession number: PP563845.1 reached a similarity of 99.18%. Further phylogenetic tree analysis showed (see Figure 2 ), this strain (DV-1 20240826) was clustered in the same branch as the strains isolated from Foshan, Guangdong (PP563845, PP563847, PP563848), and all belonged to dengue virus type I genotype I.

[0060] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A primer set for amplifying the dengue virus type I genome, characterized in that: The primer set comprises the nucleic acid sequences shown as SEQ ID NO.1-20.

2. The primer set according to claim 1, characterized in that The primer set is divided into two primer pools, namely primer pool 1 and primer pool 2; the primer pool 1 is composed of the nucleic acid sequences shown in SEQ ID NO.1-10, and the primer pool 2 is composed of the nucleic acid sequences shown in SEQ ID NO.11-20.

3. A method for amplifying the genome of type I dengue virus, characterized in that: The method comprises using the primer set described in claim 1 to amplify the dengue virus type I genome.

4. The method according to claim 3, characterized in that The method comprises the following steps: S1. Obtaining RNA of dengue virus type I from a sample; S2, reverse transcription of RNA into cDNA; S3, using the cDNA as a template and using the primer set of claim 1 to perform amplification to obtain an amplified product; S4. After library construction, sequencing was performed and the sequencing data were analyzed to obtain the complete genome of dengue virus type I.

5. The method according to claim 4, characterized in that The sample in step S1 includes a body fluid sample, an artificial culture sample or a vector.

6. The method according to claim 4, characterized in that When the primer set according to claim 1 is used for amplification in step S3, the primer sets are grouped according to claim 2, and the primer pool 1 and the primer pool 2 are used for amplification respectively, and then the amplification products of the two groups are collected.

7. The method according to claim 4, characterized in that The library construction in step S4 includes PCR product purification, end repair, barcode connection and sequencing adapter connection & purification, and the sequencing is third-generation sequencing.

8. A kit for amplifying the genome of type I dengue virus, characterized in that: The kit comprises the primer set according to any one of claims 1 or 2.

9. The kit according to claim 8, characterized in that The kit further comprises a buffer, a reverse transcriptase or a DNA amplification enzyme.

10. Use of the primer set according to any one of claims 1 to 2 or the kit according to any one of claims 8 to 9 in amplifying the genome of type I dengue virus, characterized in that: The application is non-disease diagnosis or treatment application.

Images