A method for culturing tumor tissues and analyzing extracellular vesicle typing in a microfluidic chip

By employing a dual-aptamer probe and molecular beacon strategy within a microfluidic chip, the accuracy of extracellular vesicle separation and analysis in tumor tissue was addressed. This enabled efficient typing and capture of vesicles from different cell sources within tumor tissue, thereby improving the accuracy and physiological representativeness of the analysis.

CN119736245BActive Publication Date: 2026-03-27XIAMEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411935507.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-26
Publication Date
2026-03-27
Estimated Expiration
2044-12-26

AI Technical Summary

Technical Problem

Existing technologies cannot effectively analyze extracellular vesicles from different cell sources in tumor tissues, and traditional methods may lead to reduced vesicle activity and loss of biological properties, making it impossible to accurately understand the biological mechanisms of intercellular communication.

Method used

Employing microfluidic chip technology and utilizing a dual-switch strategy of aptamer probes and molecular beacons, this method identifies extracellular vesicles derived from tumor cells and immune cells by recognizing PD-L1 and EpCAM protein markers and combining them with a linker arm, thus achieving typing analysis and avoiding enzymatic digestion and high shear force damage.

Benefits of technology

It enables efficient capture and subtyping analysis of extracellular vesicles secreted by tumor tissue in a simulated tumor microenvironment, reducing losses, improving analytical accuracy, avoiding false positive signals, and simulating extracellular vesicle analysis under physiological conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736245B_ABST
    Figure CN119736245B_ABST
Patent Text Reader

Abstract

The application discloses a tumor tissue culture and extracellular vesicle typing analysis method in a microfluidic chip, which comprises the following steps: step one, providing two aptamer probes, including an aptamer PD-L1-L (modified second fluorescent group) combined with a PD-L1 protein, an aptamer EpCAM-L combined with an EpCAM protein, and a connecting arm (containing a fluorescent quenching group and a first fluorescent group); step two, culturing tumor tissues in the chip, and capturing extracellular vesicles secreted by the tumor tissues through the modified antibodies on the chip; and step three, incubating the tumor tissues and the two aptamer probes, and then incubating the connecting arm, so that a first fluorescence recovery and a second fluorescence quenching double-switch mode are generated, so that the extracellular vesicles from tumor cells are identified; the second fluorescence of the immune cell PD-L1-L is kept, and the first fluorescence of the connecting arm is quenched, so that the extracellular vesicle typing analysis of the tumor tissues is performed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip. Background Technology

[0002] Extracellular vesicles are vesicles secreted by cells and enclosed by a lipid bilayer. They contain protein markers, nucleic acids, lipids, and other molecules, which play important roles in intercellular communication mediated by extracellular vesicles, thereby regulating various biological processes. Current methods for studying tumor extracellular vesicles mostly involve isolating and detecting total extracellular vesicles from tumor cell culture supernatants or body fluids (blood, urine, breast milk, tears). However, tumor cells undergo genetic changes during long-term culture. Furthermore, cell culture provides a single source of extracellular vesicles, missing the influence of interactions with other symbiotic cells in tumor tissue. Tumor-associated extracellular vesicles in body fluids are diluted and remodeled through fluid circulation, leading to differences in biological properties compared to those in tumor tissue. Therefore, the isolation and analysis of extracellular vesicles from tumor tissue is crucial for understanding the mechanisms of tumor development and progression. Current methods for isolating and analyzing extracellular vesicles in tumor tissues mainly involve enzymatic digestion and ultracentrifugation to obtain total extracellular vesicles and then performing biomarker analysis. These methods may lead to reduced extracellular vesicle activity and loss of some biological properties, failing to represent the state of extracellular vesicles in physiological tumor tissues. Furthermore, analyzing total extracellular vesicles cannot distinguish their origin, limiting our understanding of the biological mechanisms of communication between extracellular vesicles secreted by different cells in tumor tissues. Therefore, there is a need to develop a method for typing and analyzing extracellular vesicles from different cell sources in tumor tissues.

[0003] Currently, there is no suitable device for analyzing extracellular vesicles of different cell origins in tumor tissue. Summary of the Invention

[0004] The main objective of this invention is to provide a method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip.

[0005] The technical solution adopted by this invention to solve its technical problem is:

[0006] A method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip includes the following steps:

[0007] Step 1: Provide two aptamer probes and one linker arm. The two aptamer probes are PD-L1-L, which recognizes PD-L1 protein, and EpCAM-L, which recognizes EpCAM protein. Each aptamer has a sequence that binds to the target protein and a DNA extension strand. The two DNA extension strands are complementary to a DNA sequence of the linker arm. The linker arm is a hairpin structure and is modified with a quenching group and a first luminescent group. The PD-L1-L aptamer probe is modified with a second luminescent group.

[0008] Step two involves culturing tumor tissue in a microfluidic chip and capturing extracellular vesicles secreted by the tumor tissue using capture molecules modified on the chip.

[0009] Step 3: After incubating the captured extracellular vesicles and two aptamer probes, the unbound probes are washed away, and then incubated with the linker arm. Tumor cells are double-positive for PD-L1 and EpCAM and bind to the PD-L1-L and EpCAM-L aptamers. When incubated with the linker arm, the hairpin structure of the linker arm is opened due to the complementarity of the partial sequences of PD-L1-L and EpCAM-L with the linker arm, and the first fluorescence is restored. At the same time, the quenching group on the linker arm is adjacent to the second fluorescent molecule on PD-L1-L, quenching the second fluorescence. This produces a double-switch mode of first fluorescence restoration and second fluorescence quenching, thus identifying extracellular vesicles derived from tumor cells. Immune cells are PD-L1 positive and can only bind to the PD-L1-L aptamer, but not the EpCAM-L aptamer. When incubated with the linker arm, the hairpin structure of the linker arm cannot be opened. Therefore, the second fluorescence of PD-L1-L is maintained, and the first fluorescence of the linker arm is quenched, thus identifying them as extracellular vesicles derived from immune cells.

[0010] Furthermore, in step one, the first sequence on the connector arm that is complementary to the aptamer probe PD-L1-L, and the second sequence on the connector arm that is complementary to the aptamer probe EpCAM-L, do not overlap.

[0011] Furthermore, in step two, the microfluidic chip comprises, from top to bottom, a top layer, a tissue culture layer, a fluid layer, and a trapping layer: wherein,

[0012] The top layer has a probe inlet in the middle, a top layer fluid inlet in the left half, and a top layer fluid outlet in the right half.

[0013] The tissue culture layer has a tumor tissue culture area and two fluid vias. The tumor tissue culture area is connected to the probe inlet of the top layer. One of the two fluid vias is connected to the fluid inlet of the top layer, and the other is connected to the fluid outlet of the top layer.

[0014] The fluid layer has a left shunt zone on the left half and a right shunt zone on the right half; the left shunt zone is connected to the fluid vias on the left side of the tissue culture layer and to the fluid vias on the left side of the tumor tissue culture area, and the right shunt zone is connected to the fluid vias on the right side of the tissue culture layer and to the fluid vias on the right side of the tumor tissue culture area; a capture hole is provided in the middle of the fluid layer; the capture hole corresponds to the position of the tumor tissue culture area.

[0015] The capture layer has a capture area, and the position of the capture area corresponds to the capture hole.

[0016] Furthermore, in step two, the capturing molecules modified on the chip are located in the capturing region.

[0017] Furthermore, in step two, the capture molecules modified in the capture region include antibodies, peptides, or nucleic acid aptamers.

[0018] Furthermore, the capture molecules include antibodies, peptides, or nucleic acid aptamers that specifically recognize CD63, CD81, or CD9.

[0019] Furthermore, the tumor tissue culture area extends to the left with multiple strip-shaped grooves, which form a comb-shaped left transition area; the culture area extends to the right with multiple strip-shaped grooves, which form a comb-shaped right transition area.

[0020] Furthermore, the left diversion zone includes a left-side stem and a right-side diversion zone; the stem covers the left fluid passage; the diversion zone is a comb-like structure composed of multiple left-right oriented strip grooves. The location of this diversion zone corresponds to the location of the left transition zone.

[0021] Furthermore, the right diversion zone includes a diversion zone on the left and a handle on the right; the handle covers the right fluid passage; the diversion zone is a comb-like structure composed of multiple strip grooves distributed in the left-right direction; the position of this diversion zone corresponds to the position of the right transition zone.

[0022] Compared with the prior art, this technical solution has the following advantages:

[0023] 1. This invention develops a dual-switch strategy based on aptamers and molecular beacons for the capture and typing analysis of extracellular vesicles in tumor tissue. Tumor tissue is cultured and extracellular vesicles secreted by the tumor tissue are captured. The extracellular vesicles are then identified through tumor cell-derived extracellular vesicles (PD-L1). + EpCAM + ) and extracellular vesicles derived from immune cells (PD-L1) + EpCAM -Based on the different expression levels of surface markers, we designed the PD-L1 protein recognition aptamer PD-L1-L, the EpCAM protein recognition aptamer EpCAM-L, and the molecular beacon Connector. When the DNA probe recognizes extracellular vesicles, the fluorescence of the Cy5-PD-L1-L aptamer from tumor cell-derived extracellular vesicles is quenched, while the fluorescence signal of the Connector is restored. However, extracellular vesicles from immune cells do not respond, thus enabling the typing analysis of the two types of extracellular vesicles in tumor tissue.

[0024] 2. The advantages of the method of this invention also lie in the following: First, it uses tissue culture in a microfluidic chip to obtain extracellular vesicles in the tumor microenvironment, avoiding cell damage caused by digestive enzymes and thus better simulating the tumor microenvironment. Second, directly capturing extracellular vesicles secreted by tumor tissue in the microfluidic chip minimizes the loss of extracellular vesicles caused by differential centrifugation. Furthermore, using a dual-aptamer and dual-switch strategy allows for the typing analysis of extracellular vesicles from different cell sources, avoiding false positive signals that can be caused by a single aptamer.

[0025] 3. The chip of the present invention can be used for tumor tissue culture, and extracellular vesicles can be captured in the capture area by means of modified antibodies or other methods.

[0026] 4. The transition region and shunt region of the chip of the present invention are comb-shaped, which can reduce the shear force of tissue culture and is more conducive to tumor tissue culture. Attached Figure Description

[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0028] Figure 1 This is a schematic diagram of each layer of the microfluidic chip in Example 1.

[0029] Figure 2 This is a schematic diagram of the top-level structure of the microfluidic chip in Example 1.

[0030] Figure 3 This is a schematic diagram of the microfluidic chip tissue culture layer structure in Example 1.

[0031] Figure 4 This is a schematic diagram of the fluid layer structure of the microfluidic chip in Example 1.

[0032] Figure 5 This is a schematic diagram of the capture layer structure of the microfluidic chip in Example 1.

[0033] Figure 6 A schematic diagram illustrating the working principle of the microfluidic chip of this invention.

[0034] Figure 7 This is a schematic diagram illustrating the detection principle of the present invention.

[0035] Figure 8 The efficiency of Biotin-CD63 antibody modification.

[0036] Figure 9 The results show the detection of A375 extracellular vesicles captured on the microfluidic chip in Example 3.

[0037] Figure 10 The results show the detection of U251 extracellular vesicles captured on the microfluidic chip in Example 3.

[0038] Figure 11 This demonstrates the feasibility of extracellular vesicle typing analysis in 4T1 tumor tissue in Example 3. Yellow arrows: extracellular vesicles secreted by tumor cells; blue arrows: extracellular vesicles secreted by immune cells. Detailed Implementation

[0039] Example 1

[0040] See Figure 1 The present invention provides a microfluidic chip for tumor tissue culture and extracellular vesicle typing analysis, comprising, from top to bottom, a top layer 100, a tissue culture layer 200, a fluid layer 300 and a capture layer 400.

[0041] See Figure 2 The top layer 100 has a probe inlet 120 in the middle, a left fluid inlet 110 in the left half, and a right fluid outlet 130 in the right half.

[0042] See Figure 3 The tissue culture layer 200 has a tumor tissue culture zone 220 in the middle, a left fluid through-hole 210 in the left half, and a right fluid through-hole 230 in the right half. The left fluid through-hole 210 corresponds to the left fluid inlet 110, and the right fluid through-hole 230 corresponds to the right fluid outlet 130. The center of the tumor tissue culture zone 220 is a culture zone 222, which is a rectangular through-hole. Multiple strip grooves extend to the left of the culture zone 222, forming a comb-shaped left transition zone 221; multiple strip grooves extend to the right of the culture zone 222, forming a comb-shaped right transition zone 223.

[0043] See Figure 4 The fluid layer 300 has a capture hole 320 in the middle, a left diversion zone 310 in the left half, and a right diversion zone 330 in the right half. The capture hole 320 corresponds to the tumor tissue culture zone 220.

[0044] The left diversion zone 310 includes a left-side stem 311 and a right-side diversion zone 312. The stem 311 covers the left fluid through-hole 210; the diversion zone 312 is a comb-like structure composed of multiple horizontally distributed strip-shaped grooves. The position of this diversion zone 312 corresponds to the position of the left transition zone 221. The right diversion zone 330 is symmetrically arranged with the left diversion zone 310. That is, the right diversion zone 330 includes a left-side diversion zone 331 and a right-side stem 332. The stem 332 covers the right fluid through-hole 230; the diversion zone 331 is a comb-like structure composed of multiple horizontally distributed strip-shaped grooves. The position of this diversion zone 331 corresponds to the position of the right transition zone 223.

[0045] See Figure 5 The capture layer 400 has a capture area 410 at the middle position, and the position of the capture area 410 corresponds to the capture hole 320.

[0046] See Figure 6

[0047] The invention is used as follows:

[0048] Tumor tissue is placed in the tumor tissue culture zone 220 in the middle of the tissue culture layer, and then the top layer 100, tissue culture layer 200, fluid layer 300, and capture layer 400 are fixed. Fixation can be achieved using various methods such as rubber band fixation or adhesive bonding.

[0049] After each layer is fixed, the probe inlet 120 is first secured with adhesive tape. A peristaltic pump is used to inject tissue culture medium through the left fluid inlet 110 of the top layer. The tissue culture medium passes through the left fluid via 210 of the tissue culture layer 200, enters the handle 311 of the left shunt zone 310 of the fluid layer 300, then flows rightward from the handle 311 to the shunt zone 312, and then upwards from the shunt zone 312 into the left transition zone 221 of the tissue culture layer 200, thus entering the culture zone 222. Afterwards, it flows downwards from the right transition zone 223 into the shunt zone 331, and then to the handle 332. Finally, it flows out through the right fluid via 230 and out through the right fluid outlet 130. When culturing tumor tissue, a peristaltic pump is used to circulate the culture medium, simulating the blood circulation of the tumor tissue.

[0050] The comb-like structure of the fluid layer and tissue culture layer in this invention allows for the diversion of culture medium, reducing shear force. Cultured tumor tissue is immersed in the culture medium, and the capture zone 410 of the capture layer can hold a coverslip modified with CD63 antibody, which can capture extracellular vesicles secreted by the tumor tissue. The probe inlet 120 allows for the insertion of a detection probe after the adhesive tape is removed.

[0051] See Figure 7This is a schematic diagram illustrating the detection principle of the present invention. The present invention provides a method for the typing and analysis of extracellular vesicles secreted by tumor cells and immune cells, based on tumor cell culture and the differential expression of PD-L1 and EpCAM markers on the surface of extracellular vesicles. An aptamer probe (Cy5-PD-L1-L) and an EpCAM protein aptamer probe (EpCAM-L) are designed to recognize PD-L1 protein. These two aptamers each have a sequence that binds to the target protein and a DNA extension strand, with the DNA extension strand complementary to a DNA sequence in the connector arm. Tumor cells are double-positive for PD-L1 and EpCAM and can bind to both the Cy5-PD-L1-L and EpCAM-L aptamers. When incubated with a connector modified with FAM and the quencher group BHQ, the hairpin structure of the connector is opened due to the complementarity of Cy5-PD-L1-L and EpCAM-L with the connector portion of the sequence, and FAM fluorescence is restored. Simultaneously, the BHQ quenching group on the connector is adjacent to the Cy5 fluorescent molecule on Cy5-PD-L1-L, quenching the fluorescence of Cy5. This results in a dual-switch mode of FAM fluorescence recovery and Cy5 fluorescence quenching, thereby identifying extracellular vesicles derived from tumor cells. Immune cells are PD-L1 positive; therefore, they can only bind to the Cy5-PD-L1-L aptamer and not to the EpCAM-L aptamer. When incubated with the connector arm, the hairpin structure of the connector cannot be opened; therefore, the Cy5 fluorescence of Cy5-PD-L1-L is maintained, while the FAM fluorescence of the connector arm is quenched.

[0052] Specifically, the sequences and fluorescent labeling of the two probes and the connecting arm of the present invention are as follows:

[0053] Cy5-PD-L1-L(5'-3'):TACAGGTTCTGGGGGGTGGGTGGGGAACCTGTTTGTGGTCTATGTCGTCGTTC GCTAGTAGTTC / iCy5dT / CTGGGCTGCAC;

[0054] EpCAM-L(5'-3'):TCGAGGCGTAGAATTCCCCCGATGCGCGCTGTTCTCACTACAGAG GTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG;

[0055] Connector (5'-3'):

[0056] FAM-CTGGGCTGTTATTGTATTCTACGCCTCGAGTGCAGCCCAG-BHQ

[0057] According to the dual-switch mode or fluorescence retention principle of the present invention, in other embodiments, other sequences of PD-L1-L, EpCAM-L, and connecting arms can also be used to achieve the same dual-switch mode or fluorescence retention, with the connecting arm providing FAM fluorescence quenching. Furthermore, the types of fluorescent and quenching groups can be replaced. The specific sequences, fluorescent and quenching groups described above are merely examples and not limitations.

[0058] A cover glass slide modified with biotin-CD63 antibody was attached to the capture layer of the microfluidic chip to capture extracellular vesicles secreted by tumor tissue. The modification method was as follows: 5% (3-mercaptopropyl)trimethoxysilane (dissolved in ethanol) was dropped onto the surface of the cover glass slide of the capture layer, incubated at room temperature for 2 h, washed with anhydrous ethanol, and dried at 90°C for 30 min. After the chip cooled to room temperature, 0.5 mg / mL GMBS (dissolved in ethanol) was added, and incubated at room temperature for 30 min. After incubation, the chip was washed sequentially with anhydrous ethanol and PBS buffer. 30 μg / mL streptavidin (dissolved in PBS) was added, and the chip was incubated at 4°C overnight. After rinsing with PBS, 30 μg / mL biotin-CD63 antibody (dissolved in PBS) was added, and the chip was incubated at 4°C overnight. After the biotin-CD63 antibody modification was completed, AF488 fluorescent secondary antibody was added, and the modification efficiency of the biotin-CD63 antibody was characterized using laser confocal microscopy (the control group consisted of unmodified biotin-CD63 antibody). The results showed that the fluorescence intensity of coverslips modified with biotin-CD63 antibody was significantly stronger than that of coverslips without biotin-CD63 antibody modification. Figure 8 Therefore, the biotin-CD63 antibody was successfully modified onto the cover glass surface of the capture layer of the microfluidic chip, which can be used to capture extracellular vesicles secreted by tumor tissue.

[0059] Example 2

[0060] First, the potential of two types of extracellular vesicles—A375 (secreting PD-L1)—to be captured by a microfluidic chip and secreted by tumor cells and immune cells was investigated, and DNA probes were used to identify their potential. + EpCAM + Extracellular vesicles (representing extracellular vesicles secreted by tumor cells) or U251 (secreting PD-L1) + EpCAM -Extracellular vesicles (representing extracellular vesicles secreted by immune cells) were cultured in DMEM medium (10% serum to remove extracellular vesicles and 1% penicillin antibody) for 60 h after cell resuscitation, and the culture medium was collected. The collected cell culture supernatant was centrifuged at 3000g for 20 min at 4°C to remove cell debris. The supernatant was then pipetted and centrifuged at 16500g for 45 min at 4°C to remove large vesicles. The supernatant was then centrifuged at 100,000g for 2 h at 4°C to collect the precipitate. Finally, the precipitate was resuspended in PBS, centrifuged at 100,000g for 2 h at 4°C, the supernatant was removed, and the precipitate was resuspended in 200 μL of PBS to obtain A375 or U251 extracellular vesicle samples. The total protein concentration of A375 or U251 extracellular vesicles was detected using a BCA assay kit.

[0061] The coverslip of the microfluidic chip capture layer was modified with biotin-CD63 antibody, 3% BSA was added, and the mixture was incubated at room temperature for 1 h, followed by washing with PBS. 1 mg / mL of A375 / U251 exosomes was added, and the mixture was blocked with 100 mM glycine and 0.5% BSA for 30 min, followed by washing twice with 0.5% BSA. 200 nM Cy5-PD-L1-L aptamer and 200 nM EpCAM-L aptamer were added to binding buffer (PBS containing 10 mM MgCl2 and 0.5% BSA) and incubated at room temperature for 40 min, followed by washing twice with 0.5% BSA. Then, 1 μM Connector was added, and the mixture was incubated in binding buffer at room temperature for 20 min, followed by washing three times. The control group consisted of exosomes incubated with a random 59-base sequence labeled with Cy5 / Cy5-PD-L1-L aptamer / EpCAM-L aptamer for 40 min, followed by incubation with a connector at room temperature for 20 min, and washing twice with binding buffer. Images of the FAM and Cy5 channels were captured using a laser confocal microscope.

[0062] Identification results of A375 extracellular vesicles captured by the microfluidic chip capture layer showed that when incubated with control DNA (a random sequence of 59 Cy5-labeled bases) / PD-L1-L aptamer / EpCAM-L aptamer and the connector arm respectively, the hairpin structure of the connector arm did not open, thus maintaining fluorescence. However, when A375 extracellular vesicles were simultaneously incubated with PD-L1-L aptamer, EpCAM-L aptamer, and the connector arm, the hairpin structure of the connector arm opened, the FAM fluorescence modified on the connector arm was restored, and the Cy5 fluorescence of the Cy5-PD-L1-L aptamer was partially quenched, indicating the presence of a connector. + PD-L1 + and Connector + PD-L1 - extracellular vesicles ( Figure 9Therefore, this method can detect extracellular vesicles that are double-positive for PD-L1 and EpCAM and captured by CD63 antibody on the capture layer of a microfluidic chip.

[0063] Identification results of U251 extracellular vesicles captured by the microfluidic chip capture layer showed that the fluorescence intensity of the connecting arm after simultaneous incubation of U251 extracellular vesicles with Cy5-PD-L1-L aptamer, EpCAM-L aptamer, and connecting arm was consistent with that of the control group. The fluorescence intensity of the Cy5-PD-L1-L aptamer was also consistent with the results of incubation of U251 cells with only the Cy5-PD-L1-L aptamer and connecting arm. Figure 10 This indicates that the strategy can detect PD-L1-positive, EpCAM-negative U251 extracellular vesicles captured by CD63 antibody on the microfluidic chip capture layer.

[0064] Example 3

[0065] Subcutaneous tumors of 4T1 cells were implanted in Balb / C mice. After tumor formation, tumor tissue was harvested and placed in a cell culture layer of a microfluidic chip. RPMI-1640 medium (containing 20% ​​exosome-free serum and 1% penicillin antibody) was introduced, and the 4T1 tumor tissue was placed in the microfluidic chip. The medium was circulated using a peristaltic pump and cultured for 12 hours. The tumor tissue was then removed, and the feasibility of using a microfluidic chip to culture 4T1 tumor tissue and perform extracellular vesicle typing analysis was investigated using probe incubation and laser confocal microscopy. Confocal imaging results showed that when the capture layer was incubated with control DNA and a linker arm, or with the EpCAM aptamer and a linker arm, no fluorescence signal was observed in the FAM and Cy5 channels. When the capture layer was incubated with the Cy5-PD-L1-L aptamer and a linker arm, the fluorescence signal of the linker arm did not recover, while the fluorescence signal of the Cy5-PD-L1-L aptamer remained. When the capture layer was co-incubated with the EpCAM-L aptamer, Cy5-PD-L1-L aptamer, and the linker arm, the fluorescence signal of the linker arm was restored, while the fluorescence signal of the Cy5-PD-L1-L aptamer was quenched by the particles (…). Figure 11 The yellow arrow indicates that these particles are extracellular vesicles secreted by tumor cells. The fluorescence signal in the connecting arm did not recover, while the fluorescence signal maintained by the Cy5-PD-L1-L aptamer indicates that the particles are extracellular vesicles secreted by immune cells. Figure 11 (blue arrow). Therefore, this strategy can be used for the typing analysis of extracellular vesicles secreted by 4T1 tumor tissue.

[0066] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip, characterized in that, The method comprises the following steps: Step 1: providing two aptamer probes and a connecting arm, wherein the two aptamer probes are respectively an aptamer probe PD-L1-L for recognizing PD-L1 protein and an aptamer probe EpCAM-L for recognizing EpCAM protein, the two aptamer probes each have a sequence for binding to a target protein and a DNA extension chain, the two DNA extension chains are respectively complementary to a DNA sequence of the connecting arm, the connecting arm is a hairpin structure, and is modified with a quenching group and a first light-emitting group; and the aptamer probe PD-L1-L is modified with a second light-emitting group; Step 2: culturing tumor tissue in a microfluidic chip, and capturing extracellular vesicles secreted by the tumor tissue through a capture molecule modified on the chip; Step 3: after incubation of the captured extracellular vesicles and the two aptamer probes, removing unbound probes by washing, and then incubating with the connecting arm; when the tumor cell is PD-L1 and EpCAM double positive, the tumor cell binds to the PD-L1-L aptamer and the EpCAM-L aptamer, and when incubated with the connecting arm, the hairpin structure of the connecting arm is opened due to the complementarity between the PD-L1-L and the EpCAM-L and the partial sequence of the connecting arm, the first fluorescence is recovered, the quenching group on the connecting arm is adjacent to the second fluorescent molecule on the PD-L1-L, and the second fluorescence is quenched, thereby generating a double-switch mode of first fluorescence recovery and second fluorescence quenching, so as to identify the extracellular vesicles derived from the tumor cell; when the immune cell is PD-L1 positive, the immune cell can only bind to the PD-L1-L aptamer but cannot bind to the EpCAM-L aptamer, and when incubated with the connecting arm, the hairpin structure of the connecting arm cannot be opened, so the second fluorescence of the PD-L1-L remains, and the first fluorescence of the connecting arm is quenched, thereby identifying the extracellular vesicles derived from the immune cell.

2. The method according to claim 1, wherein the method is characterized by: In step 1, the first sequence on the connecting arm complementary to the aptamer probe PD-L1-L and the second sequence on the connecting arm complementary to the aptamer probe EpCAM-L are not overlapped.

3. The method according to claim 1, wherein the method is characterized by: In step 2, the microfluidic chip comprises, from top to bottom, a top layer, a tissue culture layer, a fluid layer and a capture layer, wherein the middle part of the top layer has a probe sample inlet, the left half of the top layer has a top layer fluid sample inlet, and the right half of the top layer has a top layer fluid outlet; the tissue culture layer has a tumor tissue culture area and two fluid through holes, the tumor tissue culture area and the probe sample inlet of the top layer are in communication, and one of the two fluid through holes is in communication with the top layer fluid sample inlet; the other is in communication with the top layer fluid outlet; the left half of the fluid layer is provided with a left shunt area, and the right half of the fluid layer is provided with a right shunt area; the left shunt area is in communication with the fluid through hole on the left side of the tissue culture layer, and is in communication with the left side of the tumor tissue culture area; the right shunt area is in communication with the fluid through hole on the right side of the tissue culture layer, and is in communication with the right side of the tumor tissue culture area; the middle part of the fluid layer is provided with a capture hole; the capture hole is in position correspondence with the tumor tissue culture area; the capture layer has a capture area, and the capture area is in position correspondence with the capture hole.

4. The method according to claim 2, wherein the method is characterized by: In step 2, the capture molecule modified on the chip is arranged in the capture area.

5. The method according to claim 4, wherein the method is characterized by: In step two, the capture molecules in the capture zone modification include antibodies, polypeptides or nucleic acid aptamers.

6. The method according to claim 5, wherein the method is characterized by: The capture molecules include antibodies, polypeptides or nucleic acid aptamers that specifically recognize CD63, CD81 or CD9.

7. The method according to claim 3, wherein the method is characterized by: The tumor tissue culture zone extends to the left with a plurality of strip grooves, which form a comb-shaped left transition zone; the culture zone extends to the right with a plurality of strip grooves, which form a comb-shaped right transition zone.

8. The method according to claim 3, wherein the method is characterized by: The left shunt zone includes a left handle and a right shunt zone; the handle covers the left fluid via hole; the shunt zone is a comb-shaped structure composed of a plurality of left and right strip grooves, and the position of the shunt zone corresponds to the position of the left transition zone.

9. The method according to claim 3, wherein the method is characterized by: The right shunt zone includes a left shunt zone and a right handle; the handle covers the right fluid via hole; the shunt zone is a comb-shaped structure composed of a plurality of left and right strip grooves; the position of the shunt zone corresponds to the position of the right transition zone.

Citation Information

Patent Citations

  • Typing analysis method for extracellular vesicles secreted by tumor cells and immune cells

    CN119688986A