Method for producing insulin-producing cells

Abstract

The present invention relates to methods and uses for producing insulin cells from pancreatic exocrine cells, comprising contacting the pancreatic exocrine cells with an EZH2 inhibitor. The invention also relates to methods and uses for preventing or treating diseases involving dysfunctional insulin production.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to Australian Provisional Application No. 2022901132 filed on April 29, 2022, the entire disclosure of which is incorporated herein by reference. Technical Field

[0003] The present invention relates to methods and uses for producing insulin-producing cells. The present invention also relates to methods and uses for preventing or treating diseases involving dysfunctional insulin production. Background Art

[0004] β cells (β-cells) are endocrine cell types found in the pancreatic islets that synthesize, store and release insulin. β cells usually account for about 50-70% of the cells in the human pancreatic islets. Type 1 diabetes (T1D) is an autoimmune disease that selectively destroys the β cells that produce insulin in the pancreas. Although symptoms usually do not appear before 80% of the β cell mass is destroyed, the absolute destruction of these cells leads to dependence on exogenous insulin administration for survival. Other types of diabetes such as type 2 diabetes (T2D) may also involve a lack of insulin during disease progression.

[0005] Current therapies for T1D diabetes focus on replacing damaged beta cell masses in diabetic patients, involving whole pancreas or pancreatic islet transplantation. Despite proven clinical utility, these therapies face a real shortage of organ donors and the associated side effects of immunosuppressive drugs. Therefore, current research focuses on beta cell replacement, which is an unmet need for diabetic patients. Given that human pluripotent stem cells (hPSCs), such as human embryonic stem cells (hESCs), have the ability to proliferate indefinitely and differentiate into many cell types, including beta cells, studies have investigated the generation of beta cells from these stem cells. However, human embryonic stem cells are not an ideal cell source due to the practical and ethical barriers surrounding their use.

[0006] Therefore, there is a need for new or improved therapies that can be used to treat or prevent diseases involving dysfunctional insulin production, such as diabetes, in particular T1D.

[0007] The reference to any prior art in the specification is not an acknowledgement or implication that the prior art forms part of the common general knowledge in any jurisdiction, or that the prior art could reasonably be expected by a person skilled in the art to be understood, considered relevant and / or combined with other prior art. Summary of the invention

[0008] The present invention provides a method for producing insulin-producing cells from pancreatic exocrine cells, the method comprising:

[0009] - contacting a pancreatic exocrine cell or a cell population comprising pancreatic exocrine cells with an EZH2 inhibitor for a sufficient period of time and under conditions to allow generation of insulin-producing cells from said pancreatic exocrine cells,

[0010] Thereby, insulin-producing cells or a cell population comprising insulin-producing cells are produced.

[0011] In any aspect of the invention, the insulin-producing cells may be characterized by increased expression of one or more pancreatic progenitor cell markers relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor. In a preferred embodiment, the one or more pancreatic progenitor cell markers are selected from Pdx1, Ngn3, Sox9 and Sox11.

[0012] In any aspect of the invention, the insulin-producing cells may be characterized by increased expression of one or more beta cell markers relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor. In a preferred embodiment, the one or more beta cell markers are selected from Nkx6.1, MafA, Ins hnRNA and Ins.

[0013] In any aspect of the invention, the insulin-producing cells may be characterized by increased expression of one or more proliferation markers relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor. In a preferred embodiment, the proliferation marker is Ki67.

[0014] In some embodiments, the insulin-producing cells are characterized by increased expression of one, two, three, four, five, six, seven, or all eight of Pdx1, Ngn3, Sox9, Sox11, Nkx6.1, MafA, Ins, Ins hnRNA, and Ki67 relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor.

[0015] In any aspect of the invention, the insulin-producing cells may be characterized by no change in the expression of one or more of the following: one or more ductal markers; one or more acinar markers; and one or more glucose sensor markers. In some embodiments, the ductal marker is Ck19. In some embodiments, the acinar marker is Amy2A. In some embodiments, the glucose sensor marker is Txnip.

[0016] Preferably, the insulin-producing cells are capable of secreting insulin when stimulated with glucose. In some embodiments, the insulin-producing cells are capable of repeated glucose-stimulated insulin secretion (GSIS).

[0017] In any aspect of the invention, the insulin-producing cell may be a β cell or a β cell-like cell.

[0018] In any aspect of the invention, the pancreatic exocrine cell can be an acinar cell or a ductal cell. In some embodiments, the pancreatic exocrine cell is a ductal cell. In one embodiment, the ductal cell is a ductal epithelial cell (e.g., a pancreatic ductal epithelial cell).

[0019] In any aspect of the invention, the cell group comprising pancreatic exocrine cells may include or consist of one or both of acinar cells and ductal cells (e.g., ductal epithelial cells). In some embodiments, the cell group comprises ductal cells or consists of ductal cells. In some embodiments, the cell group does not include embryonic pluripotent stem cells. In one embodiment, the cell group does not include any induced pluripotent stem cells (iPSC) or does not include any cells derived from iPSC.

[0020] In any aspect of the invention, the pancreatic exocrine cells or the cell population comprising the pancreatic exocrine cells can be obtained from pancreatic tissue. In some embodiments, the pancreatic tissue comprises or consists of pancreatic exocrine cells. In some embodiments, the pancreatic tissue comprises or consists of mature terminally differentiated pancreatic cells. In some embodiments, the pancreatic tissue does not comprise embryonic pluripotent stem cells.

[0021] In any aspect of the invention, the EZH2 inhibitor can directly inhibit the enzymatic activity of EZH2. In some embodiments, the EZH2 inhibitor occupies the site of the co-substrate S-adenosylmethionine (SAM) in the binding pocket of EZH2. The EZH2 inhibitor can be any EZH2 inhibitor as described herein.

[0022] In some embodiments, the EZH2 inhibitor is a compound having the following structure:

[0023]

[0024] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0025] In some embodiments, the EZH2 inhibitor is a compound of formula (I):

[0026]

[0027] in

[0028] X and Z are independently selected from the group consisting of hydrogen, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, unsubstituted or substituted (C3-C8)cycloalkyl, unsubstituted or substituted (C3-C8)cycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl-(C1-C8)alkyl or -(C2-C8)alkenyl, (C6-C8)cycloalkenyl, 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl or -(C2-C8)alkenyl, halo, cyano, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, NR a R b NR a C(O)R b NR a C(O)NR a R b 、-NR a C(O)OR a 、-NR a S02R b NR a SO2NR a R b NR a NR a R b NR a NR a C(O)R b 、-NR a NR a C(O)NR a R b 、-NR a NR a C(O)OR a 、-OR a、-OC(O)R a and -OC(O)NR a R b ;

[0029] Y is H or halo;

[0030] R 1 is (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, unsubstituted or substituted (C3-C8)cycloalkyl, unsubstituted or substituted (C3-C8)cycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C6-C 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl or -(C2-C8)alkenyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl or -(C2-C8)alkenyl, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b ;

[0031] R 2 is hydrogen, (C1-C8)alkyl, trifluoromethyl, alkoxy or halo, wherein the (C1-C8)alkyl may be substituted by one to two groups selected from the group consisting of amino and (C1-C3)alkylamino;

[0032] R 7 is hydrogen, (C1-C3) alkyl or alkoxy; R 3 is hydrogen, (C1-C8) alkyl, cyano, trifluoromethyl, -NR a R b or halogen;

[0033] R 6is selected from the group consisting of hydrogen, halogen, (C1-C8) alkyl, (C2-C8) alkenyl, -B(OH)2, substituted or unsubstituted (C2-C8) alkynyl, unsubstituted or substituted (C3-C8) cycloalkyl, unsubstituted or substituted (C3-C8) cycloalkyl-(C1-C8) alkyl, unsubstituted or substituted (C5-Cg) cycloalkenyl, unsubstituted or substituted (C5-C8) cycloalkenyl-(C1-C8) alkyl, (C6-C 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl, cyano, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, -NR a R b 、-NR a C(O)R b NR a C(O)NR a R b NR a C(O)OR a NR a S02R b NR a SO2NR a R b 、-NR a NR a R b 、-NR a NR a C(O)R b 、-NR a NR a C(O)NR a R b NR a NR a C(O)OR a 、-OR a 、-OC(O)R a 、-OC(O)NR a Rb ;

[0034] wherein any (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, cycloalkyl, cycloalkenyl, bicycloalkyl, heterocycloalkyl, aryl or heteroaryl is optionally substituted by 1, 2 or 3 groups independently selected from the group consisting of: -O(C1-C6)alkyl (R c ) 1-2 、-S(C1-C6)alkyl(R c ) 1-2 、-(C1-C6)alkyl(R c ) 1-2 , (C1-C8) alkyl-heterocycloalkyl, (C3-C8) cycloalkyl-heterocycloalkyl, halo, (C1-C6) alkyl, (C3-C8) cycloalkyl, (C5-C8) cycloalkenyl, (C1-C6) haloalkyl, cyano, -COR a 、-CO2R a 、-CONR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, -NR a R b NR a C(O)R b 、-NR a C(O)NR a R b 、-NR a C(O)OR a NR a S02R b NR a SO2NR a R b 、-OR a 、-OC(O)R a 、-OC(O)NR a R b , heterocycloalkyl, aryl, heteroaryl, aryl(C1-C4)alkyl and heteroaryl(C1-C4)alkyl;

[0035] wherein any aryl or heteroaryl portion of the aryl, heteroaryl, aryl(C1-C4)alkyl or heteroaryl(C1-C4)alkyl is optionally substituted with 1, 2 or 3 groups independently selected from the group consisting of halo, (C1-C6)alkyl, (C3-C8)cycloalkyl, (C5-C8)cycloalkenyl, (C1-C6)haloalkyl, cyano, -COR a、-CO2R a 、-CONR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, NR a R b NR a C(O)R b NR a C(O)NR a R b NR a C(O)OR a 、-NR a S02R b NR a SO2NR a R b 、-OR a 、-OC(O)R a and -OC(O)NR a R b ;

[0036] Each R° is independently (C1-C4)alkylamino, -NR a S02R b 、-SOR a 、-SO2R a 、-NR a C(O)OR a 、-NR a R b or -CO2R a ;

[0037] R a and R b are each independently hydrogen, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, (C3-C8)cycloalkyl, (C5-C8)cycloalkenyl, (C6-C 10)bicycloalkyl, heterocycloalkyl, aryl, heteroaryl, wherein the (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, cycloalkyl, cycloalkenyl, bicycloalkyl, heterocycloalkyl, aryl or heteroaryl is optionally substituted with 1, 2 or 3 groups independently selected from the group consisting of halo, hydroxy, (C1-C4)alkoxy, amino, (C1-C4)alkylamino, ((C1-C4)alkyl)((C1-C4)alkyl)amino, -CO2H, -CO2(C1-C4)alkyl, -CONH2, -CONH(C1-C4)alkyl, -CON((C1-C4)alkyl)((C1-C4)alkyl), -SO2(C1-C4)alkyl, -SO2NH2, -SO2NH(C1-C4)alkyl or -SO2N((C1-C4)alkyl)((C1-C4)alkyl);

[0038] or R a and R b together with the nitrogen to which they are attached represent a 5-8 membered saturated or unsaturated ring, optionally containing additional heteroatoms selected from oxygen, nitrogen and sulfur, wherein the ring is optionally substituted by 1, 2 or 3 groups independently selected from (C1-C4)alkyl, (C1-C4)haloalkyl, amino, (C1-C4)alkylamino, ((C1-C4)alkyl)((C1-C4)alkyl)amino, hydroxy, oxo, (C1-C4)alkoxy and (C1-C4)alkoxy(C1-C4)alkyl, wherein the ring is optionally fused to a (C3-C8)cycloalkyl, heterocycloalkyl, aryl or heteroaryl ring;

[0039] or R a and R b Together with the nitrogen to which they are attached represent a 6- to 10-membered bridged bicyclic ring system optionally fused to a (C3-C8)cycloalkyl, heterocycloalkyl, aryl or heteroaryl ring;

[0040] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0041] In some embodiments, the compound of formula (I) is a compound having the following structure:

[0042]

[0043] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0044] In some embodiments, the EZH2 inhibitor is a compound having the following structure:

[0045]

[0046] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0047] In some embodiments, the EZH2 inhibitor is a compound having the following structure:

[0048]

[0049] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0050] In some embodiments, the EZH2 inhibitor is a compound having the following structure:

[0051]

[0052] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0053] In some embodiments, the EZH2 inhibitor is a compound having the following structure:

[0054]

[0055] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0056] In some embodiments, the EZH2 inhibitor is a compound having the following structure:

[0057]

[0058] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0059] In some embodiments, the EZH2 inhibitor is a compound having the following structure:

[0060]

[0061] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0062] In a preferred embodiment, the EZH2 inhibitor is selected from one of the following:

[0063]

[0064]

[0065]

[0066] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0067] The method may further comprise the step of administering the insulin-producing cells or the cell population comprising the insulin-producing cells to an individual. In some embodiments, the pancreatic exocrine cells that produce the insulin-producing cells are obtained from the individual. In some embodiments, the individual suffers from diabetes or is prediabetic. In some embodiments, the diabetes is selected from type 1 diabetes, type 2 diabetes, and gestational diabetes.

[0068] In another aspect, the present invention provides an insulin-producing cell or a cell population comprising insulin-producing cells produced by a method as described herein.

[0069] In another aspect, the present invention provides the use of an EZH2 inhibitor for generating insulin-producing cells from pancreatic exocrine cells.

[0070] In another aspect, the present invention provides use of an EZH2 inhibitor in the preparation of a composition for producing insulin-producing cells from pancreatic exocrine cells.

[0071] In another aspect, the present invention provides an EZH2 inhibitor for use in generating insulin-producing cells from pancreatic exocrine cells.

[0072] In another aspect, the present invention provides a method for preventing or treating a disease involving dysfunctional insulin production, the method comprising:

[0073] - administering to an individual in need thereof an insulin-producing cell or a cell population comprising insulin-producing cells as described herein or produced by a method as described herein,

[0074] Thereby preventing or treating the disease.

[0075] In another aspect, the present invention provides a method for preventing or treating a disease involving dysfunctional insulin production in an individual in need thereof, the method comprising:

[0076] - obtaining pancreatic exocrine cells or a cell population comprising pancreatic exocrine cells from pancreatic tissue of an individual,

[0077] - contacting the pancreatic exocrine cells or the cell population comprising pancreatic exocrine cells with an EZH2 inhibitor for a sufficient time and under conditions to allow generation of insulin-producing cells from the pancreatic exocrine cells, thereby generating insulin-producing cells or a cell population comprising insulin-producing cells, and

[0078] - administering said insulin-producing cells or said cell population comprising insulin-producing cells to said individual,

[0079] Thereby preventing or treating the disease.

[0080] In another aspect, the present invention provides the use of an insulin-producing cell or a cell population comprising insulin-producing cells as described herein or produced by a method as described herein, for the preparation of a composition for preventing or treating a disease involving dysfunctional insulin production in an individual.

[0081] In another aspect, the present invention provides an insulin-producing cell or a cell population comprising insulin-producing cells as described herein or produced by a method as described herein for use in preventing or treating a disease involving dysfunctional insulin production in an individual.

[0082] The disease involving dysfunctional insulin production may be selected from diabetes and prediabetes. In some embodiments, the diabetes is selected from type 1 diabetes, type 2 diabetes and gestational diabetes.

[0083] Said pancreatic exocrine cells from which said insulin-producing cells are derived may be derived from pancreatic tissue obtained from said individual.

[0084] The insulin-producing cells or the population of cells comprising the insulin-producing cells may be delivered to the pancreas of the individual.

[0085] In another aspect, the present invention provides a method for preventing or treating a disease involving dysfunctional insulin production, the method comprising:

[0086] - administering an EZH2 inhibitor to an individual in need thereof such that the EZH2 inhibitor is in contact with pancreatic exocrine cells of the individual for a sufficient period of time and under conditions to allow the generation of insulin-producing cells from the pancreatic exocrine cells,

[0087] Thereby preventing or treating the disease in the individual.

[0088] In another aspect, the invention provides use of an EZH2 inhibitor in the preparation of a composition for preventing or treating a disease involving dysfunctional insulin production in an individual, wherein the EZH2 inhibitor is contacted with pancreatic exocrine cells of the individual for a sufficient period of time and under conditions to allow for the generation of insulin-producing cells from the pancreatic exocrine cells.

[0089] In another aspect, the invention provides an EZH2 inhibitor for use in preventing or treating a disease involving dysfunctional insulin production in an individual, wherein the EZH2 inhibitor is contacted with pancreatic exocrine cells of the individual for a sufficient period of time and under conditions to allow for the generation of insulin-producing cells from the pancreatic exocrine cells.

[0090] In any aspect or embodiment, the disease involving dysfunctional insulin production may be selected from diabetes and prediabetes. In some embodiments, the diabetes is selected from type 1 diabetes, type 2 diabetes and gestational diabetes.

[0091] In any aspect or embodiment, the EZH2 inhibitor may be any EZH2 inhibitor as described herein.

[0092] In any aspect or embodiment, the EZH2 inhibitor may be administered orally to the individual.

[0093] As used herein, the term "comprise" and variations of the term, such as "comprising," "comprises," and "comprised," are not intended to exclude other additives, components, integers or steps, unless the context requires otherwise.

[0094] Further aspects of the invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description given by way of example and with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] Figure 1 (a) Representative immunohistochemical insulin and glucagon staining in non-diabetic (ND) donors and type 1 diabetic (T1D) donors. Insulin and glucagon expression is indicated by dark grey staining in human islets. Note the complete absence of insulin in T1D donors; (b) Schematic organization of exocrine and endocrine compartments in the human pancreas characterized by ductal epithelial cells, which are hypothesized to contain progenitor cells capable of regeneration upon exposure to EZH2 inhibitors (EZH2i).

[0096] Figure 2.Distinguishable expression of embryonic and β-cell mRNA indicators with naive pancreatic exocrine cells isolated from donors. (a) Expression analysis in naive exocrine cells showing the relative abundance of Ins, Pdx1, Ngn3, Sox9, Sox11, Txnip, Ck19, and Amy2A mRNAs relative to 18s assessed by qRT-PCR. Relative expression of mRNAs isolated from non-diabetic (nd) and type 1 diabetic (T1D) donors. (b) Correlation of Ins, Pdx1, Ngn3, Sox9, Sox11, Txnip, Ck19, and Amy2A expression shown as a function of fold change. Expression analysis of mRNAs isolated from non-diabetic (nd) and type 1 diabetic (T1D) donors. Non-diabetic donor 1 (nd1) is depicted as a hashed bar, nd donor 2 (nd2) is depicted as an unfilled bar, and T1D donors are depicted as a filled bar.

[0097] Figure 3 Pharmacological inhibition of EZH2 activity by GSK126 reduces H3K27me3 but not H3K27ac protein levels. (a) Dose-dependent increase in GSK126 attenuates H3K27me3 in human pancreatic ductal epithelial cells. Bar graphs represent signal ratios of H3K27me3 proteins adjusted for histone H3 quantified by Li-COR Odyssey. Vehicle control is DMSO. (b) Dose-dependent increase in GSK126 does not attenuate H3K27ac in human pancreatic ductal epithelial cells.

[0098] Figure 4 GSK126 restored the expression of islet markers in non-diabetic and type 1 diabetic pancreatic exocrine cells. Correlation of mRNA abundance of Ngn3, Sox9, Sox11, Ins, Pdx1, Ck19, Amy2A, Txnip, Mafa, Nkx6.1, Igf2, and Igf2AS is shown as fold change by qRT-PCR. No significant changes in mRNA abundance of ductal markers (Ck19), acinar markers (Amy2A), and glucose sensors (Txnip) were detected. Student t-test was performed for control and GSK126 (*P<0.05, **P<0.01, ***P<0.001, ***P<0.0001 Error bars are SEM, n=3).

[0099] Figure 5.GSK126 affects the recalcitrant H3K27me3 content on the insulin chromatin domain in human non-diabetic exocrine cells. (a) The insulin domain was evaluated using an amplicon specifically designed to distinguish the promoter region (R) of the Ins and Igf2AS genes. (b) Quantitative PCR analysis of DNA in chromatin (ChIP) immunoprecipitated with anti-H3K27me3 antibodies. The vehicle control was DMSO. (c) DNA was evaluated using an amplicon specifically recognizing the promoter region (R) of the Ngn3 and Pdx1 genes. (d) Quantitative PCR analysis of DNA in ChIP using anti-H3K27me3 antibodies. The vehicle control was DMSO. Control samples are depicted as filled bars and GSK126 samples are depicted as unfilled bars. Data are expressed as the average input signal relative to specific H3K27me3 abundance. Student's t test was performed on the control and GSK126 (*P<0.05, **P<0.01 Error bars are SEM, n=2).

[0100] Figure 6 Schematic representation of pancreatic progenitor differentiation and the recalcitrant influence of H3K27me3 content on insulin chromatin domains in human exocrine cells. (a) Organization of the human endocrine and exocrine pancreas showing the main pancreatic ductal tree connecting the acinar bundles. (b) The inability to influence transcriptional expression in both the exocrine and endocrine pancreas is consistent with EZH2-dependent H3K27me3-mediated default transcriptional repression. Conversion of the default repressed state is affected by pharmacological inhibition of EZH2 by GSK126 to trigger β-cell lineage regeneration and restore insulin expression. (c) Proposed model for the Ins chromatin domain in pancreatic cells. Default transcriptional repression is characterized by regions enriched in H3K27me3 that can influence chromatin conformation and repress expression of the Ins, Igf2AS, and Ins-Igf2 genes as postulated by long-range chromatin looping.

[0101] Figure 7 Ursolic acid and GSK126 affect the expression of beta-cell and progenitor cell markers in human pancreatic ductal epithelial cells outside the islets of Langerhans. Correlation of mRNA abundance of insulin, Pdx1, and Ngn3 is shown as fold change by qRT-PCR.

[0102] Figure 8 Effects of GSK126, CPI-1205 (CPI), ursolic acid (UA), GSK343, and EPZ-6438 (EPZ) on the mRNA expression of insulin (depicted as hashed bars), Pdx1 (depicted as unfilled bars), and Ngn3 (depicted as filled bars) in acinar and ductal (AD) cells from non-diabetic donors. Drug treatment for 48 hours: GSK126 10 μM, CPI 5 μM, UA 5 μM, GSK343 ​​5 μM, and EPZ 5 μM.

[0103] Fig. 9 Effects of GSK126 and ursolic acid (UA) on mRNA expression of insulin (depicted as hashed bars), Pdx1 (depicted as unfilled bars), and Ngn3 (not depicted; no amplification) in acinar and ductal (AD) cells from marmoset donors. Drug treatment for 48 hours: GSK126 10 μM and UA 5 μM.

[0104] Fig.10 Key markers of endocrine development, epithelial-to-mesenchymal transition, pancreatic ducts, and islets are altered in human pancreatic ductal cells after stimulation with an EZH2 inhibitor. Data represent control, GSK126, EPZ6438, and triptolide from left to right, respectively. Changes in mRNA transcripts for (A) neurogenin 3 [NGN3], (B) pancreatic duodenal homeobox factor 1 [PDX1], (C) SRY-box transcription factor 9 [SOX9], (D) alpha amylase [AMY2A], (E) cytokeratin 19 [CK19], (F) insulin heterologous nuclear RNA [INS hnRNA], (G) insulin [INS], and (H) V-maf myofascial fibrosarcoma oncogene homolog A [MAFA] after 2 and 7 days of stimulation with 10 μM GSK-126, 1 μM EPZ6438, and 20 nM triptolide. Data are shown as mean fold change ± SEM of 3 replicates, calculated by normalizing drug values ​​to DMSO (vehicle treated) controls. Statistically significant changes in expression were determined using Student's t test to compare control values ​​to each drug, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0105] Fig.11. Stimulation with EZH2 inhibitors reduces H3K27me3 levels in human pancreatic ductal epithelial cells. (A) Histones were extracted from pancreatic ductal cells stimulated with EZH2 inhibitors and control cells using 5M sulfuric acid. Acid-precipitated (ppt) histones were separated on Nu-Page gels and then immunoblotted to quantify total H3 and H2K27me3 levels using Li-CoR Odyssey. (B) Representative Western blots of H3K27me3 and H3K27ac relative to total H3 after 2 and 7 days of stimulation with 10μM GSK126, 1μM EPZ6438, 20nM triptolide compared to vehicle control DMSO. (C) Quantitative analysis of H3K27ac and (D) H3K27me3 relative to total H3 after stimulation with 10 μM GSK126, 1 μM EPZ6438, 20 nM triptolide for 2 and 7 days compared to the vehicle control DMSO. Data are shown as the average signal ratio of H3K27me3 to total H3 ± SEM of 3 replicates of the above representative blots. Each dot plot represents the signal ratio of H3K27ac from an independent replicate. Each triangle plot represents the signal ratio of H3K27me3 from an independent replicate. Statistically significant differences were determined relative to the control using the Student t test. *P<0.05, **P<0.01.

[0106] Fig.12 .After inhibiting EZH2, the H3K27me3 content associated with DNA chromatin in the promoter regions of INS-IGF2, NGN3 and PDX1 was reduced. (a) H3K27me3 content was assessed by using amplicons (black bars for DNA regions corresponding to the promoters of INS, NGN3 and PDX1). Compared with the vehicle control, quantitative PCR analysis of H3K27me3-related DNA was performed using ChIP after stimulating human pancreatic ductal epithelial cells (b) for 2 days and (c) for 7 days. Data are shown as the average input signal ± SEM relative to H3K27me3 abundance for 3 replicates. Each triangle graph represents a technical replicate. Statistically significant differences were determined relative to the control using the Student t test. *P<0.05, **P<0.01, ***P<0.001. Compared with the vehicle control, quantitative PCR analysis of H3K9 / 14ac-related DNA was performed using ChIP after stimulating human pancreatic ductal epithelial cells (D) for 2 days and (E) for 7 days. Data are shown as the average input signal ± SEM of 3 replicates relative to H3K9 / 14ac abundance. Each dot plot represents a technical replicate. Statistically significant differences were determined relative to the control using the Student t test. The graphical data from left to right correspond to the control, GSK126, EPZ6438, and triptolide, respectively.

[0107] Fig.13 .EZH2 inhibitors affect glucose-sensitive insulin secretion in human pancreatic ductal cells. (a) Gene expression of chromatin regulators EZH2, P300, KAT2, and BRG1 was unchanged in non-inhibitor treated cells after exposure to high glucose (HG) compared to non-exposed (LG) cells. Data are presented as mean ± SEM of fold change for 2 replicates, calculated by normalizing high glucose values ​​to low glucose (non-exposed) controls. Statistically significant changes in expression were determined using Student's t-test. (b) Representative Western blots and quantitative analysis of EZH2 and H3K27me3 after exposure to high glucose (HG) compared to low glucose (LG). Data are shown as mean signal ratios ± SEM of EZH2 to β-actin or H3K27me3 to total H3 for 2 replicates with the above representative blots. Each dot plot represents the signal ratio of one independent replicate. Statistically significant differences were determined relative to controls using Student's t-test. (c) 2-day and 7-day protocols for evaluating glucose-stimulated insulin secretion from HPDE cells treated with EZH2 inhibitors (EZH2i). Both protocols start with inoculating cells to establish cultures. EZH2i stimulation for 2 days was performed in CMRL to decompose background insulin, while for 7-day stimulation, the initial EZH2i dose was delivered in normal growth medium, followed by switching to CMRL on the 6th day. On the last day of the protocol, cells were incubated in low glucose for 1 hour and then incubated in high glucose for 1 hour. Supernatants were collected for quantitative insulin secretion in ELISA. ELISA quantified (d) 2-day and (e) 7-day insulin secretion of HPDE cells after incubation for 1 hour in low (2.8mM-left / circle) and high (28mM-right / triangle) concentrations of glucose. Insulin concentrations were normalized to the control 2.8mM concentration to calculate the change multiple. Data are represented by the change multiple mean ± SEM of 3 repetitions. Solid circles represent a technical repetition of 2.8mM glucose supernatant. The triangle represents one technical replicate of the 28 mM glucose supernatant. Student t test was used to assess whether the changes in insulin secretion were statistically significant, *P < 0.05, **P < 0.01, ****P < 0.0001.

[0108] Fig.14.Figure demonstrating the lack of change in H3K9 / 14 acetylation (H3K9 / 14ac), demonstrating the specificity of EZH2i in modulating trimethylation signals in HPDE cells. Quantitative analysis of H3K9 / 14ac relative to total H3 after 2 and 7 days of stimulation with GSK126 (10 μM), EPZ6438 (1 μM), and triptolide (20 nM) compared to the vehicle control DMSO. Data are shown as the average signal ratio of H3K9 / 14ac to total H3 ± SEM for 3 replicates. Statistically significant differences were determined relative to controls using the Student t test. DETAILED DESCRIPTION

[0109] It should be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All these different combinations constitute various alternative aspects of the invention.

[0110] Reference will now be made in detail to certain embodiments of the present invention. Although the present invention will be described in conjunction with the embodiments, it should be understood that it is not intended to limit the present invention to those embodiments. On the contrary, the present invention is intended to cover all substitutions, modifications and equivalents that may be included within the scope of the present invention defined by the claims.

[0111] Those skilled in the art will recognize many methods and materials similar or equivalent to the methods and materials described herein that can be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described. It should be understood that the present invention disclosed and defined in this specification extends to all alternative combinations of two or more individual features mentioned or apparent from the text or drawings. All of these different combinations constitute various alternative aspects of the present invention.

[0112] All patents and publications mentioned herein are incorporated by reference in their entirety.

[0113] For the purpose of interpreting this specification, terms used in the singular form will also include the plural form and vice versa.

[0114] The inventors of this case have determined that functional insulin-producing cells can be generated by inhibiting EZH2 (enhancer of zeste homolog 2) in human pancreatic exocrine cells. Previous studies have shown that inhibiting EZH2 can allow differentiation and generation of beta cells from pluripotent stem cells. The inventors of this case have demonstrated for the first time that functional insulin-producing cells are generated from mature terminally differentiated pancreatic exocrine cells (including functionally impaired mature terminally differentiated pancreatic exocrine cells) from pancreatic tissue from non-diabetic and type 1 diabetic donors. As discussed and shown in the examples herein, stimulation of pancreatic exocrine cells with EZH2 inhibitors increases the expression of core beta cell determinants, including insulin transcription. The results described herein include the first example of restoring exocrine transcription of insulin genes in exocrine cells derived from T1D donors lacking insulin. These findings support the use of exocrine cells from the pancreas as a source for generating functional insulin-producing cells.

[0115] Advantageously, the methods and uses described herein are independent of stem cells and do not require specific culture conditions to affect the production of beta cells from embryonic stem cells. In addition, contrary to the 3-4 months required for producing beta cells from embryonic stem cells, the methods and uses described herein can allow rapid production of insulin-producing cells (e.g., within 1-4 days). In addition, since the methods and uses described herein can allow the production of insulin-producing cells from the pancreatic exocrine cells of the individual itself, immunosuppressive therapy may not be required.

[0116] Insulin-producing cells

[0117] The present invention provides a method for producing insulin-producing cells from pancreatic exocrine cells, the method comprising: contacting pancreatic exocrine cells or a cell population comprising pancreatic exocrine cells with an EZH2 inhibitor for a sufficient time under conditions that allow the production of insulin-producing cells from pancreatic exocrine cells, thereby producing insulin-producing cells or a cell population comprising insulin-producing cells. As described herein and as shown in the examples, the methods and uses of the present invention can provide functional insulin-producing cells.

[0118] The present invention also provides the use of an EZH2 inhibitor for producing insulin-producing cells from pancreatic exocrine cells. The present invention also provides the use of an EZH2 inhibitor in the preparation of a composition for producing insulin-producing cells from pancreatic exocrine cells. The present invention also provides an EZH2 inhibitor for producing insulin-producing cells from pancreatic exocrine cells. Preferably, the EZH2 inhibitor is contacted with the pancreatic exocrine cells for a sufficient time under conditions that allow the production of insulin-producing cells from the pancreatic exocrine cells.

[0119] The insulin-producing cells or cell populations comprising insulin-producing cells produced by the method may be characterized by one or more of the following:

[0120] Relative to expression in pancreatic exocrine cells not exposed to EZH2 inhibitors,

[0121] - increased expression of one or more pancreatic progenitor cell markers, such as increased expression of any one or more of Pdx1, Ngn3, Sox9 and Sox11;

[0122] - increased expression of one or more beta cell markers, such as increased expression of any one or more of Nkx6.1, MafA, Ins hnRNA and Ins;

[0123] - increased expression of one or more proliferation genes, such as increased expression of Ki67;

[0124] - No change in the expression of one or more ductal markers, such as no change in the expression of CK19;

[0125] - no change in the expression of one or more acinar markers, such as no change in the expression of Amy2A; and

[0126] - No change in the expression of one or more glucose sensor markers, such as no change in the expression of Txnip.

[0127] In some embodiments, the insulin-producing cells or cell populations comprising insulin-producing cells produced by the methods are characterized by one or both of the following:

[0128] Relative to expression in pancreatic exocrine cells not exposed to EZH2 inhibitors,

[0129] - increased expression of any one or more of Pdx1, Ngn3, Sox9, Sox11, Nkx6.1, MafA, Ins, Ins hnRNA and Ki67; and

[0130] - There is no increase in the expression of any one or more of Ck19, Amy2A and Txnip.

[0131] Insulin-producing cells are preferably capable of secreting insulin when stimulated with glucose, i.e., capable of glucose-stimulated insulin secretion (GSIS). In some embodiments, insulin-producing cells are capable of repeated GSIS. GSIS can be assessed by methods known in the art, such as by treating cells with glucose at low (e.g., 2.5 mM) or high (e.g., 25 mM) concentrations and checking insulin release by ELISA (enzyme-linked immunosorbent assay).

[0132] The insulin-producing cells produced by the method may be β cells or β cell-like cells. As used herein, "β cell-like cells" is intended to encompass cells that exhibit one or more characteristics of insulin-producing cells as described herein.

[0133] Typically, conditions suitable for producing insulin-producing cells from exocrine pancreatic cells include culturing exocrine pancreatic cells for a sufficient time in a suitable culture medium. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 days. In some embodiments, exocrine pancreatic cells can be contacted with an EZH2 inhibitor for 1 to 30 days, preferably 1 to 14 days, more preferably 1 to 7 days, and even more preferably 1 to 4 days. In some embodiments, exocrine pancreatic cells can be contacted with an EZH2 inhibitor for about 2 days, or about 7 days, or about 2 days to about 7 days. In some embodiments, exocrine pancreatic cells can be contacted with an EZH2 inhibitor for 2 days, or 7 days, or from 2 days to 7 days. Advantageously, as shown in the examples, the methods and uses of the present invention allow rapid production of insulin-producing cells within 2 days after treatment with an EZH2 inhibitor. Any culture medium suitable for culturing pancreatic cells can be used. Examples of suitable culture medium include keratinocyte SFM (serum-free medium) and Miami / CMRL culture medium as described in the examples, and other suitable culture mediums in the art, such as RPMI culture medium (also referred to as Roswell Park Memorial Institute (Roswell ParkMemorialInstitute) (RPMI) 1640 culture medium). Advantageously, the methods and uses of the present invention do not require specific culture conditions to affect the production of insulin-producing cells, such as those culture conditions required for producing β-cells from embryonic stem cells.

[0134] The invention also provides insulin-producing cells produced by the methods described herein.

[0135] One or more or all of the steps of the methods described herein can be performed in vitro.

[0136] The present invention also provides a cell population comprising insulin-producing cells produced by the methods described herein. In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells are insulin-producing cells, and these cells are produced by the methods described herein.

[0137] The present invention also provides a composition comprising insulin-producing cells or a cell population comprising insulin-producing cells produced by the method described herein.

[0138] Exocrine pancreatic cells

[0139] Exocrine pancreatic cells are pancreatic cells that secrete digestive enzymes, water, and bicarbonate into the small intestine to aid digestion. The majority of the pancreas consists of the exocrine portion (about 85% by mass), which includes acinar and ductal tissue. As described herein and shown in the Examples, the methods and uses of the present invention are capable of providing functional insulin-producing cells from pancreatic exocrine cells.

[0140] In some embodiments, the pancreatic exocrine cells are acinar cells or ductal cells, preferably ductal cells.

[0141] Preferably, the pancreatic exocrine cells are mature (or adult) terminally differentiated pancreatic exocrine cells.Preferably, the pancreatic exocrine cells are not pluripotent stem cells, such as embryonic pluripotent stem cells.

[0142] In some embodiments, the cell group comprising pancreatic exocrine cells comprises one or both of acinar cells and ductal cells or consists of them.Herein, "consisting of ..." will be understood to imply that the cell group includes only one or both of acinar cells and ductal cells, but does not include other types of pancreatic cells (e.g., endocrine cells or islet cells).In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells in the cell group are one or both of acinar cells and ductal cells.In some embodiments, the cell group does not include endocrine cells (or islet cells).

[0143] In preferred embodiments, the cell population comprises ductal cells. In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells in the cell population are ductal cells. In some embodiments, the cell population consists of ductal cells. In this article, "consisting of..." will be understood to imply that the cell population only includes ductal cells and does not include other types of cells.

[0144] Preferably, the cell group comprises mature (or adult) terminally differentiated pancreatic cells. In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells in the cell group are mature terminally differentiated pancreatic cells. In some embodiments, the cell group is composed of mature terminally differentiated pancreatic cells. In this article, "consisting of ... " should be understood as implying that the cell group only includes mature terminally differentiated pancreatic cells, and does not include other types of cells (e.g., pluripotent stem cells, such as embryonic pluripotent stem cells). Preferably, the cell population does not comprise pluripotent stem cells, such as embryonic pluripotent stem cells.

[0145] Mature terminally differentiated pancreatic cells may include or consist of pancreatic exocrine cells. In this article, "consisting of" will be understood to imply that mature terminally differentiated pancreatic cells only include pancreatic exocrine cells, and do not include other types of cells (e.g., endocrine or islet cells). In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells in the cell population are mature terminally differentiated pancreatic exocrine cells.

[0146] The mature terminally differentiated pancreatic exocrine cells can be one or both of acinar cells and ductal cells. In some embodiments, the mature terminally differentiated pancreatic cells include ductal cells or are composed of ductal cells. In this article, "consisting of ... " will be understood to imply that mature terminally differentiated pancreatic cells only include ductal cells, and do not include other types of cells. In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells in the cell population are mature terminally differentiated ductal cells.

[0147] Pancreatic exocrine cells or a cell population comprising pancreatic exocrine cells may be obtained from any suitable source. In some embodiments, pancreatic exocrine cells or a cell population comprising pancreatic exocrine cells are obtained from pancreatic tissue.

[0148] Pancreatic tissue can be obtained from any suitable source. For example, pancreatic tissue can be obtained from a biopsy, surgery, or cadaver. The pancreatic tissue can be human pancreatic tissue or non-human pancreatic tissue, such as non-human primate pancreatic tissue. Advantageously, as shown in the Examples, treatment with an EZH2 inhibitor increases the expression of key β-cell determinants including insulin transcription in exocrine cells from human and marmoset pancreatic tissue samples.

[0149] Pancreatic tissue can include exocrine cells or be composed of exocrine cells.In some embodiments, pancreatic tissue includes one or both of acinar cells and ductal cells or is composed of it.Herein, "consisting of ... " will be understood as implying that pancreatic tissue only includes one or both of acinar cells and ductal cells, and does not include other types of pancreatic cells (e.g., endocrine cells or islet cells).In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells constituting pancreatic tissue are one or both of acinar cells and ductal cells. In some embodiments, the pancreatic tissue does not comprise endocrine cells (or pancreatic islet cells).

[0150] In preferred embodiments, pancreatic tissue comprises ductal cells. In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells constituting pancreatic tissue are ductal cells. In some embodiments, pancreatic tissue is composed of ductal cells. In this article, "consisting of ... " will be understood to imply that pancreatic tissue only includes ductal cells, and does not include cells of other types.

[0151] Preferably, pancreatic tissue comprises mature (or adult) terminally differentiated pancreatic cells. In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells constituting pancreatic tissue are mature terminally differentiated pancreatic cells. In some embodiments, pancreatic tissue is composed of mature terminally differentiated pancreatic cells. In this article, "consisting of ... " will be understood to imply that pancreatic tissue only includes mature terminally differentiated pancreatic cells, and does not include other types of cells (e.g., pluripotent stem cells, such as embryonic pluripotent stem cells). Preferably, the pancreatic tissue does not comprise pluripotent stem cells, such as embryonic pluripotent stem cells.

[0152] Mature terminally differentiated pancreatic cells may include or consist of pancreatic exocrine cells. In this article, "consisting of" will be understood to imply that mature terminally differentiated pancreatic cells only include pancreatic exocrine cells, and do not include other types of cells (e.g., endocrine or islet cells). In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells constituting pancreatic tissue are mature terminally differentiated pancreatic exocrine cells.

[0153] The mature terminally differentiated pancreatic exocrine cells can be one or both of acinar cells and ductal cells. In some embodiments, the mature terminally differentiated pancreatic cells include ductal cells or are composed of ductal cells. In this article, "consisting of ... " will be understood to imply that mature terminally differentiated pancreatic cells only include ductal cells, and do not include cells of other types. In some embodiments, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the cells in pancreatic tissue are mature terminally differentiated ductal cells.

[0154] EZH2 and EZH2 inhibitors

[0155] EZH2 (Enhancer of zeste homolog 2) is a histone-lysine N-methyltransferase involved in transcriptional repression. EZH2 is the functional catalytic subunit of PRC2 (Polycomb repressive complex 2) and catalyzes the methylation of histone 3 at Lys 27 (H3K27me3) using the cofactor S-adenosylmethionine (SAM).

[0156] As used herein, "inhibitors of EZH2" or "EZH2 inhibitors" are any molecules that inhibit EZH2 activity, such as completely or partially reducing one or more functions of EZH2 (including those described herein). The molecule can inhibit the enzymatic activity of EZH2, such as by binding to the active site, or competing with the enzyme substrate or co-effector or signal transduction mechanism. In some embodiments, the EZH2 inhibitor occupies (including partially or completely) the site of the co-substrate S-adenosylmethionine (SAM) in the binding pocket of EZH2. In some embodiments, the EZH2 inhibitor competes with SAM for binding to EZH2.

[0157] The EZH2 inhibitor may be specific for EZH2 and have only some low level inhibitory activity against other enzymes. For example, the EZH2 inhibitor may have a Ki for other enzymes greater than about 50 μM or 100 μM, preferably 1 mM, as measured using an assay as described herein, or have a Ki for other enzymes that is at least 10-fold greater than the Ki for EZH2.

[0158] In one embodiment, the EZH2 inhibitor is more than 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150-fold selective for EZH2 over EZHl.

[0159] Preferably, the EZH2 inhibitor is a molecule that limits the activity of EZH2 to 10% or less compared to a control. The control is the solvent in which the inhibitor is tested, which is used in the same amount, but does not contain the inhibitor. The enzymatic activity of EZH2 can be measured by 3 H]-SAM (tritiated SAM, S-adenosine-L-[methyl- 3H]methionine) by the 5-membered PRC2 complex (Flag-EZH2, EED, SUZ12, AEBP2, RbAp48) according to McCabe et al. (Nature, 2012, 492(7427), 108-112), Verma et al. (ACS Med. Chem. Lett. 2012, 3, 12, 1091-1096), Knutson et al. (Proc Natl Acad Sci USA, 2013 May 7; 110(19):7922-7), Vaswani et al. (J Med Chem, 2016, 59, 21, 9928-9941), Kung et al. (J Med Chem, 2016, 59, 21, 9928-9941), Chem, 2018 Feb 8;61(3):650-665), WO2011 / 140324 (US20130053397A1), WO2011 / 140325 (US20130053383A1), WO2012 / 142504 (US20120264734A1), WO2013 / 120104 (US20150011546A1), WO2015 / 193765 (US20150361067A1), or other methods described herein to detect tritiated histone products (histone N 6 -[methyl- 3 H]-L-lysine) to monitor.

[0160] The EZH2 inhibitor may exhibit a Ki value of less than 1 mM, preferably less than 100 μM, more preferably less than 10 μM, as determined by an assay as described herein, such as a methylation activity assay. In some embodiments, the EZH2 inhibitor exhibits a Ki value of equal to or less than about 1 mM, equal to or less than about 900 μM, equal to or less than about 800 μM, equal to or less than about 700 μM, equal to or less than about 600 μM, equal to or less than about 500 μM, equal to or less than about 400 μM, equal to or less than about 300 μM, equal to or less than about 200 μM, equal to or less than about 100 μM, equal to or less than about 90 μM, equal to or less than about 80 μM, equal to or less than about 70 μM, equal to or less than about 60 μM, equal to or less than about 50 μM, equal to or less than about 40 μM, equal to or less than about 300 μM, equal to or less than about 200 μM, equal to or less than about 100 μM, equal to or less than about 90 μM, equal to or less than about 80 μM, equal to or less than about 70 μM, equal to or less than about 60 μM, equal to or less than about 50 μM, equal to or less than about 40 μM, equal to or less than about 3 0 μM, about 20 μM or less, about 10 μM or less, about 1 μM or less, about 900 nM or less, about 800 nM or less, about 700 nM or less, about 600 nM or less, about 500 nM or less, about 400 nM or less, about 300 nM or less, about 250 nM or less, about 200 nM or less, about 150 nM or less, about 100 nM or less, about 50 nM or less, or about 10 nM or less, or any equivalent unit of measurement (e.g., mol / L) i The EZH2 inhibitor may exhibit a Ki value equal to or less than any value defined herein. For example, the EZH2 inhibitor may be EPZ-6438, which exhibits a K of about 2.5 nM. i , as determined by the methylation activity assay as described in Knutson et al. (Proc Natl Acad Sci USA, 2013 May 7;110(19):7922-7).

[0161] Additionally or alternatively, the EZH2 inhibitor may exhibit an IC of less than about 1 mM, preferably less than about 100 μM, more preferably less than about 10 μM. 50Values ​​as determined by an assay as described herein, e.g., a methylation activity assay. In some embodiments, the EZH2 inhibitor exhibits an activity equal to or less than about 1 mM, equal to or less than about 900 μM, equal to or less than about 800 μM, equal to or less than about 700 μM, equal to or less than about 600 μM, equal to or less than about 500 μM, equal to or less than about 400 μM, equal to or less than about 300 μM, equal to or less than about 200 μM, equal to or less than about 100 μM, equal to or less than about 90 μM, equal to or less than about 80 μM, equal to or less than about 70 μM, equal to or less than about 60 μM, equal to or less than about 50 μM, equal to or less than about 40 μM, equal to or less than about 30 , equal to or less than about 20 μM, equal to or less than about 10 μM, equal to or less than about 1 μM, equal to or less than about 900 nM, equal to or less than about 800 nM, equal to or less than about 700 nM, equal to or less than about 600 nM, equal to or less than about 500 nM, equal to or less than about 400 nM, equal to or less than about 300 nM, equal to or less than about 250 nM, equal to or less than about 200 nM, equal to or less than about 150 nM, equal to or less than about 100 nM, equal to or less than about 50 nM, or equal to or less than about 10 nM, or any equivalent unit of measurement (e.g., mol / L) 50 Value, as determined by an assay for methylation activity. An EZH2 inhibitor may exhibit an IC value equal to or less than any value defined herein. 50 For example, the EZH2 inhibitor may be one or more of the following: GSK126, which exhibits an IC of 9.9 nM 50 , as determined by the methylation activity assay described in McCabe et al. (Nature, 2012, 492(7427), 108-112); GSK343, which exhibited an IC of 4 nM 50 , as determined by the methylation activity assay described in Verma et al. (ACS Med. Chem. Lett. 2012, 3, 12, 1091-1096); EPZ-6438, which exhibited an IC of 2.5 nM 50 , as determined by the methylation activity assay described in Knutson et al. (Proc Natl Acad Sci USA, 2013 May 7; 110(19):7922-7); CPI-1205, which exhibited an IC of 2 nM 50 , as determined by the methylation activity assay as described in Vaswani et al. (J Med Chem, 2016, 59, 21, 9928-9941); and PF-06821497, which exhibited an IC of 4 nM 50, as determined by the methylation activity assay described in Kung et al. (J Med Chem, 2018 Feb 8;61(3):650-665).

[0162] The methylation activity assay may be any suitable assay known in the art. Examples of suitable methylation assays include [ 3 H]-SAM (tritiated SAM, S-adenosine-L-[methyl- 3 H]methionine) by detecting the tritiated histone product (histone N 6 -[methyl- 3 H]-L-lysine) to monitor the methylation of H3 (histone 3).

[0163] The EZH2 inhibitor can be any small molecule EZH2 inhibitor known in the art. The term "small molecule" generally refers to a low molecular weight compound and includes organic and inorganic compounds. Typically, a small molecule has a clear chemical formula of a single molecular weight. Preferably, the small molecule has a molecular weight of less than 3000 Daltons. More preferably, the small molecule has a molecular weight of less than 2000 Daltons. In some embodiments, the small molecule has a molecular weight of less than 1000 Daltons.

[0164] Duan et al. (Journal of Hematology & Oncology, Vol. 13, Article No.: 104 (2020)), Shahabipour et al. (Cancer Lett. 2017 Aug 1; 400: 325-335), Stazi et al. (Expert Opinion on Therapeutic Patents, 27:7,797-813, 2017), WO2011 / 140324 (US20130053397A1), WO2011 / 140325 (US20130053383A1), WO2012 / 142504 (US20120264734A1), WO2013 / 120104 (US20150011546A1) and WO2015 / 193765 (US20150361067A1) The EZH2 inhibitors described can be used in the present invention. These references are incorporated herein by reference in their entirety.

[0165] In some embodiments, the EZH2 inhibitor is ursolic acid, which has the following structure:

[0166]

[0167] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0168] In some embodiments, the EZH2 inhibitor is a compound of formula (I):

[0169]

[0170] in

[0171] X and Z are independently selected from the group consisting of hydrogen, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, unsubstituted or substituted (C3-C8)cycloalkyl, unsubstituted or substituted (C3-C8)cycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl-(C1-C8)alkyl or -(C2-C8)alkenyl, (C6-C8)cycloalkenyl, 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl or -(C2-C8)alkenyl, halo, cyano, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, NR a R b NR a C(O)R b NR a C(O)NR a R b 、-NR a C(O)OR a 、-NR a S02R b NR a SO2NR a R b NR a NR a R b NR a NR a C(O)Rb 、-NR a NR a C(O)NR a R b 、-NR a NR a C(O)OR a 、-OR a 、-OC(O)R a and -OC(O)NR a R b ;

[0172] Y is H or halo;

[0173] R 1 is (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, unsubstituted or substituted (C3-C8)cycloalkyl, unsubstituted or substituted (C3-C8)cycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C6-C 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl or -(C2-C8)alkenyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl or -(C2-C8)alkenyl, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b ;

[0174] R 2 is hydrogen, (C1-C8)alkyl, trifluoromethyl, alkoxy or halo, wherein the (C1-C8)alkyl may be substituted by one to two groups selected from the group consisting of amino and (C1-C3)alkylamino;

[0175] R 7 is hydrogen, (C1-C3) alkyl or alkoxy; R 3 is hydrogen, (C1-C8) alkyl, cyano, trifluoromethyl, -NR a R b or halogen;

[0176] R 6is selected from the group consisting of hydrogen, halogen, (C1-C8) alkyl, (C2-C8) alkenyl, -B(OH)2, substituted or unsubstituted (C2-C8) alkynyl, unsubstituted or substituted (C3-C8) cycloalkyl, unsubstituted or substituted (C3-C8) cycloalkyl-(C1-C8) alkyl, unsubstituted or substituted (C5-C8) cycloalkenyl, unsubstituted or substituted (C5-C8) cycloalkenyl-(C1-C8) alkyl, (C6-C 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl, cyano, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, -NR a R b 、-NR a C(O)R b NR a C(O)NR a R b NR a C(O)OR a NR a S02R b NR a SO2NR a R b 、-NR a NR a R b 、-NR a NR a C(O)R b 、-NR a NR a C(O)NR a R b NR a NR a C(O)OR a 、-OR a 、-OC(O)R a 、-OC(O)NR a Rb ;

[0177] wherein any (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, cycloalkyl, cycloalkenyl, bicycloalkyl, heterocycloalkyl, aryl or heteroaryl is optionally substituted by 1, 2 or 3 groups independently selected from the group consisting of: -O(C1-C6)alkyl (R c ) 1-2 、-S(C1-C6)alkyl(R c ) 1-2 、-(C1-C6)alkyl(R c ) 1-2 , (C1-C8) alkyl-heterocycloalkyl, (C3-C8) cycloalkyl-heterocycloalkyl, halo, (C1-C6) alkyl, (C3-C8) cycloalkyl, (C5-C8) cycloalkenyl, (C1-C6) haloalkyl, cyano, -COR a 、-CO2R a 、-CONR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, -NR a R b NR a C(O)R b 、-NR a C(O)NR a R b 、-NR a C(O)OR a NR a S02R b NR a SO2NR a R b 、-OR a 、-OC(O)R a 、-OC(O)NR a R b , heterocycloalkyl, aryl, heteroaryl, aryl(C1-C4)alkyl and heteroaryl(C1-C4)alkyl;

[0178] wherein any aryl or heteroaryl portion of the aryl, heteroaryl, aryl(C1-C4)alkyl or heteroaryl(C1-C4)alkyl is optionally substituted with 1, 2 or 3 groups independently selected from the group consisting of halo, (C1-C6)alkyl, (C3-C8)cycloalkyl, (C5-C8)cycloalkenyl, (C1-C6)haloalkyl, cyano, -COR a、-CO2R a 、-CONR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, NR a R b NR a C(O)R b NR a C(O)NR a R b NR a C(O)OR a 、-NR a S02R b NR a SO2NR a R b 、-OR a 、-OC(O)R a and -OC(O)NR a R b ;

[0179] Each R° is independently (C1-C4)alkylamino, -NR a S02R b 、-SOR a 、-SO2R a 、-NR a C(O)OR a 、-NR a R b or -CO2R a ;

[0180] R a and R b are each independently hydrogen, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, (C3-C8)cycloalkyl, (C5-C8)cycloalkenyl, (C6-C 10)bicycloalkyl, heterocycloalkyl, aryl, heteroaryl, wherein the (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, cycloalkyl, cycloalkenyl, bicycloalkyl, heterocycloalkyl, aryl or heteroaryl is optionally substituted with 1, 2 or 3 groups independently selected from the group consisting of halo, hydroxy, (C1-C4)alkoxy, amino, (C1-C4)alkylamino, ((C1-C4)alkyl)((C1-C4)alkyl)amino, -CO2H, -CO2(C1-C4)alkyl, -CONH2, -CONH(C1-C4)alkyl, -CON((C1-C4)alkyl)((C1-C4)alkyl), -SO2(C1-C4)alkyl, -SO2NH2, -SO2NH(C1-C4)alkyl or -SO2N((C1-C4)alkyl)((C1-C4)alkyl);

[0181] or R a and R b together with the nitrogen to which they are attached represent a 5-8 membered saturated or unsaturated ring, optionally containing additional heteroatoms selected from oxygen, nitrogen and sulfur, wherein the ring is optionally substituted by 1, 2 or 3 groups independently selected from (C1-C4)alkyl, (C1-C4)haloalkyl, amino, (C1-C4)alkylamino, ((C1-C4)alkyl)((C1-C4)alkyl)amino, hydroxy, oxo, (C1-C4)alkoxy and (C1-C4)alkoxy(C1-C4)alkyl, wherein the ring is optionally fused to a (C3-C8)cycloalkyl, heterocycloalkyl, aryl or heteroaryl ring;

[0182] or R a and R b Together with the nitrogen to which they are attached represent a 6- to 10-membered bridged bicyclic ring system optionally fused to a (C3-C8)cycloalkyl, heterocycloalkyl, aryl or heteroaryl ring;

[0183] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0184] The EZH2 inhibitor or compound of formula (I) may be any compound disclosed in WO2011 / 140324 (US20130053397A1), including GSK126, or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0185] In some embodiments, the EZH2 inhibitor or compound of Formula (I) is GSK126, which has the following structure:

[0186]

[0187] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0188] For compounds of formula (I), for the avoidance of doubt, unless otherwise stated, the term "substituted" means substituted with one or more defined groups. Where groups may be selected from a plurality of alternative groups, the selected groups may be the same or different.

[0189] The term "independently" means that when more than one substituent is selected from a number of possible substituents, those substituents may be the same or different.

[0190] The term "alkyl" refers to a straight or branched hydrocarbon group having a specified number of carbon atoms, thus, for example, as used herein, the term "C1-C8 alkyl" refers to an alkyl group having at least 1 and at most 8 carbon atoms, respectively. Examples of such branched or straight chain alkyl groups that can be used in the present invention include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, isobutyl, n-butyl, tert-butyl, n-pentyl, isopentyl, n-hexyl, n-heptyl and n-octyl, as well as branched analogs of the latter five normal alkanes.

[0191] According to the above definition of alkyl, as used herein, the term "alkoxy" refers to -O(C 1- C8 alkyl), including -OCH3, -OCH2CH3 and -OC(CH3)3, etc.

[0192] According to the above definition of alkyl, as used herein, the term "alkylthio" refers to -S(C 1- C8 alkyl), including -SCH3, -SCH2CH3, etc.

[0193] According to the above definition of alkyl, the term "acyloxy" refers to -OC(O)C1-C8 alkyl and the like.

[0194] According to the above definition of alkyl, the term "acylamino" refers to -N(H)C(O)C 1- C8 alkyl, etc.

[0195] The term "aryloxy" refers to -O(aryl), -O(substituted aryl), -O(heteroaryl), or -O(substituted heteroaryl).

[0196] The term "arylamino" means -NH(aryl), -NH(substituted aryl), -NH(heteroaryl), or -NH(substituted heteroaryl) and the like.

[0197] When the term "alkenyl" (or "alkenylene") is used, it refers to a straight or branched hydrocarbon chain containing the specified number of carbon atoms and at least 1 and up to 5 carbon-carbon double bonds. Examples include ethenyl (or ethenylene) and propenyl (or propenylene).

[0198] When the term "alkynyl" (or "alkynylene") is used, it refers to a straight or branched hydrocarbon chain containing the specified number of carbon atoms and at least 1 and up to 5 carbon-carbon triple bonds. Examples include ethynyl (or ethynylene) and propynyl (or propynylene).

[0199] The term "haloalkyl" refers to an alkyl group substituted by one or more halo substituents, suitably 1 to 6 substituents. Haloalkyl includes trifluoromethyl.

[0200] When "cycloalkyl" is used, it refers to a non-aromatic saturated cyclic hydrocarbon ring containing the specified number of carbon atoms. Thus, for example, the term "C3-C8 cycloalkyl" refers to a non-aromatic cyclic hydrocarbon ring having 3 to 8 carbon atoms. Exemplary "C3-C8 cycloalkyl" groups useful in the present invention include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

[0201] The term "C5-C8 cycloalkenyl" refers to a non-aromatic monocyclic carbocyclic ring having the specified number of carbon atoms and up to 3 carbon-carbon double bonds. "Cycloalkenyl" includes, for example, cyclopentenyl and cyclohexenyl.

[0202] When "C3-C8 heterocycloalkyl" is used, it means a non-aromatic heterocyclic ring containing the specified number of ring atoms, which is saturated or has one or more degrees of unsaturation and contains one or more heteroatom substitutions independently selected from O, S and N. Such rings may be optionally fused to one or more other "heterocyclic" rings or cycloalkyl rings. Examples are given herein.

[0203] "Aryl" refers to an optionally substituted monocyclic or polycyclic unfused or fused group having 6 to 14 carbon atoms and having at least one aromatic ring that conforms to Hückel's rule. Examples of aryl are phenyl, biphenyl, naphthyl, anthracenyl, phenanthrenyl, and the like, as further described herein.

[0204] "Heteroaryl" means an optionally substituted aromatic monocyclic or polycyclic carbocyclic fused ring system, wherein at least one ring conforms to Hückel's rule, has the specified number of ring atoms, and the ring contains at least one heteroatom independently selected from N, O and S. Examples of "heteroaryl" groups are given herein.

[0205] The EZH2 inhibitor may be any compound disclosed in WO2011 / 140325 (US20130053383A1), including GSK343, or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0206] In some embodiments, the EZH2 inhibitor is GSK343, which has the following structure:

[0207]

[0208] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof. GSK-126 has a selectivity for EZH2 of about >150 times that for EZH1.

[0209] The EZH2 inhibitor may be any compound disclosed in WO2012 / 142504 (US20120264734A1), including EPZ-6438 (Tazemetostat), or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0210] In some embodiments, the EZH2 inhibitor is EPZ-6438 (tazemestat), which has the following structure:

[0211]

[0212] Or its stereoisomer, tautomer, hydrate, solvate or salt, in particular a pharmaceutically acceptable salt, or a mixture thereof. EPZ-6438 competitively binds to the S-adenosylmethionine (SAM) binding site of EZH2, and also non-competitively binds to the binding site of peptide or nucleosome substrates. EPZ-6438 selectively inhibits EZH2, with a selectivity of about 35 times that of EZH1.

[0213] The EZH2 inhibitor may be any compound disclosed in WO2013 / 120104 (US20150011546A1), including CPI-1205, or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0214] In some embodiments, the EZH2 inhibitor is CPI-1205, which has the following structure:

[0215]

[0216] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0217] The EZH2 inhibitor may be any compound disclosed in WO2015 / 193765 (US20150361067A1), including PF-06821497, or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0218] In some embodiments, the EZH2 inhibitor is PF-06821497, which has the following structure:

[0219]

[0220] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0221] The EZH2 inhibitor can be any compound disclosed in Shahabipour et al. (Cancer Lett. 2017 Aug 1; 400: 325-335), including ursolic acid, triptolide and sulforaphane, or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0222] In some embodiments, the EZH2 inhibitor is triptolide, which has the following structure:

[0223]

[0224] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0225] In some embodiments, the EZH2 inhibitor is sulforaphane, which has the following structure:

[0226]

[0227] or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

[0228] In a preferred embodiment, the EZH2 inhibitor is selected from the group consisting of the following compounds, or stereoisomers, tautomers, hydrates, solvates or salts thereof, in particular pharmaceutically acceptable salts, or mixtures thereof:

[0229]

[0230]

[0231] When the plural form of the word compounds, salts, polymorphs, hydrates, solvates and the like is used herein, this is intended to mean a single compound, salt, polymorph, isomer, hydrate, solvate and the like as well.

[0232] By "stable compound" or "stable structure" is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.

[0233] The compounds described herein may contain one or more asymmetric centers, depending on the desired location and properties of the various substituents. Asymmetric carbon atoms exist in (R) or (S) configurations, producing racemic mixtures in the case of a single asymmetric center and diastereomeric mixtures in the case of multiple asymmetric centers. In some cases, asymmetry may also exist due to restricted rotation around a given bond (e.g., a central bond adjacent to two substituted aromatic rings of a particular compound).

[0234] The compounds described herein may contain an asymmetric sulfur atom, such as an asymmetric sulfoxide, of the structure:

[0235]

[0236] For example, where * indicates an atom to which the rest of the molecule can bind.

[0237] Substituents on the rings may also exist in cis or trans form. It is intended that all such configurations (including enantiomers and diastereomers) are included within the scope of the present invention.

[0238] Preferred compounds are those that produce more desirable biological activity. Isolation, pure or partially purified isomers and stereoisomers or racemic or diastereomeric mixtures of the compounds described herein are also included within the scope of the present invention. The purification and separation of these substances can be accomplished by standard techniques known in the art.

[0239] Optical isomers can be obtained by resolving racemic mixtures according to conventional methods, for example, by forming diastereomeric salts or forming covalent diastereomers using optically active acids or bases. Examples of suitable acids are tartaric acid, diacetyltartaric acid, ditoluoyltartaric acid and camphorsulfonic acid. A mixture of diastereoisomers can be separated into their respective diastereoisomers based on their physical and / or chemical differences by methods known in the art, for example, by chromatography or fractional crystallization. The optically active base or acid is then released from the separated diastereomeric salts. Different methods for separating optical isomers involve the use of chiral chromatography (e.g., chiral HPLC columns), with or without conventional derivatization, optimally selected to maximize the separation of enantiomers. Suitable chiral HPLC columns are manufactured by Daicel, such as Chiracel OD and Chiracel OJ, etc., which are all conventionally selectable. Enzymatic separation with or without derivatization is also useful. The optically active compounds of the present invention can also be obtained by chiral synthesis using optically active starting materials.

[0240] For the purpose of limiting isomers of different types to one another, reference is made to IUPAC rules, Part E (Pure Appl Chem 45, 11-30, 1976).

[0241] The present invention includes all possible stereoisomers of the compounds described herein, as single stereoisomers, or as any mixture of said stereoisomers in any ratio, such as R- or S-isomers, or E- or Z-isomers. Separation of single stereoisomers (e.g., single enantiomers or single diastereomers) of the compounds described herein is achieved by any suitable prior art method, such as chromatography, especially chiral chromatography.

[0242] Additionally, the compounds described herein may exist as tautomers. The present invention includes all possible tautomers of the compounds of the present invention, either as single tautomers, or as any mixture of said tautomers in any ratio.

[0243] Additionally, the compounds described herein may exist as N-oxides, which is defined as at least one nitrogen of the compounds described herein is oxidized. The present invention includes all such possible N-oxides.

[0244] The present invention also relates to useful forms of the compounds described herein, such as metabolites, hydrates, solvates, prodrugs, salts, particularly pharmaceutically acceptable salts, and coprecipitates.

[0245] The compounds described herein may exist as hydrates or solvates, wherein the compounds described herein contain polar solvents, in particular water, methanol or ethanol, for example as structural elements of the crystal lattice of the compound. The amount of polar solvent, in particular water, may be present in a stoichiometric or non-stoichiometric ratio. In the case of stoichiometric solvates such as hydrates, these may be hemi, (semi), mono, sesqui, di, tri, tetra, penta, etc. solvates or hydrates, respectively. The present invention includes all such hydrates or solvates.

[0246] In addition, the compounds described herein may exist in free form, for example as a free base, or as a free acid, or as a zwitter ion, or may exist in the form of a salt. The salt may be any salt commonly used in pharmacy, an organic or inorganic addition salt, in particular any pharmaceutically acceptable organic or inorganic addition salt.

[0247] Examples of acid addition salts include, but are not limited to, hydrochloride, hydrobromide, phosphate, nitrate, sulfate, sulfamate, formate, acetate, propionate, citrate, D-gluconate, benzoate, 2-(4-hydroxybenzoyl)-benzoate, butyrate, salicylate, sulfosalicylate, lactate, maleate, laurate, malate, fumarate, succinate, oxalate, malonate, pyruvate, acetoacetate, tartrate, stearate, benzenesulfonate, toluenesulfonate, methanesulfonate, trifluoromethanesulfonate, 3-hydroxy-2-naphthoate, benzenesulfonate, naphthalene disulfonate, and trifluoroacetate.

[0248] Examples of salts with bases include, but are not limited to, lithium, sodium, potassium, calcium, aluminum, magnesium, titanium, meglumine, ammonium, salts optionally derived from NH3 or an organic amine having 1 to 16 C atoms, such as ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, dimethylaminoethanol, procaine, dibenzylamine, N-methylmorpholine, arginine, lysine, ethylenediamine, N-methylpiperidinium and guanidine salts.

[0249] Salts include water-insoluble salts, and particularly include water-soluble salts.

[0250] The term "pharmaceutically acceptable salt" refers to the relatively non-toxic, inorganic or organic acid addition salts of the compounds described herein. See, for example, SM Berge et al. "Pharmaceutical Salts," J. Pharm. Sci. 1977, 66, 1-19.

[0251] Suitable pharmaceutically acceptable salts of the compounds described herein can be, for example, acid addition salts of the compounds described herein with nitrogen atoms in the chain or ring, which are, for example, sufficiently basic, such as acid addition salts with inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, bisulfuric acid, phosphoric acid or nitric acid, or with organic acids such as formic acid, acetic acid, acetoacetic acid, pyruvic acid, trifluoroacetic acid, propionic acid, butyric acid, hexanoic acid, heptanoic acid, undecanoic acid, lauric acid, benzoic acid, salicylic acid, 2-(4-hydroxybenzoyl)-benzoic acid, camphoric acid, cinnamic acid, cyclopentanepropionic acid, digluconic acid, 3-hydroxy-2-naphthoic acid, nicotinic acid, pamoic acid, pectic acid, persulfuric acid, 3-phenylpropionic acid, picric acid, pivalic acid, 2-hydroxyethyl The acid addition salts of the present invention can be substituted with an acid addition salt of 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol, 1-hydroxy-2-nitro-2-ol

[0252] In addition, another suitable sufficiently acidic pharmaceutically acceptable salt of the compounds described herein is an alkali metal salt (e.g., sodium or potassium salt), an alkaline earth metal salt (e.g., calcium or magnesium salt), an ammonium salt, or a salt with an organic base providing a physiologically acceptable cation, such as a salt with N-methyl-glucamine, dimethyl-glucamine, ethyl-glucamine, lysine, dicyclohexylamine, 1,6-hexanediamine, ethanolamine, glucosamine, sarcosine, serinol, tris-hydroxy-methyl-aminomethane, aminopropylene glycol, sovak's base, 1-amino-2,3,4-butanetriol. In addition, basic nitrogen-containing groups can be quaternized using agents such as: lower alkyl halides, such as chlorides, bromides and iodides of methyl, ethyl, propyl and butyl; dialkyl sulfates, such as dimethyl sulfate, diethyl sulfate and dibutyl sulfate, and diamyl sulfate; long chain halides, such as chlorides, bromides and iodides of decyl, lauryl, myristyl and stearyl; aralkyl halides, such as benzyl bromide and phenethyl bromide, etc.

[0253] Those skilled in the art will also recognize that the acid addition salts of the compounds described herein can be prepared by reacting the compounds with an appropriate inorganic or organic acid using any of a variety of known methods. Alternatively, the alkali metal and alkaline earth metal salts of the acidic compounds described herein can be prepared by reacting the compounds with an appropriate base using a variety of known methods.

[0254] The present invention includes all possible salts of the compounds described herein, either as single salts, or as any mixture of said salts in any ratio.

[0255] As used herein, when a compound is referred to in the form of a salt with a corresponding base or acid, the exact stoichiometric composition of the salt form obtained by the corresponding preparation and / or purification process is in most cases unknown. Unless otherwise indicated, the suffixes of the chemical name or structural formula, such as "hydrochloride", "trifluoroacetate", "sodium salt" or "x HCl", "xCF3COOH", "xNa + " is to be understood not as a stoichiometric specification but only as a salt form. This applies analogously to the case where synthetic intermediates or exemplary compounds or their salts are obtained in the form of solvates (e.g. hydrates of (if defined) unknown stoichiometric composition) by the described preparation and / or purification processes.

[0256] As used herein, the term "in vivo hydrolyzable ester" is understood to mean an in vivo hydrolyzable ester containing a carboxyl or hydroxyl group of the compounds described herein, such as a pharmaceutically acceptable ester, which is hydrolyzed in the human or animal body to produce the parent acid or alcohol. Suitable pharmaceutically acceptable esters of carboxyl groups include, for example, alkyl esters, cycloalkyl esters and optionally substituted phenylalkyl esters (particularly benzyl esters), C1-C6 alkoxymethyl esters (e.g., methoxymethyl esters), C1-C6 alkanoyloxymethyl esters (e.g., pivaloyloxymethyl esters), phthalate esters, C3-C8 cycloalkyloxy-carbonyloxy-C1-C6 alkyl esters (e.g., 1-cyclohexylcarbonyloxyethyl esters); 1,3-dioxol-2-one methyl esters, such as 5-methyl-1,3-dioxol-2-one methyl esters; and C1-C6 alkoxycarbonyloxyethyl esters, such as 1-methoxycarbonyloxyethyl esters, and can be formed at any carboxyl group in the compounds described herein.

[0257] In vivo hydrolyzable esters of compounds containing hydroxyl groups described herein include inorganic esters such as phosphates and [α]-acyloxyalkyl ethers and related compounds, which decompose to give the parent hydroxyl group due to in vivo hydrolysis of the ester. Examples of [α]-acyloxyalkyl ethers include acetoxymethoxy and 2,2-dimethylpropionyloxymethoxy. Selection of in vivo hydrolyzable ester-forming groups of hydroxyl groups include alkanoyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl, alkoxycarbonyl (to give alkyl carbonates), dialkylcarbamoyl and N-(dialkylaminoethyl)-N-alkylcarbamoyl (to give carbamates), dialkylaminoacetyl and carboxyacetyl. The present invention encompasses all such esters.

[0258] Furthermore, the present invention includes all possible crystalline forms or polymorphs of the compounds described herein, either as single polymorphs, or as mixtures of more than one polymorph in any ratio.

[0259] application

[0260] Insulin-producing cells or cell populations comprising insulin-producing cells produced by the methods as described herein can be administered to an individual in need thereof.

[0261] Thus, in some embodiments of the method of generating insulin-producing cells from pancreatic exocrine cells, the method further comprises the step of administering the insulin-producing cells or a population of cells comprising insulin-producing cells to an individual.

[0262] In some embodiments, the pancreatic exocrine cells that produce the insulin-producing cells are obtained from an individual. Advantageously, because the insulin-producing cells are derived from the individual's own cells, this can avoid the need for immunosuppressants when administering the insulin-producing cells to the individual.

[0263] Insulin-producing cells or cell populations comprising insulin-producing cells can be used for administration to individuals with diseases involving dysfunctional insulin production. Thus, in some embodiments, the individual to whom the insulin-producing cells or cell populations comprising insulin-producing cells are administered has diabetes, such as type 1 diabetes, type 2 diabetes, or gestational diabetes, or is prediabetic.

[0264] The present invention also provides a method for preventing or treating a disease involving dysfunctional insulin production, the method comprising:

[0265] - administering to an individual in need thereof a cell population comprising insulin-producing cells as described herein or produced by a method as described herein,

[0266] Thereby preventing or treating the disease.

[0267] In another aspect, the present invention provides the use of an insulin-producing cell or a cell population comprising insulin-producing cells as described herein or produced by a method as described herein for preventing or treating a disease involving dysfunctional insulin production in an individual.

[0268] In another aspect, the present invention provides the use of an insulin-producing cell or a cell population comprising insulin-producing cells as described herein or produced by a method as described herein, for the preparation of a composition (or medicament) for preventing or treating a disease involving dysfunctional insulin production in an individual.

[0269] In another aspect, the present invention provides an insulin-producing cell or a cell population comprising insulin-producing cells as described herein or produced by a method as described herein for use in preventing or treating a disease involving dysfunctional insulin production in an individual.

[0270] Diseases involving dysfunctional insulin production include diabetes and prediabetes.

[0271] Diabetes, commonly known as diabetes, is a metabolic disease that causes high blood sugar levels. There are several different types of diabetes, including type 1 diabetes, type 2 diabetes, and gestational diabetes.

[0272] Type 1 diabetes (T1D) refers to a chronic autoimmune disease that selectively destroys the insulin-producing beta cells in the pancreas. Type 1 diabetes is not associated with modifiable lifestyle factors. Typical symptoms include excessive thirst, frequent urination, unexplained weight loss, feeling extremely hungry, fatigue and weakness, mood swings, itching and skin infections, and visual disturbances such as blurred vision. The main diagnostic test is a blood test to measure glucose while fasting or at other times of the day. Tests include a fasting blood sugar test, a random blood sugar test, and an oral glucose tolerance test.

[0273] Type 2 diabetes (T2D) is a condition in which the body becomes resistant to the normal effects of insulin and gradually loses the ability of the pancreas to produce enough insulin. The disease has strong genetic and familial (non-modifiable) risk factors and is often associated with modifiable lifestyle risk factors. Typical symptoms include excessive thirst, frequent urination, unexplained weight loss, feeling extremely hungry, fatigue and weakness, mood swings, itching and skin infections, and visual disturbances such as blurred vision. The main diagnostic test is a blood test to measure glucose. Tests include a fasting blood sugar test, an oral glucose tolerance test, and a hemoglobin A1C test.

[0274] Gestational diabetes is diabetes that develops during pregnancy. Blocking the hormone insulin produced by the placenta can cause gestational diabetes. Gestational diabetes usually goes away after delivery, but it increases an individual's risk of developing type 2 diabetes in the future. Symptoms are usually mild and may include excessive thirst, frequent urination, fatigue, blurred vision, and yeast infections. Gestational diabetes is usually diagnosed with a pregnancy oral glucose tolerance test.

[0275] Prediabetes (also called moderate diabetes) is a condition in which an individual's blood sugar is higher than normal but not high enough to be diagnosed with type 2 diabetes. Individuals with prediabetes (also called moderate diabetics) are defined as typically having fasting plasma glucose (FPG) levels ≥100 mg / dl (5.6 mmol / l) but <126 mg / dl (7.0 mmol / l). Prediabetes is often associated with modifiable lifestyle risk factors. The condition has no clear symptoms; a possible sign of prediabetes is darkening of the skin in certain areas of the body, including the neck, armpits, and groin. Diagnostic tests include a fasting blood sugar test, an oral glucose tolerance test, and a hemoglobin A1C test. Individuals with prediabetes are considered to be at high risk for developing diabetes.

[0276] In some embodiments, the individual is identified as having diabetes, such as type 1 diabetes, type 2 diabetes, or gestational diabetes, or prediabetes.

[0277] In some embodiments, Diabetes or prediabetes may be associated with one or more of the following: endocrinopathy (diseases associated with endocrine gland dysfunction), including endocrinopathy associated with the administration of hormones (e.g., Cortisol); exocrine pancreatic disease (e.g., due to infection, trauma); drug-induced diabetes (e.g., diabetes associated with the administration of alpha-interferon); and genetic disorders (e.g., Down syndrome).

[0278] In some embodiments, the pancreatic exocrine cells from which the insulin-producing cells of the cell population are derived are from pancreatic tissue obtained from an individual. As shown in the examples, the methods and uses of the present invention allow the production of insulin-producing cells from pancreatic tissue obtained from non-diabetic donors and diabetic donors. Advantageously, since the insulin-producing cells are derived from the individual's own cells, this can avoid the need for immunosuppressants when administering the insulin-producing cells to an individual.

[0279] In some embodiments, the cell population comprising insulin-producing cells is delivered to the pancreas of an individual. The cell population can be delivered by any suitable method known in the art. For example, the cell population can be delivered to the pancreas by injecting the cell population into the portal vein of the liver of the individual.

[0280] In another aspect, the present invention provides a method for preventing or treating a disease involving dysfunctional insulin production, the method comprising:

[0281] - administering an EZH2 inhibitor to an individual in need thereof such that the EZH2 inhibitor is in contact with pancreatic exocrine cells of the individual for a sufficient period of time and under conditions to allow the generation of insulin-producing cells from the pancreatic exocrine cells,

[0282] Thereby preventing or treating the disease in the individual.

[0283] The invention also provides for the use of an EZH2 inhibitor for preventing or treating a disease involving dysfunctional insulin production in an individual, wherein the EZH2 inhibitor is contacted with pancreatic exocrine cells of the individual for a sufficient time and under conditions to allow for the generation of insulin-producing cells from the pancreatic exocrine cells.

[0284] The present invention also provides the use of an EZH2 inhibitor in the preparation of a composition (or medicament) for preventing or treating a disease involving dysfunctional insulin production in an individual, wherein the EZH2 inhibitor is contacted with pancreatic exocrine cells of the individual for a sufficient time and under conditions to allow the generation of insulin-producing cells from the pancreatic exocrine cells.

[0285] The invention also provides an EZH2 inhibitor for use in preventing or treating a disease involving dysfunctional insulin production in an individual, wherein the EZH2 inhibitor is contacted with pancreatic exocrine cells of the individual for a sufficient period of time and under conditions to allow generation of insulin-producing cells from the pancreatic exocrine cells.

[0286] In another aspect, the present invention provides a pharmaceutical composition for treating or preventing a disease involving dysfunctional insulin production, the pharmaceutical composition comprising an EZH2 inhibitor and a pharmaceutically acceptable diluent, excipient or carrier. In one embodiment, the only active ingredient present in the composition is the EZH2 inhibitor.

[0287] The present invention also provides a pharmaceutical composition for treating or preventing a disease involving dysfunctional insulin production, the composition comprising an EZH2 inhibitor as an active ingredient and a pharmaceutically acceptable diluent, excipient or carrier. In one embodiment, the only active ingredient present in the composition is the EZH2 inhibitor.

[0288] The present invention also provides a pharmaceutical composition for treating or preventing a disease involving dysfunctional insulin production, the composition comprising as a main ingredient an EZH2 inhibitor and a pharmaceutically acceptable diluent, excipient or carrier. In one embodiment, the only active ingredient present in the composition is an EZH2 inhibitor.

[0289] The disease involving dysfunctional insulin production may be diabetes, such as type 1 diabetes, type 2 diabetes or gestational diabetes, or prediabetes.

[0290] In some embodiments, the individual is identified as having diabetes, such as type 1 diabetes, type 2 diabetes, or gestational diabetes, or prediabetes.

[0291] The EZH2 inhibitor can be any EZH2 inhibitor as described herein. The EZH2 inhibitor can be administered systemically or directly to the disease site. The EZH2 inhibitor can be formulated for oral administration.

[0292] As used herein, the term "treatment" or "treating" a subject includes applying or administering to a subject insulin-producing cells produced by the methods described herein (or a cell population comprising insulin-producing cells produced by the methods described herein), or applying or administering to a subject (or to a cell or tissue from a subject) an EZH2 inhibitor as described herein, for the purpose of delaying, slowing, stabilizing, curing, healing, alleviating, relieving, altering, remedying, weakening, improving, modifying or affecting a disease or condition, a symptom of a disease or condition, or a risk (or susceptibility) for a disease or condition. The term "treat" refers to any indication of successful treatment or improvement of an injury, pathology or condition, including any objective or subjective parameter, such as alleviation; remission; reduced rate of deterioration; reduced severity of the disease; stabilization, alleviation of symptoms or making the subject more tolerant to an injury, pathology or condition; slowing the rate of degeneration or decline; making the endpoint of degeneration less debilitating; or improving the physical or mental health of the subject.

[0293] As used herein, the term "prevention" or "preventing" is intended to mean at least reducing the likelihood of acquiring the risk (or susceptibility) of a disease or condition (i.e., causing at least one clinical symptom of the disease not to develop in a patient who may be exposed to or susceptible to the disease but has not yet experienced or displayed symptoms of the disease). Biological and physiological parameters for identifying such patients are provided herein and are known in the art.

[0294] The presence or improvement of treatment or prevention of diabetes and prediabetes can be carried out by any clinical or biochemical related methods known in the art. Examples of related measurements include blood glucose tests, including those as described herein. Related methods include measuring blood glucose, blood pressure, cholesterol levels and body weight. For example, a positive response to treatment can be an improvement (e.g., reduction) in blood glucose levels or control of blood glucose levels. Improvement or treatment can be determined directly from a subject or from a sample or biopsy of a subject. The sample can be a blood test. The sample or biopsy can be pancreatic tissue or pancreatic cells therefrom.

[0295] Administration of EZH2 inhibitors

[0296] In some embodiments, a method of preventing or treating a disease involving dysfunctional insulin production comprises administering a therapeutically effective amount of an EZH2 inhibitor as described herein or a pharmaceutical composition as described herein.

[0297] As used herein, the term "therapeutically effective amount" is generally intended to refer to an amount of an active agent (e.g., a compound described herein) that (i) treats a disease involving dysfunctional insulin production, (ii) attenuates, ameliorates, or eliminates one or more symptoms of a disease involving dysfunctional insulin production, or (iii) delays the onset of one or more symptoms of a disease involving dysfunctional insulin production as described herein. The exact dosage will depend on the purpose of the treatment and will be determined by one skilled in the art using known techniques. Adjustments for systemic versus local delivery, age, weight, general health, sex, diet, time of administration, drug interactions, and severity of the condition may be necessary, as known in the art and described herein, and can be determined by routine experimentation by one skilled in the art.

[0298] The appropriate dosage of the compounds or pharmaceutical compositions described herein will vary depending on the specific disease involving dysfunctional insulin production being treated and / or the subject being treated. A skilled physician is able to determine an appropriate dosage, for example, by starting with a suboptimal dose and incrementally modifying the dose to determine an optimal or useful dose. Alternatively, to determine an appropriate therapeutic dose, data from cell culture assays or animal studies can be used, where appropriate dosages are measured in the presence or absence of an ED inhibitor, including the active compound. 50The dose may vary within this range depending upon the dosage form employed and the route of administration utilized. The therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 determined in cell culture. 50 (i.e., the concentration or amount of the compound that achieves half-maximal inhibition of symptoms). Such information can be used to more accurately determine useful doses in humans. For example, levels in plasma can be measured by high performance liquid chromatography.

[0299] Typically, a therapeutically effective dose is formulated to contain a concentration (by weight) of at least about 0.1% to about 50% or more of the compounds described herein, and all combinations and subcombinations of ranges therein. Pharmaceutical compositions as described herein can be formulated to contain a concentration of about 0.1 to less than about 50%, for example, about 49, 48, 47, 46, 45, 44, 43, 42, 41 or 40% of a compound described herein, or a pharmaceutically acceptable salt or solvent thereof, wherein the concentration is greater than about 0.1%, for example, about 0.2, 0.3, 0.4 or 0.5% to less than about 40%, for example, about 39, 38, 37, 36, 35, 34, 33, 32, 31 or 30%. Exemplary compositions can contain about 0.5% to less than about 30%, for example, about 29%, 28%, 27%, 26%, 25%, 25%, 24%, 23%, 22%, 21% or 20%, wherein concentration is greater than about 0.5%, for example, about 0.6%, 0.7%, 0.8%, 0.9% or 1% to less than about 20%, for example, about 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11% or 10%. Compositions can contain greater than about 1%, for example, about 2%, to less than about 10%, for example, about 9% or 8%, including greater than about 2%, for example, about 3% or 4%, to less than about 8%, for example, about 7% or 6%. Active agent can be present, for example, with a concentration of about 5%. In all cases, the amount can be adjusted to compensate for the difference in the amount of the active ingredient of the cells or tissues actually delivered to the subject.

[0300] The compounds or pharmaceutical compositions described herein can be administered or formulated for administration by any route described herein. As used herein, the term "administering" means administering a therapeutically effective dose of a compound described herein to a subject. As used herein, the term "formulated for administration" means preparing a therapeutically effective dose of a compound described herein in a manner suitable for the route of administration. In a preferred embodiment, the compound (or pharmaceutical composition) is administered orally or parenterally, more preferably orally. In other preferred embodiments, the compound (or pharmaceutical composition) is formulated for oral administration or parenteral administration, more preferably for oral administration.

[0301] In embodiments where the compound (or pharmaceutical composition) is orally administered to a subject or formulated for oral administration to a subject, a therapeutically effective amount of the compound may correspond to preferably about 1 to about 50 mg / kg, or about 1 to about 25 mg / kg, or about 1 to about 10 mg / kg, about 5 to about 25 mg / kg, or about 10 to about 20 mg / kg.

[0302] The frequency of administration of the compounds or pharmaceutical compositions described herein can be once daily, twice daily, or three times daily. The treatment period can be the duration for which disease can be detected.

[0303] Pharmaceutical composition can be formulated for any suitable route of administration, including, for example, oral, oral, nasal, vaginal, rectal or parenteral administration. As used herein, the term parenteral includes subcutaneous, intradermal, intravascular (e.g., intravenous), intramuscular, intraspinal, intracranial, intrathecal, intraocular, periocular, intraorbital, intrasynovial and intraperitoneal injection, and any similar injection or infusion techniques. In certain embodiments, it is preferred to be suitable for oral use or parenteral use, especially for oral use. Suitable oral forms include, for example, tablets, lozenges, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. In other embodiments, provided herein is a composition that can be formulated into a lyophilized product.

[0304] The various dosage units are each preferably provided as discrete dose tablets, capsules, lozenges, dragees, chewing gums or other types of solid preparations. Capsules can encapsulate powders, liquids or gels. Solid preparations can be swallowed, or can be suckable or chewable types (fragile or gelatinous). The present invention contemplates dosage unit holding devices other than blister packs; for example, packaging such as bottles, tubes, cans, bags. The dosage unit may further include conventional excipients well known in pharmaceutical preparation practice, such as adhesives, gelling agents, fillers, tableting lubricants, disintegrants, surfactants and colorants; and excipients for suckable or chewable preparations.

[0305] Compositions for oral use may further comprise one or more components, such as sweeteners, flavorings, coloring agents and / or preservatives, to provide attractive and palatable preparations. Tablets contain active ingredients mixed with physiologically acceptable excipients suitable for preparing tablets. Such excipients include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate, granulating agents and disintegrants such as corn starch or alginic acid, adhesives such as starch, gelatin or gum arabic, and lubricants such as magnesium stearate, stearic acid or talcum. Tablets can be uncoated, or they can be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract, thereby providing sustained action over a long period of time. For example, a time-delay material such as glyceryl monostearate or glyceryl distearate can be used.

[0306] Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium such as peanut oil, liquid paraffin or olive oil.

[0307] Aqueous suspensions contain the active ingredient mixed with excipients suitable for preparing aqueous suspensions. Such excipients include suspending agents such as sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinyl pyrrolidone, gum tragacanth and gum arabic, and dispersants or wetting agents such as naturally occurring phosphatides (e.g., lecithin), condensation products of alkylene oxides with fatty acids such as polyoxyethylene stearate, condensation products of ethylene oxide with long chain aliphatic alcohols such as heptadecaethyleneoxycetanol, condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides such as polyoxyethylene sorbitan monooleate. The aqueous suspension may also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose or saccharin.

[0308] Oily suspensions can be prepared by suspending the active ingredient in a vegetable oil such as peanut oil, olive oil, sesame oil or coconut oil or a mineral oil such as liquid paraffin. Oily suspensions may contain thickeners, such as beeswax, hard paraffin or cetyl alcohol. Sweeteners (such as those described above) and / or flavorings may be added to provide a palatable oral formulation. Such suspensions may be preserved by adding an antioxidant such as ascorbic acid.

[0309] Dispersible powders and granules suitable for preparing an aqueous suspension by adding water provide the active ingredient in admixture with a dispersant or wetting agent, a suspending agent and one or more preservatives. Suitable dispersants or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, such as sweeteners, flavorings and coloring agents may also be present.

[0310] Pharmaceutical composition can also be in the form of water-in-oil emulsion. The oil phase can be vegetable oil such as olive oil or peanut oil, mineral oil such as liquid paraffin, or a mixture thereof. Suitable emulsifiers include naturally occurring gums such as gum arabic or tragacanth, naturally occurring phospholipids such as soybean lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides such as sorbitan monooleate, and condensation products of partial esters and ethylene oxide derived from fatty acids and hexitol such as polyoxyethylene sorbitan monooleate. Emulsions can also include one or more sweeteners and / or flavorings.

[0311] Syrups and elixirs may be formulated with sweetening agents such as glycerol, propylene glycol, sorbitol or sucrose. Such preparations may also contain one or more demulcents, preservatives, flavorings and / or coloring agents.

[0312] The compounds described herein can be formulated for local or topical administration. Formulations for topical administration typically comprise a topical vehicle in combination with the active agent, with or without additional optional components.

[0313] Suitable topical vehicles and additional components are well known in the art, and it will be apparent that the choice of excipient will depend on the particular physical form and mode of delivery. Topical vehicles include organic solvents such as alcohols (e.g., ethanol, isopropanol, or glycerol), glycols such as butylene glycol, isopentyl glycol, or propylene glycol, fatty alcohols such as lanolin, mixtures of water and organic solvents, and mixtures of organic solvents such as alcohol and glycerol, lipid-based materials such as fatty acids, acylglycerols including oils such as mineral oil and fats of natural or synthetic origin, phosphoglycerides, sphingolipids, and waxes, protein-based materials such as collagen and gelatin, silicone-based materials (both non-volatile and volatile), and hydrocarbon-based materials such as microsponges and polymer matrices.

[0314] The composition may further include one or more components suitable for improving the stability or effectiveness of the administered formulation, such as stabilizers, suspending agents, emulsifiers, viscosity modifiers, gelling agents, preservatives, antioxidants, skin penetration enhancers, humectants and sustained release materials. Examples of these components are described in Martindale-The Extra Pharmacopoeia (Pharmaceutical Press, London 1993) and Martin (ed.), Remington's Pharmaceutical Sciences. The formulation may include microcapsules, such as hydroxymethylcellulose or gelatin microcapsules, liposomes, albumin microspheres, microemulsions, nanoparticles or nanocapsules.

[0315] Topical preparations can be prepared in a variety of physical forms, including, for example, solids, pastes, emulsifiable pastes, foams, lotions, gels, powders, aqueous liquids, emulsions and sprays. The physical appearance and viscosity of these forms can be controlled by the presence and amount of the emulsifiers and viscosity modifiers present in the preparation. Solids are usually hard and non-pourable, and are usually formulated into strips or rods or granular forms. Solids can be opaque or transparent, and optionally can contain solvents, emulsifiers, humectants, emollients, spices, dyes / colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Emulsifiable pastes and lotions are usually similar to each other, mainly different in viscosity. Lotions and emulsifiable pastes can be opaque, translucent or transparent, and usually contain emulsifiers, solvents and viscosity modifiers, as well as humectants, emollients, spices, dyes / colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Gels can be prepared to have a series of viscosities from thick or high viscosity to rare or low viscosity. These formulations, such as lotions and creams, may also contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes / colorants, preservatives, and other active ingredients that increase or enhance the efficacy of the final product. Liquids are thinner than creams, lotions, or gels and usually do not contain emulsifiers. Liquid topical products often contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes / colorants, preservatives, and other active ingredients that increase or enhance the efficacy of the final product.

[0316] Emulsifiers for topical preparations include but are not limited to ionic emulsifiers, cetearyl alcohol, nonionic emulsifiers such as polyoxyethylene oleyl ether, PEG-40 stearate, ceteareth-12, ceteareth-20, ceteareth-30, cetearyl alcohol, PEG-100 stearate and glyceryl stearate. Suitable viscosity modifiers include but are not limited to protective colloids or nonionic glues, such as hydroxyethylcellulose, xanthan gum, magnesium aluminum silicate, silicon dioxide, microcrystalline wax, beeswax, paraffin and cetyl palmitate. Gel compositions can be formed by adding gelling agents such as chitosan, methylcellulose, ethylcellulose, polyvinyl alcohol, polyquaternium salt, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, carbomer or ammoniated glycyrrhizinate. Suitable surfactants include but are not limited to nonionic, amphoteric, ionic and anionic surfactants. For example, one or more of dimethicone copolyol, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, lauramide DEA, cocamide DEA and cocamide MEA, oleyl betaine, cocamidopropyl phosphatidyl PG-diammonium chloride, and ammonium laureth sulfate can be used in topical formulations.

[0317] Preservatives include, but are not limited to, antimicrobial agents such as methylparaben, propylparaben, sorbic acid, benzoic acid, and formaldehyde, as well as physical stabilizers and antioxidants such as vitamin E, sodium ascorbate / ascorbic acid, and propyl gallate. Suitable moisturizers include, but are not limited to, lactic acid and other hydroxy acids and their salts, glycerol, propylene glycol, and butylene glycol. Suitable emollients include lanolin alcohol, lanolin, lanolin derivatives, cholesterol, petrolatum, isostearyl neopentanoate, and mineral oil. Suitable fragrances and colorants include, but are not limited to, FD&C Red No.40 and FD&C Yellow No.5. Other suitable additional ingredients that may be included in topical preparations include, but are not limited to, abrasives, absorbents, anti-caking agents, defoamers, antistatic agents, astringents (such as witch hazel), alcohols, and herbal extracts such as chamomile extracts, binders / excipients, buffers, chelating agents, film formers, conditioners, propellants, sunscreens, pH regulators, and protective agents.

[0318] Typical modes of delivery for topical compositions include application with the fingers, application with a physical applicator such as a cloth, tissue, swab, stick or brush, spraying (including mist, aerosol or foam spray), dropper application, sprinkling, soaking and rinsing. Controlled release carriers may also be used.

[0319] The pharmaceutical composition can be formulated as an inhalation formulation, including sprays, mists or aerosols. This may be particularly preferred for treating pulmonary fibrosis. For inhalation formulations, compositions provided herein or combinations can be delivered via any inhalation method known to those skilled in the art. Such inhalation methods and devices include but are not limited to metered dose inhalers with propellants such as CFC or HFA or physiologically and environmentally acceptable propellants. Other suitable devices are breath-operated inhalers, multi-dose dry powder inhalers and aerosol sprayers. Aerosol formulations for the inventive method typically include propellants, surfactants and cosolvents, and can be filled into conventional aerosol containers sealed by suitable metering valves.

[0320] Inhalant compositions can include liquid or powder compositions containing active ingredients suitable for atomization and intrabronchial use, or aerosol compositions administered via an aerosol unit distributing a quantitative dose. Suitable liquid compositions include active ingredients in aqueous, pharmaceutically acceptable inhalant solvents such as isotonic saline or antibacterial water. The solution is atomized by a pump or extrusion-actuated atomizer, or is administered by any other conventional means for causing or enabling the desired dose of liquid composition to be sucked into the patient's lungs. Suitable formulations for administration (e.g., nasal sprays or nasal drops) wherein the carrier is a liquid include aqueous or oily solutions of active ingredients.

[0321] Pharmaceutical compositions can also be prepared in the form of suppositories, for example for rectal administration. Such compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature and will therefore melt in the rectum to release the drug. Suitable excipients include, for example, cocoa butter and polyethylene glycols.

[0322] The pharmaceutical composition can be formulated into a sustained release formulation, such as a capsule that produces a slow release of the modulator after administration. Such formulations can be prepared using well-known techniques, and are administered, for example, by oral, rectal or subcutaneous implantation or by implantation in a desired target site. The carrier used in such formulations is biocompatible and can also be biodegradable. Preferably, the formulation provides a relatively constant level of modulator release. The amount of modulator contained in the sustained release formulation depends on, for example, the expected duration of implantation site, release rate and release, and the nature of the disease to be treated or prevented.

[0323] In another aspect, the invention relates to a composition comprising at least one pancreatic exocrine cell and at least one EZH2 inhibitor. The pancreatic exocrine cell and the EZH2 inhibitor may be any of those described herein.

[0324] Also provided herein is a kit or article of manufacture comprising one or more EZH2 inhibitors as described herein, or a pharmaceutically acceptable salt, polymorph or prodrug thereof and / or a pharmaceutical composition as described above.

[0325] In some embodiments, the kit includes:

[0326] - a container containing a therapeutic composition in the form of one or more EZH2 inhibitors described herein, or a pharmaceutically acceptable salt, polymorph or prodrug or pharmaceutical composition thereof;

[0327] - Label or package insert with instructions for use.

[0328] Preferably, when used in the methods of the invention as described herein, the invention provides a kit. In some embodiments, a kit for producing insulin-producing cells as described herein is provided. In some embodiments, a kit for preventing or treating a disease involving dysfunctional insulin production is provided.

[0329] The label or package insert may indicate that the therapeutic composition is used to prevent or treat a disease involving dysfunctional insulin production. In one embodiment, the label or package insert includes instructions for use and indicates that the therapeutic or prophylactic composition can be used to prevent or treat a disease involving dysfunctional insulin production as described herein. In some embodiments, the kit includes instructions for producing insulin-producing cells from pancreatic exocrine cells according to the methods described herein.

[0330] It should be understood that the specific dosage level for any particular patient will depend on a variety of factors, including the activity of the specific compound used, age, weight, general health, sex, diet, time of administration, route of administration and rate of excretion, drug combination (i.e., other drugs used to treat the patient) and the severity of the specific condition being treated.

[0331] Examples

[0332] The present invention will be further described by way of non-limiting examples. Those skilled in the art of the present invention will appreciate that modifications may be made without departing from the spirit and scope of the present invention.

[0333] The present invention discloses several molecules with different structures, such as GSK126, EPZ-6438, ursolic acid and triptolide, which are used to produce insulin-producing cells by the described method. Although these molecules have different structures, different modes of action, different affinities and inhibition constants, and different selectivities for EZH2, they all have the same properties as EZH2 inhibitors. The results described below show that any EZH2 inhibitor can produce insulin-producing cells from pancreatic exocrine cells.

[0334] Human pancreatic ductal epithelial cells were stimulated with EZH2 inhibitors GSK-126, EPZ6438, and triptolide using 2-day and 7-day regimens to determine their effects on the expression of the core endocrine developmental marker NGN3, as well as the beta cell markers insulin, MAFA, and PDX1. Chromatin immunoprecipitation studies showed that pharmacological EZH2 inhibition closely corresponded to reduced H3K27me3 content of the core genes NGN3, MAFA, and PDX1. Consistent with the reduction of H3K27me3 by pharmacological inhibition of EZH2, the inventors observed measurable immunofluorescent staining of insulin protein and glucose-sensitive insulin responses.

[0335] Example 1. Effects of GSK126 on pancreatic cells from non-diabetic and type 1 diabetic donors

[0336] Materials and methods

[0337] Human samples

[0338] Cadaveric pancreatic tissue was rapidly harvested from brain-dead donors with heartbeats, under research approval from the Human Research Ethics Committee of St. Vincent's Hospital, Melbourne, with informed consent from next of kin. Pancreas, islets, acinar and ductal samples from individuals without and with diabetes were obtained as part of research consent tissue through the National Islet Transplantation Program (at Westmead Hospital, Sydney and St. Vincent's Research Institute, Melbourne, Australia), HREC protocol number: 011 / 04. Donor characteristics of islet cell donor isolates are shown in Table 1.

[0339] Table 1. Clinical characteristics of type 1 diabetic and non-diabetic donors

[0340]

[0341] Preparation and culture of isolated human pancreatic cells

[0342] Islets were purified by intraductal perfusion and digestion of pancreas with collagenase AF-1 (SERVA / Nordmark, Germany) (RicordiC et al. Automated method for isolation of human pancreatic islets. Diabetes 37, 413-420 (1988)), followed by Ficoll density gradient purification (Barbaro B et al. Improved human pancreatic islet purification with the refined UIC-UB density gradient. Transplantation 84, 1200-1203 (2007)). Islets were purified from low density gradient fractions and acinar / ductal tissue from high density fractions in Miami medium 1A (Mediatech / Corning 98-021, the United States) supplemented with 2.5% human serum albumin (Australian Red Cross, Melbourne, VIC, Australia) at 37°C, 5% CO2 incubator.

[0343] Gene expression analysis

[0344] Total RNA from isolated human pancreatic cells was isolated using TRIzol (Invitrogen) and RNeasy kit (QIAGEN), including DNase treatment. First-strand cDNA synthesis was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer's instructions. cDNA primers were designed using oligoperfect designer (Thermo Fisher Scientific) as shown in Tables 2 and 3. Briefly, quantitative RT-PCR analysis was performed using the Applied Biosystems 7500 fast real-time PCR system using PrecisionFast 2x qPCR master mix (Primerdesign) and primers. Each qPCR reaction contained: 6.5 μl qPCR master mix, 0.5 μl forward and reverse primers, 3.5 μl H2O, and 2 μl previously synthesized cDNA, diluted 1 / 20. The expression level of a specific gene was tested and normalized relative to the 18s ribosomal RNA housekeeping gene.

[0345] Table 2. Human primer sequences for mRNA expression

[0346]

[0347]

[0348] Table 3. Human primer sequences used for ChIP

[0349] Primer name sequence SEQ ID No. PDX1 PromR1 F ACGTTTCTGCAAAGCTGTCTAGTT 41 PDX1 PromR1 R GGCTTCAAACCATTCAGTAACTTC 42 PDX1 PromR2 F TGGCTGTGAACAAACTTCATAAAT 43 PDX1 PromR2 R CACCGTGGCTTAAAAGTTTCTATT 44 NGN3 PromR1 F TTGCTCCTAGCCTATCTTTCCTTA 45 NGN3 PromR1 R CTTTAGAATTCCTGGACCCTTCTC 46 NGN3 PromR2 F CTTCTGGTCGCCAAGTTCAG 47 NGN3 PromR2 R AGCAGATAAAGCGTGCCAAG 48 INS-IGF2 PromR1 F GGGAACATAGAGAAAGAGGTCTCA 49 INS-IGF2 PromR1 R AATTAATCTCAGCTTCCCCCTAAC 50 INS PromR2 F TTTATAGTCTCAGAGCCCATCTCC 51 INS PromR2 R CCCCTGGTTAAGACTCTAATGACC 52 INS PromR3 F GACCTCATCTTCCGTGTGATCT 53 INS PromR3 R CAGATGACACTATGGGGGTGAT 54

[0350] Histone extraction and quantitative immunoblotting

[0351] The protein signals of trimethylation (H3K27me3) and acetylation (H3K27ac) of histone H3K27 were quantified in human pancreatic ductal epithelial cells (AddexBio) by LI-COR Odyssey. Cells were treated with 5 or 10 μM GSK126 (S7061, Selleckchem) for 48 hours, and histones were prepared using an acid extraction method. Acidic histone extraction and immunoblotting were performed as described previously (Kaipananickal H et al. Targeting Treatment Refractory NET by EZH2 Inhibition in Postural Tachycardia Syndrome. Circ Res 126, 1058-1060 (2020)). Protein concentration was determined using Coomassie reagent (Sigma) with BSA as the standard. Equal amounts (3 μg) of acid extracts were separated by Nu-PAGE (Invitrogen), transferred to PVDF membranes (Immobilon-FL; Millipore), and then probed with antibodies against H3K27me3 (07-449, Millipore), H3K27ac (ab4729, Abcam), and total histone H3 (14269, CellSignaling Technology). Western blot signals were quantified by an infrared imaging system (Odyssey; LI-COR). Total histone H3 signals were used as loading controls to quantify H3K27me3 and H3K27ac signals.

[0352] Chromatin immunoprecipitation

[0353] Chromatin immunoprecipitation assays in human exocrine cells were performed as previously described (Rafehi ​​H et al. Vascular histone deacetylation by pharmacological HDAC inhibition. Genome Res 24, 1271-1284 (2014); Pirola L et al. Genome-wide analysis distinguishes hyperglycemia regulated epigenetic signatures of primary vascular cells. Genome Res 21, 1601-1615 (2011)). Cells were fixed with 1% formaldehyde for 10 minutes and quenched with glycine (0.125 M) solution for 10 minutes. Fixed cells were resuspended in sodium dodecyl (lauryl) sulfate (SDS) lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8.1) including a protease inhibitor cocktail (Roche Diagnostics GmBH, Mannheim, Germany), homogenized, and then incubated on ice for 5 minutes. The soluble samples were sonicated to 200-600 bp, the chromatin was resuspended in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl pH 8.0, and 167 mM NaCl), and 20 μL Protein A (Invitrogen, Carlsbad, CA, USA) and pre-clarification. H3K27me3 antibody was used for immunoprecipitation of chromatin and incubated overnight at 4 ° C (Khurana I et al. SAHA attenuates Takotsubo-like myocardial injury by targeting an epigenetic Ac / Dc axis. Signal Transduct Target Ther 6, 159 (2021)). Immunoprecipitated DNA was collected by magnetic separation, washed with low salt buffer, then washed with high salt buffer, and eluted with 0.1M NaHCO3 containing 1% SDS. Protein-DNA crosslinks were reversed by adding proteinase K (Sigma, St. Louis, MO, USA) and incubating at 62 ° C for 2 hours. DNA was recovered using Qiagen MinElute columns (Qiagen Inc., Valencia, CA, USA). The H3K27me3 content at the promoters of INS, INS-IGF2, NGN3 and PDX1 genes was assessed by qPCR using primers designed from the integrated ENCODE resource (Zhang J et al. An integrative ENCODE resource for cancer genomics. Nat Commun 11, 3696 (2020)).

[0354] Immunohistochemistry

[0355] The localization of insulin and glucagon in human islets was assessed by paraffin sections (5 μm thick) of human pancreatic tissue fixed with 10% neutral buffered formalin and stained with hematoxylin and eosin (H&E) or prepared for immunohistochemistry. Insulin and glucagon were detected using guinea pig anti-insulin (1 / 100, DAKO) or mouse anti-glucagon (1 / 50) mAbs (polyclonal antibodies, Sigma-Aldrich).

[0356] Induction of human pancreatic progenitor cells in vitro

[0357] For pharmacological inhibition of EZH2, human pancreatic exocrine cells were either left untreated or treated with 10 mM GSK126 (S7061, Selleckchem) at 1 × 10 5After 24 hours of treatment, fresh Miami medium was added to the cells, treated again with 10 mM GSK126, and cultured for another 24 hours. All cell incubations were performed in Miami medium 1A (Mediatech / Corning 98-021, USA) supplemented with 2.5% human serum albumin (Australian Red Cross, Melbourne, VIC, Australia) in a cell culture incubator at 37°C in an atmosphere of 5% CO2 for 48 hours using untreated 6-well culture plates (Corning).

[0358] result

[0359] The effects of GSK126 on Nkx6.1, MafA, Pdx1, Ngn3, Sox11, and Sox9 were investigated using isolated human pancreatic tissue from three donors, and the effect of GSK126 on β-cell regeneration was assessed by the increase in insulin (Ins) gene expression.

[0360] Pancreatic specimens were stained with H&E and immunostained for glucagon and insulin from non-diabetic and type 1 diabetic (T1D) donors ( Figure 1 ). Insulin and glucagon expression is indicated by staining in human islets. Note the complete absence of insulin in T1D donors. As expected, insulin mRNA is present in non-diabetic donors, in contrast to its absence in T1D donors. Using qRT-PCR, expression of the progenitor and embryogenesis markers Pdx1, Ngn3, Sox9, and Sox11, as well as specific β-cell markers Pdx1, Ins, Nkx6.1, and MafA mRNA levels were mirrored in naive pancreatic exocrine cells using the same non-diabetic and T1D donors ( Figure 2 ). Li-COR analysis confirmed that GSK126 selectively reduced H3K27me3 levels ( Figure 3 a) and could not affect H3K27ac content ( Figure 3 b).

[0361] Figure 4Pharmacological inhibition of pancreatic exocrine cells from two non-diabetic donors and one type 1 diabetic donor using GSK126 is described. When stimulated with GSK126, the marker genes Pdx1, Ngn3, and Sox9 responsible for maintaining pancreatic progenitor identity were restored, and significant expression of the Ins gene was observed in both non-diabetic and T1D donors. These results may suggest that EZH2 inhibition can restore exocrine pluripotency even in chronic diseases with complete destruction of beta cells. Notably, GSK126 did not significantly alter the expression of the acinar marker Amy2A, the ductal marker Ck19, or the glucose sensor Txnip. Stimulation with GSK126 also increased the expression of the proliferation marker Ki67. This is consistent with the elevated expression of Sox9, a regulator of ductal progenitor expansion and differentiation.

[0362] To determine whether H3K27me3 content on the Ins chromatin domain (Ins and Igf2AS) could influence default transcriptional repression, chromatin immunoprecipitation (ChIP) experiments were performed on exocrine cells derived from non-diabetic donors (2) that were treated with the presence (GSK126) or absence (vehicle control, DMSO) of an EZH2 inhibitor. Proteins were cross-linked to DNA and soluble chromatin separated by ultrasound fractionation. DNA was immunopurified using an antibody that specifically recognizes H3K27me3. DNA was assessed by qPCR using amplicons specifically designed to detect genes in the human Ins chromatin domain. Figure 5 a). In exocrine cells treated with GSK126, a significant decrease in H3K27me3 content was observed in the Ins and Igf2AS promoter (R1-R3) regions ( Figure 5 b). The H3K27me3 promoter content on Ngn3 and Pdx1 promoters was also examined ( Figure 5 c). In non-diabetic exocrine cells, the H3K27me3 content on the Ngn3 promoter of R1 was slightly affected, whereas that of R2 was significantly reduced in cells treated with GSK126 ( Figure 5 d). Pdx1 DNA was recovered equally well from vehicle- and GSK126-treated cells. These results may suggest that the chromatin content of the Ins domain can be characterized by tight epigenetic control of H3K27me3 in human exocrine cells.

[0363] discuss

[0364] In conclusion, the results may suggest that EZH2 inhibitors may be used as epigenetic compounds for β-cell regeneration. These studies not only have direct clinical relevance of the data, but are also important for understanding the gene regulatory mechanisms of pharmacological EZH2 inhibition. Because exocytic Pdx1, Ngn3, Sox9, Sox11 and β-cell-specific markers Nkx6.1, MafA and Ins gene expression were confirmed to be restored ex vivo, it can be predicted that these changes may affect β-cell neogenesis and that GSK126 targeting of refractory EZH2-mediated inhibition ( Figure 6 a). MafA is expressed exclusively in β cells and regulates the expression of genes involved in insulin synthesis and secretion. Nkx6.1 is a lineage-committing factor that drives progenitor cells toward a β cell fate, with expression of Nkx6.1 restricted to β cells and found to be required for normal insulin secretion. Importantly, the results showed that despite complete β cell destruction, the exocrine barrier resulted in a failure to restore core progenitor cell genes that influence plasticity ex vivo ( Figure 6 b). The insulin gene is part of a large chromatin domain associated with histone modifications that regulate gene expression in human pancreatic islets. The assembly of specialized nucleosomal structures on H3K27me3 chromatin suggests that the Ins domain is able to repress transcription more efficiently than conventional or open chromatin in exocrine cells not treated with GSK126 ( Figure 6 c).

[0365] The current results describe the first example of restoration of exocrine transcription of insulin genes, providing distinguishable evidence for β-cell regeneration and possible de novo regeneration, which may have clinical implications for regenerative medicine in the context of T1D. Furthermore, the results also demonstrate that human pancreatic progenitor cells retain their ability to differentiate into new β-cells from the exocrine compartment derived from insulin-deficient T1D donors. These results suggest that pharmacological alteration of cell fate determination by epigenetic induction of pancreatic progenitor cell genes holds promise for the treatment of T1D by promoting ex vivo β-cell regeneration through assisted epigenetic lineage reprogramming.

[0366] Example 2. Effects of ursolic acid and GSK126 on human pancreatic ductal cells

[0367] Human immortalized ductal cell lines (Cat. No.: T0018001, Addexbio) were cultured and assayed in Keratinocyte SFM (Serum Free Medium) (Cat. No. 17005042, ThermoFisherScientific, USA). Pharmacological inhibition of EZH2 and gene expression analysis were performed as described in Example 1. Human immortalized ductal cells were either left untreated or stimulated with ursolic acid (final concentration 1 μM, 2.5 μM or 5 μM) or GSK126 (final concentration 5, 10 or 20 μM).

[0368] Figure 7 Pharmacological inhibition of human immortalized ductal cells using ursolic acid or GSK126 is shown. Ursolic acid and GSK126 stimulate the expression of insulin and Pdx1 as well as the canonical master endocrine progenitor cell determinant Ngn3. These results may suggest that EZH2 inhibition can restore exocrine pluripotency.

[0369] Example 3. Effects of various EZH2 inhibitors on human and marmoset exocrine cells

[0370] Exocrine cells from non-diabetic humans and marmosets were cultured and assayed in Miami / CMRL medium. Human exocrine cells were derived from the Islet Transplantation Unit at St. Vincent's Institute of Medical Research. Marmoset exocrine cells were derived from the Australian Institute of Regenerative Medicine (ARMI) at Monash University. Miami medium is based on CMRL 1066 medium (Connaught Medical Research Lab), supplemented with: insulin, transferrin and selenium (ITS), human serum, vitamin E, sodium pyruvate, zinc and HEPES. Pharmacological inhibition of EZH2 and gene expression analysis were performed as described in Example 1. Human exocrine cells were untreated or stimulated with GSK126 (final concentration 10 μM), CPI-1205 (final concentration 5 μM), ursolic acid (final concentration 5 μM), GSK343 ​​(final concentration 5 μM) or EPZ-6438 (final concentration 5 μM). Marmoset exocrine cells were either untreated or stimulated with GSK126 (final concentration 10 μM) or ursolic acid (final concentration 5 μM).

[0371] Figure 8 Pharmacological inhibition of human exocrine (acinar and ductal) cells from non-diabetic donors using GSK126, CPI-1205, ursolic acid, GSK343 ​​or EPZ-6438 is shown. EZH2 inhibitors stimulate the expression of one, two or all of insulin, Pdx1 and Ngn3. Fig. 9 Pharmacological inhibition of marmoset exocrine (acinar and ductal) cells using GSK126 or ursolic acid is shown. GSK126 and ursolic acid stimulate the expression of insulin and Pdx1. No expansion of Ngn3 was observed. These results may indicate that EZH2 inhibition can restore exocrine pluripotency in human and non-human primate exocrine cells.

[0372] Example 4. Pharmacological inhibition of human EZH2 affects the ability of pancreatic ductal cells to release insulin in vitro and regenerate β-cell-like

[0373] Materials and methods

[0374] Cell culture and EZH2 inhibitor stimulation

[0375] Human pancreatic ductal epithelial cells were purchased from AddexBio and cultured according to the recommended protocol. Cells were cultured in complete keratinocyte serum-free medium (supplemented with human recombinant EGF, bovine pituitary extract, and antibiotic-antimycotic [Gibco]). All cell cultures were grown and maintained in a tissue culture incubator at 37°C, 5% CO2. Once cells reached 70-80% confluence, 0.05% trypsin EDTA (Sigma) was used for passage.

[0376] The EZH2 inhibitors investigated in this study included synthetically designed GSK-126 (S7061, SelleckChem) and EPZ-6438 (S7128, SelleckChem), as well as a naturally occurring compound known to show EZH2 inhibitor activity, triptolide (S3604, SelleckChem). The vehicle control was DMSO. Cells were treated at 2 major time points and harvested after 2 and 7 days.

[0377] For the 2-day time point, cells were inoculated and adhered to the plate for 24 hours. Treatment was started with the first dose prepared in complete K-SFM. The second dose was delivered 24 hours later after the culture medium was replaced. For the longer period of 7 days, cells were initially inoculated in 10 cm plates, and doses were delivered every other day after the initial period of 24 hours. When the plate reached 90% confluence, 0.05% trypsin EDTA (Sigma) was used to passage cells and re-inoculate at a 1:2 dilution. Three days before harvest, cells were passaged and inoculated into cell culture plates according to the application, and finally a 2-day treatment similar to that over 2 24-hour periods was added.

[0378] Quantitative real-time PCR (qRT-PCR) was performed to examine differential gene expression using the following reaction mixture: 5 μL Brailiant II Green QPCR master mix (600903, Agilent Technologies), 2 μL nuclease-free water, 2 μL template cDNA and 0.5 μL forward and reverse primers from oligoperfect designer (Thermo Fisher Scientific), see Table 1 for details. qRT-PCR cycles were performed using the Applied Biosystems 7500 fast real-time PCR system, and each reaction consisted of: a hot start at 95°C for 3 minutes, followed by 40 cycles of 5 seconds at 95°C and 15 seconds at 60°C. The Ct values ​​of the experimental genes were normalized to the housekeeping gene H3F3A. The fold change in mRNA abundance was calculated by normalizing the values ​​of drug treatment to the vehicle control.

[0379] RNA extraction and quantitative RT-PCR

[0380] TRIzol was used to extract 5 × 10 5 Total RNA was extracted from each cell, and the 12-well plate was untreated (vehicle control DMSO) or incubated with EZH2 inhibitor for 2 days and 7 days. According to the manufacturer's instructions, RNA was isolated using RNeasy kit. After RNA concentration was measured using QIAxpert system, 1 μg RNA was used for cDNA synthesis by high-capacity cDNA reverse transcription kit (Applied Biosystems). The resulting cDNA reaction mixture was diluted with 1:6 to form the final template cDNA used subsequently.

[0381] Quantitative real-time PCR (qRT-PCR) was performed using the following reaction mixture to examine differential gene expression: 5 μL Brailiant II SYBRR Green QPCR master mix (600903, Agilent Technologies), 2 μL nuclease-free water, 2 μL template cDNA, and 0.5 μL forward and reverse primers from oligoperfect designer (Thermo Fisher Scientific), see Table 4 for details. qRT-PCR cycles were performed using the Applied Biosystems 7500 Fast Real-Time PCR System, and each reaction consisted of: a hot start at 95°C for 3 minutes, followed by 40 cycles of 5 seconds at 95°C and 15 seconds at 60°C. The Ct values ​​of the experimental genes were normalized to the housekeeping gene H3F3A. The fold change in mRNA abundance was calculated by normalizing the values ​​of drug treatment to the vehicle control.

[0382] Table 4. Human primers used for qRT-PCR

[0383]

[0384]

[0385] Quantitative PCR Chromatin Immunoprecipitation (q-PCR ChIP)

[0386] Place approximately 5×10 6Cells were fixed in 1% formaldehyde for 10 minutes and incubated in 0.125M glycine for 10 minutes to quench the cross-linking reaction. The fixed cell pellet was lysed after resuspending and homogenizing in sodium dodecyl (lauryl) sulfate (SDS) lysis buffer (1% SDS, 10mM EDTA, 50mM Tris-HCl pH 8.1) containing a protease inhibitor cocktail (Roche Diagnostics GmBH, Mannheim, Germany). The samples were incubated on ice for 5 minutes and then sonicated to shear the chromatin between 200-600bp. The sonicated chromatin was resuspended in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2mM EDTA, 16.7mM Tris-HCl pH8.0 and 167mM NaCl). 20 μl DynabeadsR protein A (Invitrogen, Carlsbad, CA, USA) was added to each sample and pre-clarified. As previously described, incubation with H3K27me3 or H3K9 / 14ac antibodies at 4 ° C overnight for chromatin immunoprecipitation. The immunoprecipitate was collected by magnetic separation and washed with low salt and high salt buffers in sequence. The immunoprecipitated DNA was then eluted from the solution with 0.1M NaHCO3 containing 1% SDS. Protein-DNA crosslinking was reversed by incubating the sample at 62 ° C for 2 hours in proteinase K (Sigma, St. Louis, MO, USA). DNA was purified using Qiagen MinElute columns (Qiagen Inc., Valencia, CA, USA). Using primers designed from integrated ENCODE resources, the H3K27me3 or H3K9 / 14ac content at the promoters of INS-IGF2, NGN3 and PDX1 genes was evaluated by qPCR. ChIP primers are shown in Table 5.

[0387] Table 5. Human primers for q-PCR ChIP

[0388]

[0389] Western blotting

[0390] From each sample 1×10 6Histones were extracted from 100 cells. Acid extraction and immunoblotting of nuclear proteins were performed as previously described (Kaipananickal H et al. Targeting treatment refactory NET by EZH2 inhibition in postural tachycardiasyncrome. Circ Res, 126(8)(2020)). The protein content of the samples was incubated with Bradford reagent (Sigma), and standard concentrations of BSA were used to determine the concentration. 1 μg of protein per sample was run on a 4-12% gel (Nu-Page, Invitrogen) before transfer to a PVDF membrane. The membrane (Immobilon-FL; Millipore) was incubated overnight in primary antibodies against H3 (1B1B2, CST), H3K27ac (ab4729, Abcam), EZH2 (#4905, CST), β-actin (ab8226, Abcam), and H3K27me3 (07-229, Millipore) (dilutions are listed in Table 3). The membrane was incubated in secondary antibodies and imaged using the LiCoR Odyssey infrared system. Total H3 or β-actin was used as a loading control and protein bands were quantified using Image studio.

[0391] Immunofluorescence

[0392] 20×10 4 Cells were seeded on 15 mm coverslips in 24-well plates and treated with EZH2 inhibitors or vehicle controls for 2 or 7 days. Cells were fixed in 4% PFA. Cells were permeabilized for 10 minutes using 0.1% Triton X diluted in PBS and then blocked in a solution of 0.2% gelatin, 2.5% bovine serum albumin prepared in PBS (PBG). Primary antibodies against CK19 (HPA002465, Sigma-Aldrich) and INS (A0564, DAKO) were prepared in PBG according to the dilutions listed in Table 6 and incubated overnight at 4°C. Coverslips were washed and incubated with antibodies against rabbit (Alexa Fluor 488) and goat ( 680CW) (dilution in Table 6) was incubated for 1 hour at room temperature. The cells were then washed and incubated for 10 minutes with 4',6-diamidino-2-phenylindole (DAPI) as a nuclear counterstain (1:100 dilution from 10 μg / ml stock; D8417 Sigma-Aldrich) before mounting with Prolong Gold Anti-Fade mounting medium with DAPI (ThermoFisher). The slides were observed and images were obtained from EVOS (ThermoFisher) using TagBFP, Cy5 and GFP filters. Images were processed using Image J.

[0393] Table 6. Antibody dilutions used for Western blotting and immunofluorescence staining of human pancreatic ductal epithelial cells

[0394]

[0395] Glucose-stimulated insulin secretion assay

[0396] 5×10 5 Cells were seeded in 12-well plates and allowed to adhere for 24 hours. In view of the relatively high concentration of insulin in KSFM, cells were washed and cultured with CMRL-complete (CMRL 1066 supplemented with antibiotic-antimycotic [Gibco] and Glutamax [Gibco]) to reduce the background insulin concentration of ELISA. Cells were stimulated with EZH2 inhibitors or vehicle control (DMSO) for 2 or 7 days, then washed twice with 2.8mM glucose Krebs buffer (25mM HEPES, 115mM sodium chloride, 24mM sodium bicarbonate, 5mM potassium chloride, 1mM magnesium chloride heptahydrate, 0.1% bovine serum albumin and 2.5mM calcium chloride dihydrate prepared in deionized water), and incubated for 1 hour to obtain low glucose (basal) insulin secretion. Cells were then cultured in 28mM (high) glucose Krebs buffer and incubated for 1 hour to obtain glucose-stimulated insulin secretion. Supernatants were collected and the concentration of insulin was determined using an ultrasensitive insulin ELISA (Mercodia) according to the manufacturer's instructions. The fold change in insulin secreted by cells compared to the control was calculated by adjusting the insulin concentration of cells stimulated with the EZH2 inhibitor.

[0397] result

[0398] To examine whether pharmacological EZH2 inhibition could affect the terminal differentiation state, adult human pancreatic ductal epithelial cells were stimulated with GSK-126, EPZ6438, and triptolide for 2 and 7 days ( Fig.10The genes studied included those important during endocrine development, as well as those involved in the expression of ductal and beta cell identity retention after development. Culturing pancreatic ductal cells with GSK-126, EPZ6438, and triptolide for 2 days significantly increased NGN3 mRNA levels ( Fig.10 a). Further increases were observed on day 7 for GSK-126 and triptolide. After 2 days of GSK-126 stimulation, α-amylase (AMY2A) transcripts increased significantly, while all EZH2 inhibitors significantly increased AMY2A mRNA levels ( Fig.10 d). After 2 days of treatment, cytoplasmic CK19 decreased ( Fig.10 e), showing a statistically significant decrease after stimulation with GSK-126 and triptolide. Although EPZ-6438 showed an increase at the day 2 time point, CK19 expression levels were significantly reduced by day 7, matching the decreases observed with the other compounds ( Fig.10 E). Inhibition of EZH2 in pancreatic ductal cells stimulates unprocessed heterogeneous nuclear forms ( Fig.10 f) and mature mRNA ( Fig.10 g). Transcriptional changes showed similar trends, increasing after 2 days of treatment when stimulated with GSK-126, EPZ-6438, and triptolide. The increase in gene expression was maintained at day 7, with even further increases with triptolide and GSK-126. V-maf aponeurotic fibrosarcoma oncogene homolog A or MAFA mRNA levels increased in a statistically significant manner only at the 2-day time point after treatment with GSK-126 and triptolide ( Fig.10 g). While the fold change was stable at day 7 for GSK-126 treatment compared to vehicle treatment, EPZ-6438 similarly began to induce a statistically significant increase in MAFA transcripts.

[0399] Example 5. H3K27me3 content in endocrine genes is reduced after EZH2 inhibition

[0400] To confirm that the EZH2 inhibitor acts to reduce EZH2 activity within nuclear chromatin, histones were acid-extracted from pancreatic ductal cells and analyzed for H3K27me3 and H3K27ac content relative to total H3 extracted ( Fig.11 a). Lack of changes in H3K27ac between EZH2i treatment and control ( Fig.11 b and c). After 2 days, the drug significantly reduced H3K27me3 in pancreatic ductal cells compared with vehicle-treated controls ( Fig.11 b and d). Prolonged stimulation for 7 days further reduced H3K27me3 in the presence of GSK126 and EPZ6438 ( Fig.11b and d).

[0401] Given that EZH2 is involved in writing H3K27me3 associated with gene repression, we assessed whether gene expression caused by EZH2 inhibitor treatment would affect the H3K27me3 content of the genes of interest. H3K27me3-associated chromatin was immunopurified (ChIP) from pancreatic ductal cells. H3K27me3 content was assessed by qPCR using primers specifically designed to detect the promoter regions of INS, the endocrine master regulator NGN3, and the β-cell marker PDX1. Fig.12 a). ChIP showed that GSK-126 significantly reduced the H3K27me3 content of chromatin associated with the INS promoter domain as well as NGN3 and PDX1 ( Fig.12 b). In addition, triptolide also confirmed these results. EPZ-6438 reduced the H3K27me3 content of PDX1 on day 7 ( Fig.12 c). Furthermore, the lack of changes in H3K9 / 14 acetylation (H3K9 / 14ac) demonstrated the specificity of EZH2i in modulating trimethylation signaling in HPDE cells, which further correlated with the lack of changes assessed by western blotting ( Fig.14 ).

[0402] Example 6. EZH2 inhibition stimulates insulin expression in human pancreatic ductal epithelial cells

[0403] In order to determine whether the increased INS and CK19 gene expression indicates the functional synthesis of proteins, cells stimulated with EZH2 inhibitors for 2 days and 7 days were stained using immunofluorescence of INS and CK19, with DAPI used as a control nuclear stain (data not shown). As expected, nuclear stain DAPI was imaged in stained cells. All stained cells were positive for CK19, indicating their ductal cell identity. Importantly, the pancreatic ductal cell population was positive for insulin, which was not present in the DMSO control, as indicated by the lack of signal in the control cells when insulin was imaged. An average of 3 in 20,000 cells was observed in cells stimulated by GSK-126 and EPZ-6438. After 7 days, the number of insulin-positive cells increased overall, with an average of 7 in 20,000 cells per treatment (data not shown). Similarly, these cells were positive for DAPI and CK19 staining, confirming their identity as pancreatic ductal cells.

[0404] Example 7. Human pancreatic ductal epithelial cells are able to release insulin

[0405] Since insulin was detected by pharmacological EZH2 inhibition, we assessed glucose-stimulated insulin secretion (GSIS). To confirm the specificity of the assay, RT-qPCR ( Fig.13a) and Western blot ( Fig.13 b) Determine basal and stimulated levels of EZH2 and H3K27me3. In addition, after 1 hour incubation in high glucose, there was no change in mRNA levels of histone acetyltransferase P300, KAT2, and chromatin remodeler BRG1. There was no change in EZH2 expression or protein levels, as demonstrated by no change in trimethylation after exposure to high glucose, thus confirming that any subsequent changes in insulin concentrations were due to EZH2i stimulation. GSIS assays were performed after EZH2i stimulation ( Fig.13 c) to examine whether those pancreatic ductal cells that produce insulin have the ability to produce insulin when incubated for 1 hour under basal (2.8 mM glucose) or stimulated (28 mM glucose) conditions. After incubation in high glucose medium, a significant increase in insulin concentration was observed from human pancreatic ductal epithelial cells stimulated with GSK-126, EPZ6438, and triptolide ( Fig.13 d), which was not observed in control DMSO-treated cells. Insulin release was also sustained on day 7 using GSK126 and triptolide ( Fig.13 e).

Claims

1. A method for producing insulin-producing cells from pancreatic exocrine cells, the method comprising: - contacting a pancreatic exocrine cell or a cell population comprising pancreatic exocrine cells with an EZH2 inhibitor for a sufficient period of time and under conditions to allow generation of insulin-producing cells from said pancreatic exocrine cells, Thereby, insulin-producing cells or a cell population comprising insulin-producing cells are produced.

2. The method of claim 1, wherein the insulin-producing cells are characterized by increased expression of one or more pancreatic progenitor cell markers relative to pancreatic exocrine cells that have not been contacted with the EZH2 inhibitor. 3 . The method of claim 2 , wherein the one or more pancreatic progenitor cell markers are selected from the group consisting of Pdx1, Ngn3, Sox9 and Sox11.

4. The method of any one of claims 1 to 3, wherein the insulin-producing cells are characterized by increased expression of one or more beta cell markers relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor.

5. The method of claim 4, wherein the one or more β cell markers are selected from Nkx6.1, MafA, Ins hnRNA and Ins.

6. The method of any one of claims 1 to 5, wherein the insulin-producing cells are characterized by increased expression of one or more proliferation genes relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor.

7. The method of claim 6, wherein the one or more proliferation genes comprises Ki67.

8. The method of any one of claims 1 to 7, wherein the insulin-producing cells are characterized by increased expression of one or more of Pdx1, Ngn3, Sox9, Sox11, Nkx6.1, MafA, Ins, Ins hnRNA, and Ki67 relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor.

9. The method of any one of claims 1 to 8, wherein the insulin-producing cells are characterized by no change in expression of one or more of the following: one or more ductal markers; one or more acinar markers; and one or more glucose sensor markers relative to pancreatic exocrine cells not contacted with the EZH2 inhibitor.

10. The method of claim 9, wherein one or more of the following applies: the one or more ductal markers comprise Ck19; the one or more acinar markers comprise Amy2A; and the one or more glucose sensor markers comprise Txnip.

11. The method according to any one of claims 1 to 10, wherein the insulin-producing cells are capable of secreting insulin when stimulated with glucose.

12. The method of claim 11, wherein the insulin-producing cells are capable of repetitive glucose-stimulated insulin secretion (GSIS).

13. The method according to any one of claims 1 to 12, wherein the insulin-producing cells are β cells or β cell-like cells.

14. The method of any one of claims 1 to 13, wherein the pancreatic exocrine cells are acinar cells or ductal cells.

15. The method of claim 14, wherein the pancreatic exocrine cells are ductal cells.

16. The method of any one of claims 1 to 13, wherein the cell population comprising pancreatic exocrine cells comprises or consists of one or both of acinar cells and ductal cells.

17. The method of claim 16, wherein the cell population consists of ductal cells.

18. The method according to any one of claims 1 to 17, wherein the pancreatic exocrine cells or the cell population comprising the pancreatic exocrine cells are obtained from pancreatic tissue.

19. The method of claim 18, wherein the pancreatic tissue comprises or consists of pancreatic exocrine cells.

20. The method of claim 18 or claim 19, wherein the pancreatic tissue comprises or consists of mature terminally differentiated pancreatic cells.

21. The method of any one of claims 1 to 20, wherein the EZH2 inhibitor directly inhibits the enzymatic activity of EZH2.

22. The method of claim 21, wherein the EZH2 inhibitor occupies the site of the co-substrate S-adenosylmethionine (SAM) in the EZH2 binding pocket.

23. The method of claim 21 or claim 22, wherein the EZH2 inhibitor competes with SAM for binding to EZH2.

24. The method according to any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound having the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

25. The method according to any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound of formula (I): in: X and Z are independently selected from the group consisting of hydrogen, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, unsubstituted or substituted (C3-C8)cycloalkyl, unsubstituted or substituted (C3-C8)cycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl-(C1-C8)alkyl or -(C2-C8)alkenyl, (C6-C8)cycloalkenyl, 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl or -(C2-C8)alkenyl, halo, cyano, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, NR a R b NR a C(O)R b NR a C(O)NR a R b 、-NR a C(O)OR a 、-NR a S02R b NR a SO2NR a R b NR a NR a R b NR a NR a C(O)R b 、-NR a NR a C(O)NR a R b 、-NR a NR a C(O)OR a 、-OR a , -OC(O)R a and -OC(O)NR a R b ; Y is H or halo; R 1 is (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, unsubstituted or substituted (C3-C8)cycloalkyl, unsubstituted or substituted (C3-C8)cycloalkyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl, unsubstituted or substituted (C5-C8)cycloalkenyl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted (C6-C 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl or -(C2-C8)alkenyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl or -(C2-C8)alkenyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl or -(C2-C8)alkenyl, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b ; R 2 is hydrogen, (C1-C8)alkyl, trifluoromethyl, alkoxy or halo, wherein the (C1-C8)alkyl may be substituted by one to two groups selected from the group consisting of amino and (C1-C3)alkylamino; R 7 is hydrogen, (C1-C3) alkyl or alkoxy; R 3 is hydrogen, (C1-C8) alkyl, cyano, trifluoromethyl, -NR a R b or halogen; R 6 is selected from the group consisting of hydrogen, halogen, (C1-C8) alkyl, (C2-C8) alkenyl, -B(OH)2, substituted or unsubstituted (C2-C8) alkynyl, unsubstituted or substituted (C3-C8) cycloalkyl, unsubstituted or substituted (C3-C8) cycloalkyl-(C1-C8) alkyl, unsubstituted or substituted (C5-Cg) cycloalkenyl, unsubstituted or substituted (C5-C8) cycloalkenyl-(C1-C8) alkyl, (C6-C 10 )bicycloalkyl, unsubstituted or substituted heterocycloalkyl, unsubstituted or substituted heterocycloalkyl-(C1-C8)alkyl, unsubstituted or substituted aryl, unsubstituted or substituted aryl-(C1-C8)alkyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heteroaryl-(C1-C8)alkyl, cyano, -COR a 、-CO2R a 、-CONR a R b 、-CONR a NR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, -NR a R b 、-NR a C(O)R b NR a C(O)NR a R b NR a C(O)OR a NR a S02R b NR a SO2NR a R b 、-NR a NR a R b 、-NR a NR a C(O)R b 、-NR a NR a C(O)NR a R b NR a NR a C(O)OR a 、-OR a 、-OC(O)R a 、-OC(O)NR a R b ； wherein any (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, cycloalkyl, cycloalkenyl, bicycloalkyl, heterocycloalkyl, aryl or heteroaryl is optionally substituted with 1, 2 or 3 groups independently selected from the group consisting of: -O(C1-C6)alkyl (Rc) 1-2 、-S(C1-C6)alkyl(R c ) 1-2 、-(C1-C6)alkyl(R c ) 1-2 , (C1-C8) alkyl-heterocycloalkyl, (C3-C8) cycloalkyl-heterocycloalkyl, halo, (C1-C6) alkyl, (C3-C8) cycloalkyl, (C5-C8) cycloalkenyl, (C1-C6) haloalkyl, cyano, -COR a 、-CO2R a 、-CONR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, -NR a R b NR a C(O)R b 、-NR a C(O)NR a R b 、-NR a C(O)OR a NR a S02R b NR a SO2NR a R b 、-OR a 、-OC(O)R a 、-OC(O)NR a R b , heterocycloalkyl, aryl, heteroaryl, aryl(C1-C4)alkyl and heteroaryl(C1-C4)alkyl; wherein any aryl or heteroaryl portion of the aryl, heteroaryl, aryl(C1-C4)alkyl or heteroaryl(C1-C4)alkyl is optionally substituted with 1, 2 or 3 groups independently selected from the group consisting of halo, (C1-C6)alkyl, (C3-C8)cycloalkyl, (C5-C8)cycloalkenyl, (C1-C6)haloalkyl, cyano, -COR a 、-CO2R a 、-CONR a R b 、-SR a 、-SOR a 、-SO2R a 、-SO2NR a R b , nitro, NR a R b NR a C(O)R b NR a C(O)NR a R b NR a C(O)OR a 、-NR a S02R b NR a SO2NR a R b 、-OR a 、-OC(O)R a and -OC(O)NR a R b ; Each R° is independently (C1-C4)alkylamino, -NR a S02R b 、-SOR a 、-SO2R a 、-NR a C(O)OR a 、-NR a R b or -CO2R a ; R a and R b are each independently hydrogen, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, (C3-C8)cycloalkyl, (C5-C8)cycloalkenyl, (C6-C 10 )bicycloalkyl, heterocycloalkyl, aryl, heteroaryl, wherein the (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, cycloalkyl, cycloalkenyl, bicycloalkyl, heterocycloalkyl, aryl or heteroaryl is optionally substituted with 1, 2 or 3 groups independently selected from the group consisting of halo, hydroxy, (C1-C4)alkoxy, amino, (C1-C4)alkylamino, ((C1-C4)alkyl)((C1-C4)alkyl)amino, -CO2H, -CO2(C1-C4)alkyl, -CONH2, -CONH(C1-C4)alkyl, -CON((C1-C4)alkyl)((C1-C4)alkyl), -SO2(C1-C4)alkyl, -SO2NH2, -SO2NH(C1-C4)alkyl or -SO2N((C1-C4)alkyl)((C1-C4)alkyl); or R a and R b together with the nitrogen to which they are attached represent a 5-8 membered saturated or unsaturated ring, optionally containing additional heteroatoms selected from oxygen, nitrogen and sulfur, wherein the ring is optionally substituted by 1, 2 or 3 groups independently selected from (C1-C4)alkyl, (C1-C4)haloalkyl, amino, (C1-C4)alkylamino, ((C1-C4)alkyl)((C1-C4)alkyl)amino, hydroxy, oxo, (C1-C4)alkoxy and (C1-C4)alkoxy(C1-C4)alkyl, wherein the ring is optionally fused to a (C3-C8)cycloalkyl, heterocycloalkyl, aryl or heteroaryl ring; or R a and R b Together with the nitrogen to which they are attached represent a 6- to 10-membered bridged bicyclic ring system optionally fused to a (C3-C8)cycloalkyl, heterocycloalkyl, aryl or heteroaryl ring; or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

26. The method of claim 25, wherein the compound of formula (I) has the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

27. The method according to any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound having the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

28. The method of any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound having the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

29. The method according to any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound having the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

30. The method of any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound having the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

31. The method of any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound having the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

32. The method of any one of claims 1 to 23, wherein the EZH2 inhibitor is a compound having the following structure: or a stereoisomer, tautomer, hydrate, solvate or salt thereof, in particular a pharmaceutically acceptable salt, or a mixture thereof.

33. The method according to any one of claims 1 to 32, wherein the method further comprises the step of administering the insulin-producing cells or the cell population comprising the insulin-producing cells to an individual.

34. The method of claim 33, wherein the pancreatic exocrine cells from which the insulin-producing cells are derived are obtained from the individual.

35. The method of claim 33 or claim 34, wherein the individual has diabetes or is pre-diabetic.

36. The method of claim 35, wherein the diabetes is selected from type 1 diabetes, type 2 diabetes, and gestational diabetes.

37. An insulin-producing cell or a cell population comprising insulin-producing cells produced by the method according to any one of claims 1 to 36.

38. Use of an EZH2 inhibitor in the preparation of a composition for producing insulin-producing cells from pancreatic exocrine cells.

39. An EZH2 inhibitor for use in producing insulin-producing cells from pancreatic exocrine cells.

40. A method for preventing or treating a disease involving dysfunctional insulin production, the method comprising: - administering to an individual in need thereof a cell population comprising insulin-producing cells according to claim 37 or produced by the method according to any one of claims 1 to 36, Thereby preventing or treating the disease.

41. The method of claim 40, wherein the disease involving dysfunctional insulin production is selected from the group consisting of diabetes and prediabetes.

42. The method of claim 41, wherein the diabetes is selected from type 1 diabetes, type 2 diabetes, and gestational diabetes.

43. The method of any one of claims 40 to 42, wherein the pancreatic exocrine cells from which the insulin-producing cells of the cell population are derived are from pancreatic tissue obtained from the individual.

44. The method of any one of claims 40 to 43, wherein the cell population comprising the insulin-producing cells is delivered to the pancreas of the individual.

45. Use of an insulin-producing cell or a cell population comprising insulin-producing cells according to claim 37 or produced by a method according to any one of claims 1 to 36 in the preparation of a composition for preventing or treating a disease involving dysfunctional insulin production in an individual.

46. ​​An insulin-producing cell or a cell population comprising insulin-producing cells according to claim 37 or produced by a method according to any one of claims 1 to 36 for use in preventing or treating a disease involving dysfunctional insulin production in an individual.

47. A method for preventing or treating a disease involving dysfunctional insulin production, the method comprising: - administering an EZH2 inhibitor to an individual in need thereof such that the EZH2 inhibitor is in contact with pancreatic exocrine cells of the individual for a sufficient period of time and under conditions to allow the generation of insulin-producing cells from the pancreatic exocrine cells, Thereby preventing or treating the disease in the individual.

48. The method of claim 47, wherein the disease involving dysfunctional insulin production is selected from the group consisting of diabetes and prediabetes.

49. The method of claim 48, wherein the diabetes is selected from type 1 diabetes, type 2 diabetes, and gestational diabetes.

50. The method according to any one of claims 47 to 49, wherein the EZH2 inhibitor is as defined in any one of claims 21 to 32.

51. Use of an EZH2 inhibitor in the preparation of a composition for preventing or treating a disease involving dysfunctional insulin production in a subject, wherein the EZH2 inhibitor is contacted with pancreatic exocrine cells of the subject for a sufficient period of time and under conditions to allow for the generation of insulin-producing cells from the pancreatic exocrine cells.

52. An EZH2 inhibitor for use in preventing or treating a disease involving dysfunctional insulin production in a subject, wherein the EZH2 inhibitor is contacted with pancreatic exocrine cells of the subject for a sufficient period of time and under conditions to allow for the generation of insulin-producing cells from the pancreatic exocrine cells.

Images