Ganoderma lucidum strain L4905, and cultivation method and application thereof
By providing the Ganoderma lucidum strain L4905 and its cultivation method, the problem of varieties not adapting to diverse and three-dimensional climates in Yunnan Province's Ganoderma lucidum industry has been solved, achieving stable mycelial growth and high-yield fruiting body production, making it suitable for large-scale promotion in Yunnan Province.
Patent Information
- Application Number
- CN202411548810.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-20
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2044-11-20
AI Technical Summary
The Ganoderma lucidum industry in Yunnan Province lacks superior cultivated varieties. The suitability, yield and biological conversion rate of introduced varieties are unstable under diverse and three-dimensional climates, resulting in inconsistent strain quality, uneven fruiting or failure to fruit normally, and unstable fruiting body yield.
This invention provides a Ganoderma lucidum strain L4905 and its cultivation method, including steps such as mother culture propagation, original culture preparation, cultivar preparation and soil covering cultivation. By adjusting conditions such as light intensity, humidity and CO2 concentration, it adapts to the three-dimensional climate characteristics of Yunnan Province, ensuring stable mycelial growth and high fruiting body yield.
The Ganoderma lucidum strain L4905 is highly adaptable, with robust mycelium, low contamination, and a glossy yellow-brown fruiting body. It is rich in polysaccharides and triterpenes, and has a high yield, making it suitable for large-scale promotion in Yunnan Province with a promising market prospect.
Smart Images

Figure CN119752637B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a Ganoderma lucidum strain L4905 and its cultivation method and application. Background Technology
[0002] The medicinal use of Ganoderma lucidum in my country has a recorded history of over 2000 years. For centuries, it has been regarded by the Chinese people as a panacea capable of curing all diseases and is listed as one of the nine sacred herbs of China. In the 1950s, the first Ganoderma lucidum specimen collected from Qingdao was domesticated and cultivated by researchers at the Institute of Microbiology, Chinese Academy of Sciences, marking the first successful cultivation of Ganoderma lucidum. Since then, the scale of Ganoderma lucidum cultivation in my country has continuously expanded, and China has rapidly developed into a major producer and exporter of Ganoderma lucidum in the market. To date, artificial cultivation of Ganoderma lucidum in China has a history of over 60 years, with continuous development of cultivation techniques and an increasingly large scale, resulting in diversification of cultivated varieties, techniques, models, and raw materials. With the continuous improvement of people's living standards, the demand for Ganoderma lucidum products is constantly increasing, and wild Ganoderma lucidum resources are insufficient to meet current market demand. The rational development and utilization of wild Ganoderma lucidum resources will contribute to the healthy and sustainable development of the Ganoderma lucidum industry.
[0003] Reishi mushroom is listed as a medicinal material in the 2020 edition of the Chinese Pharmacopoeia, and its legally recognized medicinal material is Ganoderma lucidum (red reishi). Ganoderma lucidum and Zizhi Ganoderma sinensis The dried fruiting body of Ganoderma lucidum. Due to its wide distribution and high content of active ingredients such as polysaccharides and triterpenes, Ganoderma lucidum is widely used in China. Currently, Ganoderma lucidum is cultivated in large quantities throughout the country, using two methods: log cultivation and substrate cultivation. Cultivation techniques are becoming increasingly mature, and yields are increasing year by year, achieving significant economic and social benefits.
[0004] In Yunnan Province's Ganoderma lucidum industry, there is a shortage of superior cultivated varieties, and currently, no locally bred Ganoderma lucidum varieties with distinctive characteristics have been developed in Yunnan. Furthermore, the suitability, yield, and bioconversion rate of introduced mature Ganoderma lucidum varieties and technologies from outside the province are unstable in Yunnan's diverse and varied climate, hindering the large-scale promotion of substrate-based cultivation of Ganoderma lucidum. Currently, the supporting cultivation techniques for various varieties are relatively backward. In actual production, the lack of corresponding spawn production and cultivation techniques leads to inconsistent spawn quality, uneven fruiting, and even failure to fruit properly after cultivation, resulting in unstable fruiting body yields. Therefore, selecting superior native Yunnan Ganoderma lucidum varieties and developing corresponding substrate-based cultivation and management techniques is urgent. Determining the optimal cultivation and management techniques for Ganoderma lucidum strains through experimental research to overcome the shortcomings of existing technologies is a pressing issue in the field of microbial technology. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Ganoderma lucidum strain L4905 and its cultivation method and application.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] The first aspect of this invention provides a Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0008] The second aspect of this invention provides a method for cultivating the above-mentioned Ganoderma lucidum strain L4905, comprising the following steps:
[0009] Step (1), propagation of mother culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and place it in a 24 ℃ incubator for constant temperature culture for 7-10 days;
[0010] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, and 990-1010 parts water;
[0011] Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 26 ℃ culture room for constant temperature culture for 25-30 days to obtain the original seed;
[0012] The original culture medium in the original culture bottle comprises the following raw materials by weight: 72-74 parts hardwood sawdust, 23-25 parts wheat bran, 0.9-1.1 parts white sugar, 0.9-1.1 parts gypsum powder, and 0.8-1.2 parts lime powder; pH value 6-8, moisture content 55-65%;
[0013] Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn bag and placed in a 26 ℃ incubation room for constant temperature incubation for 25-30 days to obtain the spawn;
[0014] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 77-79 parts hardwood sawdust, 16-18 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.8-1.2 parts lime powder; pH value 6-8, moisture content 55-65%;
[0015] Step (4), soil covering cultivation: After the mycelium in the cultivation bag is fully grown, transport it to the cultivation base and continue to ripen for 5-7 days under shade. Then, open the bag with small holes at a 45° angle and cover it with soil for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be shot out, cover the bag to harvest spores or harvest fruiting bodies.
[0016] Furthermore, in step (4), the cultivation base is a greenhouse or commercial forest; 3,000-4,000 bags are planted per mu in commercial forest, and 6,000-8,000 bags are planted per mu in greenhouse.
[0017] Furthermore, in step (4), the light intensity in the greenhouse is adjusted by using a shade net; the light intensity in the commercial forest is adjusted by tending and harvesting or by building small arched sheds.
[0018] In step (4), after covering with soil, the plants can be harvested 58-60 days later.
[0019] The third aspect of this invention provides a method for cultivating the above-mentioned Ganoderma lucidum strain L4905, comprising the following steps:
[0020] Step A, Propagation of Mother Culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and incubate at 24℃ for 7-10 days to obtain mycelial blocks;
[0021] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, and 990-1010 parts water;
[0022] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5 ℃ for 7-10 days to obtain the seed liquid;
[0023] The shake flask culture medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 1.9-2.1 parts yeast powder, 0.19-0.21 parts ferric chloride, 990-1010 parts water, with a pH of 6.0-7.0.
[0024] Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 23.5-24.5℃ for 8-11 days to obtain liquid inoculum;
[0025] The fermentation broth culture medium comprises the following raw materials by weight: 600 parts soluble starch, 2350-2450 parts glucose, 90-110 parts peptone, 90-110 parts yeast extract, 115-125 parts potassium dihydrogen phosphate, 59-61 parts ferric chloride, and 99000-101000 parts water, with a pH of 6.0-7.0.
[0026] Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a 26℃ incubation room for 25-30 days;
[0027] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 77-79 parts hardwood sawdust, 17-19 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.5-0.8 parts lime powder; pH value 6-8, moisture content 55-65%;
[0028] Step E, Soil Covering Cultivation: After the mycelium has fully grown in the cultivation bag, transport it to the cultivation base and continue to ripen under shade for 5-7 days. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag and harvest the spores or harvest the fruiting bodies.
[0029] Furthermore, in step E, the cultivation base is either a greenhouse or under commercial forest; 3,000-4,000 bags are planted per acre under commercial forest, and 6,000-8,000 bags are planted per acre in greenhouses.
[0030] Furthermore, in step E, the light intensity in the greenhouse is adjusted by using a shade net; the light intensity under the commercial forest is adjusted by tending and harvesting or by building small arched sheds; in step E, after covering with soil, the trees can be harvested 58-60 days later.
[0031] Furthermore, in step E, the greenhouse maintains soil moisture of 20-30%, air humidity of 70-90%, and CO2 concentration of less than 0.05%; the canopy closure of the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.
[0032] The fourth aspect of this invention provides the use of the mycelium, fermentation broth, fruiting body or spore powder of the above-mentioned Ganoderma lucidum strain L4905 in the preparation of antitumor drugs or sedative and sleep-promoting drugs.
[0033] The fifth aspect of this invention provides the application of the mycelium, fermentation broth, fruiting body or spore powder of the above-mentioned Ganoderma lucidum strain L4905 in the preparation of whitening and anti-inflammatory products.
[0034] The *Ganoderma lucidum* strain L4905 of this invention contains high levels of *Ganoderma lucidum* polysaccharides and triterpenoids. Using the detection methods described in the 2020 edition of the Chinese Pharmacopoeia, Volume I, *Ganoderma lucidum*, page 196, for the determination of *Ganoderma lucidum* polysaccharides and triterpenoids (calculated as oleanolic acid), the wild *Ganoderma lucidum* strain L4905 showed a polysaccharide content of 1.2% and a triterpenoid content of 3.9%. The cultivated *Ganoderma lucidum* strain L4905 showed significantly higher polysaccharide and triterpenoid content, with a polysaccharide content of 1.37% and a triterpenoid content of 4.28%. *Ganoderma lucidum* polysaccharides possess a wide range of pharmacological activities, including lowering blood sugar and lipids, antithrombosis, antioxidation, scavenging free radicals, anti-aging, anti-radiation, anti-tumor, promoting blood circulation, regulating immunity, regulating nucleic acid and protein metabolism, promoting DNA synthesis, and promoting the proliferation of human umbilical cord blood LAK cells. *Ganoderma lucidum* triterpenoids exhibit anti-inflammatory, analgesic, sedative, anti-aging, tumor cell cytotoxicity, and anti-hypoxia effects.
[0035] Compared with the prior art, the beneficial effects of this invention are as follows:
[0036] The Ganoderma lucidum strain L4905 of this invention has robust mycelia, rapid mycelial growth, low contamination, and strong resistance to contamination; the fruiting body is yellowish-brown with a high glossy, lacquer-like appearance, kidney-shaped cap, and stable characteristics; the mushroom is relatively large, with thick, fleshy fruiting bodies that are grayish-white to light brown; it has a strong aroma, high content of triterpenes and polysaccharides, and is rich in nutrients. Compared with the control strain, it has higher yield and active ingredients, and both the fruiting body and spore powder yields are high, indicating high application value and good market prospects.
[0037] Because the wild species of Ganoderma lucidum strain L4905 originates from Yunnan Province, this strain exhibits strong adaptability to the diverse climate characteristics of Yunnan. Specifically, it has a wide temperature tolerance range, with mycelium growing normally between 10 and 32°C, and producing fruiting bodies within a temperature range of 10 to 35°C. It also has a wide altitude tolerance range, producing fruiting bodies normally at altitudes of 1000-3000 meters. Furthermore, this strain is drought-tolerant. Yunnan experiences severe drought during winter and spring, with the rainy season typically arriving from late May to early June. Therefore, early April is hot and dry with very low humidity, only 30%-50%. Some Ganoderma lucidum varieties introduced from other provinces and the bright-capped Ganoderma lucidum variety bred by our unit, planted in April, showed malformation at the bud stage, but the malformation rate of Ganoderma lucidum strain L4905 was almost zero.
[0038] The Ganoderma lucidum strain L4905 of this invention has excellent uniformity and stability. In 2023 and 2024, the research group cultivated the Ganoderma lucidum strain L4905 of this invention at five locations in Yunnan. The Ganoderma lucidum at each location was uniform, with kidney-shaped caps, either double-kidney or single-kidney, and matured simultaneously, showing extremely stable cultivation characteristics.
[0039] The Ganoderma lucidum strain L4905 of this invention is adaptable to all cultivation methods for fruiting. Our research group has tried cultivation in greenhouses, native forests or under walnut trees, stacking cultivation, substrate-covered soil cultivation, and log cultivation, all of which showed good growth. Experimental research showed that planting with small holes at a 45-degree angle yielded the best results and the highest yield.
[0040] The Ganoderma lucidum strain L4905 of this invention is easy to cultivate, highly adaptable, and has strong resistance to contamination. It is rich in polysaccharides and triterpenes, making it an excellent Ganoderma lucidum strain suitable for large-scale cultivation in Yunnan Province. Attached Figure Description
[0041] Figure 1 For Ganoderma lucidum strain L4905 based on ITS+nrLSU+ TEF1 -α+ RPB 2-sequence polygenic phylogenetic tree;
[0042] Figure 2 Polyacrylamide gel image of Ganoderma lucidum strain L4905 with SSR molecular marker.
[0043] Figure 3 The results are from the antagonism test;
[0044] Figure 4 Morphology of wild-type Ganoderma lucidum strain L4905; where ab: fruiting body morphology; cd: cap section; e: cortical cells; fg: flesh skeleton hyphae; h: tube-binding hyphae; i: tube reproductive hyphae; jk: basidia or pseudo-basidia; lo: basidiospores; scale bar: eg = 20 mm; hl = 10 µm; mo = 5 µm.
[0045] Figure 5 These are multi-site demonstration cultivation images of Ganoderma lucidum strain L4905; where A is a demonstration cultivation image in Songming County, Kunming City; B is a demonstration cultivation image in Panlong District, Kunming City; C is a demonstration cultivation image in Wuding County, Chuxiong Prefecture; and D is a demonstration cultivation image in Xundian County, Kunming City.
[0046] Figure 6 The results of antagonistic culture between Ganoderma lucidum and Aspergillus versicolor are shown; (a) is a antagonistic culture diagram of Ganoderma lucidum strain L4905 and Aspergillus versicolor; (b) is a antagonistic culture diagram of Ganoderma lucidum strain L4287 and Aspergillus versicolor.
[0047] Figure 7 The Ganoderma lucidum strain L4905 was planted by opening small bags at a 45-degree angle and covering them with soil; among them, A was planted by slanted bags; B was planted by horizontal bags; and C was planted by vertical bags.
[0048] Figure 8 Figure showing the effect of carbon source on mycelial growth rate;
[0049] Figure 9 Figure showing the effect of nitrogen source on mycelial growth rate;
[0050] Figure 10 Figure showing the effect of inorganic salts on mycelial growth rate;
[0051] Figure 11 The graph shows the effect of temperature on mycelial growth rate.
[0052] Figure 12 The graph shows the effect of pH on mycelial growth rate.
[0053] In the figure, different lowercase letters indicate a significant difference between the two (P < 0.05), while the same lowercase letter indicates no significant difference between the two (P > 0.05).
[0054] The Ganoderma lucidum strain L4905 of this invention is classified and named as follows: Ganoderma sp . It was deposited on October 9, 2023, at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC No: 63866. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Institute of Microbiology. Detailed Implementation
[0055] The present invention will now be described in further detail with reference to the embodiments.
[0056] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.
[0057] Example 1
[0058] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0059] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0060] Step (1), propagation of mother culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and place it in a 24 ℃ incubator for constant temperature culture for 8 days;
[0061] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 20 parts agar powder, and 1000 parts water;
[0062] Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 26 ℃ culture room for constant temperature culture for 28 days to obtain the original seed;
[0063] The original culture medium in the original culture bottle comprises the following raw materials by weight: 73 parts hardwood sawdust, 24 parts wheat bran, 1 part white sugar, 1 part gypsum powder, and 1 part lime powder; pH value 7, moisture content 60%;
[0064] Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn bag and placed in a 26 ℃ incubation room for 28 days to obtain the spawn;
[0065] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 78 parts hardwood sawdust, 17 parts wheat bran, 2 parts soybean meal, 1 part gypsum powder, and 1 part lime powder; pH value 7, moisture content 60%;
[0066] Step (4), soil covering cultivation: After the mycelium in the cultivation bag is fully grown, transport it to the cultivation base and continue to ripen for 6 days under shade. Then, open the bag with small holes at a 45° angle and cover it with soil for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag to harvest spores or harvest fruiting bodies.
[0067] Example 2
[0068] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0069] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0070] Step (1), propagation of mother culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and place it in a 24 ℃ incubator for 7 days;
[0071] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19 parts glucose, 19 parts agar powder, and 990 parts water;
[0072] Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 26 ℃ culture room for constant temperature culture for 25 days to obtain the original seed;
[0073] The original culture medium in the original culture bottle comprises the following raw materials by weight: 72 parts hardwood sawdust, 23 parts wheat bran, 0.9 parts white sugar, 0.9 parts gypsum powder, and 0.8 parts lime powder; pH value 6, moisture content 55%;
[0074] Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn bag and placed in a 26 ℃ incubation room for 25 days to obtain the spawn;
[0075] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 77 parts hardwood sawdust, 16 parts wheat bran, 1.9 parts soybean meal, 0.9 parts gypsum powder, and 0.8 parts lime powder; pH value 6, moisture content 55%;
[0076] Step (4), soil covering cultivation: After the mycelium in the cultivation bag is fully grown, transport it to the cultivation base and continue to ripen for 5 days under shade. Then, open the bag with small holes and cover it with soil at a 45° angle. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag to harvest spores or harvest fruiting bodies.
[0077] In step (4), the cultivation base is either a greenhouse or a commercial forest; 3,000 bags are planted per mu in commercial forest and 6,000 bags are planted per mu in greenhouse.
[0078] In step (4), the light intensity in the greenhouse is adjusted by using a shade net; the light intensity in the commercial forest is adjusted by tending and harvesting or by building small arched sheds.
[0079] In step (4), after covering with soil, the plants can be harvested 58 days later.
[0080] Example 3
[0081] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0082] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0083] Step (1), propagation of mother culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and place it in a 24 ℃ incubator for 10 days;
[0084] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 21 parts glucose, 21 parts agar powder, and 1010 parts water;
[0085] Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 26 ℃ culture room for constant temperature culture for 30 days to obtain the original seed;
[0086] The original culture medium in the original culture bottle comprises the following raw materials by weight: 74 parts hardwood sawdust, 25 parts wheat bran, 1.1 parts white sugar, 1.1 parts gypsum powder, and 1.2 parts lime powder; pH value 8, moisture content 65%;
[0087] Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn bag and placed in a 26 ℃ incubation room for 30 days to obtain the spawn;
[0088] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 79 parts hardwood sawdust, 18 parts wheat bran, 2.1 parts soybean meal, 1.1 parts gypsum powder, and 1.2 parts lime powder; pH value 8, moisture content 65%;
[0089] Step (4), soil covering cultivation: After the mycelium in the cultivation bag is fully grown, transport it to the cultivation base and continue to ripen for 7 days under shaded conditions. Then, open the bag with small holes at a 45° angle and cover it with soil for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be shot out, cover the bag and harvest the spores or fruiting bodies.
[0090] In step (4), the cultivation base is either a greenhouse or a commercial forest; 4,000 bags are planted per mu in commercial forest and 8,000 bags are planted per mu in greenhouse.
[0091] In step (4), the light intensity in the greenhouse is adjusted by using a shade net; the light intensity in the commercial forest is adjusted by tending and harvesting or by building small arched sheds.
[0092] In step (4), after covering with soil, the plants can be harvested 60 days later.
[0093] Example 4
[0094] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0095] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0096] Step (1), propagation of mother culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and place it in a 24 ℃ incubator for constant temperature culture for 8 days;
[0097] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 20 parts agar powder, and 1000 parts water;
[0098] Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 26 ℃ culture room for constant temperature culture for 28 days to obtain the original seed;
[0099] The original culture medium in the original culture bottle comprises the following raw materials by weight: 73 parts hardwood sawdust, 24 parts wheat bran, 1 part white sugar, 1 part gypsum powder, and 1 part lime powder; pH value 7, moisture content 60%;
[0100] Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn bag and placed in a 26 ℃ incubation room for 28 days to obtain the spawn;
[0101] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 78 parts hardwood sawdust, 17 parts wheat bran, 2 parts soybean meal, 1 part gypsum powder, and 1 part lime powder; pH value 7, moisture content 60%;
[0102] Step (4), soil covering cultivation: After the mycelium in the cultivation bag is fully grown, transport it to the cultivation base and continue to ripen for 6 days under shade. Then, open the bag with small holes at a 45° angle and cover it with soil for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag to harvest spores or harvest fruiting bodies.
[0103] In step (4), the cultivation base is either a greenhouse or a commercial forest; 3,600 bags are planted per mu in commercial forest and 7,000 bags are planted per mu in greenhouse.
[0104] In step (4), the light intensity in the greenhouse is adjusted by using a shade net; the light intensity in the commercial forest is adjusted by tending and harvesting or by building small arched sheds.
[0105] In step (4), after covering with soil, the plants can be harvested 59 days later.
[0106] Example 5
[0107] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0108] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0109] Step A, Propagation of Mother Culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and incubate it at 24℃ for 8 days to obtain mycelial blocks;
[0110] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 20 parts agar powder, and 1000 parts water;
[0111] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture in a shaker at 28 ℃ for 8 days to obtain the seed liquid;
[0112] The shake flask culture medium comprises the following ingredients by weight: 200 parts potato, 20 parts glucose, 2 parts yeast powder, 0.2 parts ferric chloride, 1000 parts water, with a pH of 6.5.
[0113] Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 24℃ for 9 days to obtain liquid inoculum;
[0114] The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2400 parts glucose, 100 parts peptone, 100 parts yeast powder, 120 parts potassium dihydrogen phosphate, 60 parts ferric chloride, and 100,000 parts water, with a pH of 6.5.
[0115] Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a 26℃ incubator for 28 days;
[0116] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 78 parts hardwood sawdust, 18 parts wheat bran, 2 parts soybean meal, 1 part gypsum powder, and 0.7 parts lime powder; pH value 7, moisture content 60%;
[0117] Step E, Soil Covering Cultivation: After the mycelium has fully grown in the cultivation bag, transport it to the cultivation base and continue to ripen for 6 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag and harvest the spores or harvest the fruiting bodies.
[0118] Example 6
[0119] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0120] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0121] Step A, Propagation of Mother Culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and incubate it at 24℃ for 7 days to obtain mycelial blocks;
[0122] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19 parts glucose, 19 parts agar powder, and 990 parts water;
[0123] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture in a shaker at 27.5 ℃ for 7 days to obtain the seed liquid;
[0124] The shake flask culture medium comprises the following ingredients by weight: 200 parts potato, 19 parts glucose, 1.9 parts yeast powder, 0.19 parts ferric chloride, 990 parts water, with a pH of 6.0.
[0125] Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 23.5℃ for 8 days to obtain liquid inoculum;
[0126] The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2350 parts glucose, 90 parts peptone, 90 parts yeast powder, 115 parts potassium dihydrogen phosphate, 59 parts ferric chloride, and 99,000 parts water, with a pH of 6.0.
[0127] Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a 26℃ incubator for 25 days;
[0128] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 77 parts hardwood sawdust, 17 parts wheat bran, 1.9 parts soybean meal, 0.9 parts gypsum powder, and 0.5 parts lime powder; pH value 6, moisture content 55%;
[0129] Step E, Soil Covering Cultivation: After the mycelium has fully grown in the cultivation bag, transport it to the cultivation base and continue to ripen for 5 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag and harvest the spores or harvest the fruiting bodies.
[0130] In step E, the cultivation base is either a greenhouse or under commercial forest; 3,000 bags are planted per acre under commercial forest, and 6,000 bags are planted per acre in greenhouse.
[0131] In step E, the light intensity in the greenhouse is adjusted by using shade nets; the light intensity under the commercial forest is adjusted by tending and harvesting or by building small arched sheds; in step E, after covering with soil, the trees can be harvested 58 days later.
[0132] In step E, the greenhouse maintains soil moisture of 20-30%, air humidity of 70-90%, and CO2 concentration of less than 0.05%; the canopy closure of the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.
[0133] Example 7
[0134] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0135] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0136] Step A, Propagation of Mother Culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and incubate it at 24℃ for 10 days to obtain mycelial blocks;
[0137] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 21 parts glucose, 21 parts agar powder, and 1010 parts water;
[0138] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture in a shaker at 28.5 ℃ for 10 days to obtain the seed liquid;
[0139] The shake flask culture medium comprises the following ingredients by weight: 200 parts potato, 21 parts glucose, 2.1 parts yeast powder, 0.21 parts ferric chloride, 1010 parts water, with a pH of 7.0.
[0140] Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 24.5℃ for 11 days to obtain liquid inoculum;
[0141] The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2450 parts glucose, 110 parts peptone, 110 parts yeast powder, 125 parts potassium dihydrogen phosphate, 61 parts ferric chloride, 101000 parts water, with a pH of 7.0.
[0142] Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a 26℃ incubator for 30 days;
[0143] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 79 parts hardwood sawdust, 19 parts wheat bran, 2.1 parts soybean meal, 1.1 parts gypsum powder, and 0.8 parts lime powder; pH value 8, moisture content 65%;
[0144] Step E, Soil Covering Cultivation: After the mycelium has fully grown in the cultivation bag, transport it to the cultivation base and continue to ripen for 7 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag and harvest the spores or harvest the fruiting bodies.
[0145] In step E, the cultivation base is either a greenhouse or under commercial forest; 4,000 bags are planted per acre under commercial forest, and 8,000 bags are planted per acre in greenhouse.
[0146] In step E, the light intensity in the greenhouse is adjusted by using shade nets; the light intensity in the commercial forest is adjusted by tending and harvesting or by building small arched sheds; in step E, after covering with soil, the trees can be harvested 60 days later.
[0147] In step E, the greenhouse maintains soil moisture of 20-30%, air humidity of 70-90%, and CO2 concentration of less than 0.05%; the canopy closure of the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.
[0148] Example 8
[0149] A Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp .It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
[0150] The cultivation method of Ganoderma lucidum strain L4905 in this embodiment includes the following steps:
[0151] Step A, Propagation of Mother Culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and incubate it at 24℃ for 9 days to obtain mycelial blocks;
[0152] The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 20 parts agar powder, and 1000 parts water;
[0153] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture in a shaker at 28 ℃ for 8 days to obtain the seed liquid;
[0154] The shake flask culture medium comprises the following ingredients by weight: 200 parts potato, 20 parts glucose, 2 parts yeast powder, 0.2 parts ferric chloride, 1000 parts water, with a pH of 6.7.
[0155] Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 24℃ for 10 days to obtain liquid inoculum;
[0156] The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2400 parts glucose, 100 parts peptone, 100 parts yeast powder, 120 parts potassium dihydrogen phosphate, 60 parts ferric chloride, 100,000 parts water, with a pH of 6.7.
[0157] Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a 26℃ incubator for 28 days;
[0158] The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 78 parts hardwood sawdust, 18 parts wheat bran, 2 parts soybean meal, 1 part gypsum powder, and 0.7 parts lime powder; pH value 7, moisture content 60%;
[0159] Step E, Soil Covering Cultivation: After the mycelium has fully grown in the cultivation bag, transport it to the cultivation base and continue to ripen for 6 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag and harvest the spores or harvest the fruiting bodies.
[0160] In step E, the cultivation base is either a greenhouse or under commercial forest; 3,500 bags are planted per acre under commercial forest, and 7,000 bags are planted per acre in greenhouses.
[0161] In step E, the light intensity in the greenhouse is adjusted by using shade nets; the light intensity in the commercial forest is adjusted by tending and harvesting or by building small arched sheds; in step E, after covering with soil, the trees can be harvested 59 days later.
[0162] In step E, the greenhouse maintains soil moisture of 20-30%, air humidity of 70-90%, and CO2 concentration of less than 0.05%; the canopy closure of the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.
[0163] Application Examples
[0164] 1. Source of Ganoderma lucidum strain L4905
[0165] On August 17, 2019, the breeding group collected wild Ganoderma lucidum strains in Mengzi County, Honghe Prefecture, Yunnan Province, and obtained pure strain—Ganoderma lucidum strain L4905—through tissue isolation and purification.
[0166] 1.1 Separation and purification (tissue separation)
[0167] Small pieces of wild Ganoderma lucidum internal tissue were cut near an alcohol lamp and placed on PDA medium to germinate. After purification, pure strains were obtained. Under the same culture conditions, mycelial growth indicators such as growth rate, thickness, and density were compared. Strains with weak mycelia were eliminated, and effective strains with the best mycelial growth and capable of producing fruiting bodies were selected. This resulted in Ganoderma lucidum strain L4905, which was named "Yunling No. 1".
[0168] 1.2 Molecular Identification
[0169] A suitable amount of pure cultured mycelium was scraped and ground with liquid nitrogen (or a grinder). Total DNA was extracted using a plant genomic DNA extraction kit (Shanghai Sangon Biotech Co., Ltd.) following the instructions. Four gene fragments were selected using RNA polymerase chain reaction (PCR): ITS, nLSU, ... TEF-1α , RBP 2. Amplification was performed. The specific primer base composition is shown in Table 1. The PCR amplification system used was a 25 μL reaction system, which included: 12.5 μL of 2×T5 Super PCR Mix, 1 μL each of forward and reverse primers (both at a concentration of 0.1 mmol / μL), 1 μL of DNA template, and 9.5 μL of sterile ddH2O. Then, PCR amplification was performed.
[0170] Table 1 Primers and base composition used for PCR amplification
[0171]
[0172] Note: Bases include a, t, c, and g. Other letters in the primers represent degenerate bases.
[0173] The ITS PCR reaction procedure is as follows: initial denaturation at 94 ℃ for 5 min; 94 ℃ for 30 s, 53 ℃ for 30 s, 72 ℃ for 50 s, repeated for 35 cycles; final extension at 72 ℃ for 10 min.
[0174] The PCR reaction procedure for nLSU is as follows: initial denaturation at 94 ℃ for 5 min; 94 ℃ for 30 seconds, 52 ℃ for 30 seconds, 72 ℃ for 1 min, 35 cycles; final extension at 72 ℃ for 10 min.
[0175] The PCR reaction procedure for TEF1-α is as follows: initial denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 seconds, denaturation at 55℃ for 30 seconds, denaturation at 72℃ for 50 seconds, repeated for 35 cycles, followed by a 10 min extension at 72℃.
[0176] RPB The PCR reaction procedure for 2 is as follows: initial denaturation at 94 ℃ for 5 min; 94 ℃ for 30 seconds, 50 ℃ for 30 seconds, 72 ℃ for 50 seconds, repeated for 35 cycles, followed by a 10 min extension at 72 ℃.
[0177] The amplified product was stored at 4 ℃.
[0178] Accurately weigh 1g of agarose using an electronic balance and dissolve it in 100mL of 0.5×TBE buffer (Tris-borate-EDTA). Heat the solution in a microwave oven on medium heat for 2.0 min until it becomes clear and transparent. When the temperature reaches 65 ℃, add 1μL of nucleic acid dye and mix thoroughly. Pour the solution into a silica gel plate and allow it to cool. Place the plate in an electrophoresis pool and use a pipette to spot the sample. The sample volume is 5μL. The electrophoresis time is 160V, 90A, and 15min. After electrophoresis in 1.0×TBE buffer, observe, photograph, and record the results using a UV gel imaging system. Detect the concentration of extracted DNA. Send positive products to Shanghai Sangon Biotech for sequencing.
[0179] The ITS sequence is: tttccgtaggtgaacctgcggaaggatcattatcgagttttgaccgggttgtagctggccttccgaggcatgtgcacgccctgytcatccactctacacctgtgcacttactgtgggcttcagattgcgaggcacgctctttaccgggcttgcggagcatatctgtgcctgcgtttatcacaaactctataaagtaacagaatgtgtattgcgatgtaacacatctatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgtttgagtgtcatgaaatcttcaacctacaagcttttgtggtttgtaggcttggacttggaggtttgtcggccgttatcggtcggctcctcttaaatgcattagcttggttccttgcggatcggctctcggtgtgataacgtctacgccgygaccgtgaagcgtttggcgagcttctaaccgtcttataagacagctttatgacctctgacctcaaatcaggtaggactacccgctgaacttaagcatatcaataagcggagg (SEQ ID NO.9)
[0180] The nLSU sequence is: gcagttttgctgtccgagttgtaatctggagaagtgtcttccgcgttggaccgtgtacaagtctcttggaatagagcgtcatagagggtgagaatcccgtccatgacacggactaccaatgctctgtgatacactttctaagagtcgagttgtttgggaatgcagctcaaaatgggtggtaaattccatctaaagctaaatattggcgagagaccgatagcgaacaagtaccgtgagggaaagatgaaaagcactttggaaagagagttaaacagtacgtgaaattgttgaaagggaaacgcttcaagtcagtcgcgtcttactagactcagctttgcttcggcttagtgtacttctaataagacgggtcaacatcaattttggtcggtggaaaaaggtttgagaaatgtagcgtatcttcgggtacgtgttatagtctcttactgtatacactggctgggattgaggtctgcagcacgcctttatggccagggttcgcccatgtaacgtgcttaggatgttggcataatggctttaagcgacccgtcttgaaacacggaccaaggagtctaacatgcctgcgagtattagggtggaaaacccttgtgcgtaatgaaagtgaaagttgggaactctcgcaagggagtgcaccgacgcccggccctgaagtttacggacggtgctgcggtagagcatgtatgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagag (SEQ ID NO.10)
[0181] TEF1-αThe sequence is: ttgacatcaccactcttgcctgtcttagtccagcccttgtaccatttagctctacagcgatattgtaagctttatgttaagataattaatatttgaagttagagcttactcttccaaggtggtctcctcaatcatattgtcaccttcgaaaccggaaatagggacaaacggaacgctcttagggttgtatccgaccttcttaatgaagttagaagtttccgtgacaatttcaaggaaacgtttctcctcccacttaaaggagaagcttcagcaacaaaaaggtaagaagaaagtaatatgactgaccttgacggagtccattttgttgacggcaacgatgagttgtcgtacaccgagagtgaacgcaagtagtgcgtgttcacgagtctggccatccttggagataccggcctcgaattcacccgtaccaccagcaatgatgaggataga (SEQ ID NO.11)
[0182] RBP The sequence is:
[0183] ctacgagcctccaccagagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacatacatgctctaccgcagcaccgtccgtaaacttcagggccgggcgtcggtgcactcccttgcgagagttcccaactttcactttcattacgcacaagggttttccaccctaatactcgcaggcatgttagactccttggtccgtgtttcaagacgggtcgcttaaagccattatgccaacatcctaagcacgttacatgggcgaaccctggccataaaggcgtgctgcagacctcaatcccagccagtgtatacagtaagagactataacacgtacccgaagatacgctacatttctcaaacctttttccaccgaccaaaattgatgttgacccgtcttattagaagtacactaagccgaagcaaagctgagtctagtaagacgcgactgacttgaagcgtttccctttcaacaatttcacgtactgtttaactctctttccaaagtgcttttcatctttccctcacggtacttgttcgctatcggtctctcgccaatatttagctttagatggaatttaccacccattttgagctgcattcccaaacaactcgactcttagaaagtgtatcacagagcattggtagtccgtgtcatggacgggattctcaccctctatgacgctctattccaagagacttgtacacggtccaacgcggaagacacttctccagattacaactcgg (SEQ ID NO.12)
[0184] Based on four gene fragments (ITS, nrLSU, TEF1 -α, RPB2) Based on the BLAST alignment results in NCBI data, four gene fragment sequences from nine Ganoderma species were downloaded from GenBank. After alignment using Maft and sequence matrix assembly, with *Tomophagus colossus* as the outgroup, a maximum likelihood tree was constructed using RaxML with 100 repetitions, and branches showing a support greater than 70% were marked. For example... Figure 1 As shown, phylogenetic analysis results indicate that both strain L4905 and control strain L4287 (Ganoderma lucidum, a Ganoderma lucidum variety approved by the Sichuan Academy of Agricultural Sciences in 2008) are Ganoderma lucidum (Ganoderma lucidum). G.lingzhi The approval rating is 100%.
[0185] 1.3 SSR Molecular Markers
[0186] (1) DNA extraction
[0187] The tested bacterial strain was transferred to potato dextrose agar solid medium and cultured at 25°C for 15 days. Mycelia were then collected. Genomic DNA was extracted from the mycelia using the DE711-50 kit from Jinsha Biotechnology. The purity and concentration of the DNA were determined by agarose gel electrophoresis and biospectrophotometry.
[0188] The potato glucose agar solid culture medium consists of: 200 g potato (peeled), 20 g glucose, 16 g agar, 2 g yeast powder, 2 g peptone, 0.2 g potassium dihydrogen phosphate, and 0.2 g magnesium sulfate.
[0189] (2) Genome sequencing
[0190] After DNA extraction, purification, and library construction, the samples were sequenced using sequencing technology on a sequencing platform. SSR sites were searched within the genome sequence of the Ganoderma lucidum strain L4905.
[0191] (3) Development of SSR primers based on genome sequencing results
[0192] Based on Ganoderma lucidum genome data, six pairs of SSR primers were developed and screened to distinguish Ganoderma lucidum strain L4905 from control L4287 using primer set 1, primer set 2, primer set 3, primer set 4, primer set 5, and primer set 6. Detailed labeling information is shown in Table 2.
[0193] Table 2 SSR marker primer information
[0194]
[0195] (4) PCR amplification
[0196] SSR molecular markers were used to perform SSR-labeled PCR amplification on the extracted DNA.
[0197] The PCR amplification system consisted of a total volume of 25 μL, including: 12.5 μL of Sangon Biotech 2XT5 Super PCR Mix (with black dye); 1 μL each of SSR-labeled forward and reverse primers (both at 0.1 mmol / μL); 1 μL of template DNA; 9.5 μL of sterile ddH2O; 2 μL each of SSR-labeled forward and reverse primers (both at 0.1 mmol / μL); and 2 μL of template DNA. PCR reaction conditions were: 95 ℃ for 2 min; 95 ℃ for 30 s, 53 ℃ for 30 s, 72 ℃ for 30 s, for 38 cycles; 72 ℃ for 5 min. To ensure accurate identification, three replicates were performed. The L4287 strain was used as a control, with three replicates under the same conditions.
[0198] (5) Electrophoresis
[0199] Electrophoresis was performed using polyacrylamide gel, followed by silver staining to reveal bands.
[0200] Mix the following reagents: 48 mL of 1×TBE solution; 12 mL of Acr-Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED;
[0201] Immediately after mixing, pour the gel and remove air bubbles. After the gel solidifies, perform electrophoresis; the sample volume is 2 μL per well, and the electrophoresis conditions are 270 V constant voltage for 1 h. After electrophoresis, wash the gel twice with distilled water; add 400 mL of 10% silver nitrate solution and shake on a shaker for 8 min; after silver staining, wash twice with water; add sodium hydroxide and formaldehyde for color development (NaOH 6 g, distilled water 400 mL, formaldehyde solution 2 mL).
[0202] Table 3. Comparison of amplified fragment sizes of primers in Ganoderma lucidum strain L4905 and control (CK).
[0203]
[0204] from Figure 2 As shown in Table 3, Ganoderma lucidum strains L4905 and L4287 exhibit different band patterns after PCR amplification using SSR primer sets 1, 2, 3, 4, 5, and 6 under the same PCR conditions. These six pairs of SSR primers can be used to distinguish between Ganoderma lucidum strains L4905 and L4287.
[0205] 1.4 Antagonism Experiment
[0206] Antagonism tests were conducted on the isolated Ganoderma lucidum strain L4905 and the control strain L4287. The results showed that Ganoderma lucidum strains L4905 and L4287 had strong antagonistic reactions and no affinity, forming "raised" antagonistic lines. Figure 3 This indicates that the two are different strains of Ganoderma lucidum. The mycelium of the Ganoderma lucidum strain L4905 grows faster.
[0207] 2. Morphological characteristics of the sub-entity
[0208] 2.1 Morphological observation results
[0209] Morphological observation such as Figure 4 As shown, the fruiting body is a basidiosperm, annual or perennial, stalked, corky when fresh, odorless, and bitter, becoming hard corky or woody when dried. The cap is fan-shaped to round, 5–11 cm long, 3.5–8 cm wide, and 1.1 cm thick, with a dull, yellowish-brown to reddish-brown surface. The cap surface usually has concentric rings, more pronounced near the edge, and fine (radiating) grooves in the center, without cracking. The edge is distinct, sharp or blunt, sometimes slightly rolled, and variable in color, pale yellow, pale yellowish-brown to yellowish-brown when young, turning yellowish-brown to reddish-brown when mature. The flesh can be up to 0.4 cm thick, usually layered in color, with a light brown upper layer and a dark brown lower layer, corky, without concentric rings, sometimes with black shell-like lines in mature basidiosperms. The tubes can be up to 0.6 cm long, brown or dark brown, hard corky, and not layered. There are 5–7 pores per millimeter, angular, nearly round, or round, with slightly thick or thick walls, mostly entire; the surface of the pores turns sulfur-colored when mature, turns brown or dark brown when touched, and pale yellow when dry. The stipe is 5.0–13 cm × 1.6–2.8 cm, lateral, dorsal, or eccentric, flat or nearly cylindrical, with a smooth surface and a strong lacquer-like luster, orange-yellow to light yellowish-brown when young, turning reddish-brown to purplish-black woody or softwood when mature.
[0210] The mycelial system is divided into three types: reproductive hyphae, 1-2.5 μm in diameter, with clamp connections, thin-walled, colorless, and uncommon; skeletal hyphae, 2-5 μm in diameter, thick-walled to sub-solid, mostly dibranched, pale brown to brown, and the majority; and twining hyphae, 1-3 μm in diameter, thick-walled, often interlacing and branched, pale yellow, thick-walled with a narrow lumen, and rarely sub-solid. All three types of hyphae are classified as IKI. - CB + The tissue turns black in KOH reagent.
[0211] Cortex cells: 22-40×7-10 μm in length and width, club-shaped, bright yellow, thick-walled to subsolid, cortex cells in mature basidiosus usually have a strong starch reaction.
[0212] Basidiospores: (40 / 2 / 2)9.0- 10.0- 11.0(12.0)×(5.0)5.5- 6.1- 6.5 (7.0) μm, Q = (1.50)1.51–1.90 (2.02), Qm = 1.68 ± 0.13 (including umbilicus); oval to broadly elliptical, with umbilicus, which becomes distinctly truncate after falling off, light yellowish-brown, KI - CB + It exhibits a starch reaction, has a double-walled structure, with a smooth outer wall and a moderately rough, dotted surface on the inner wall. The basidia are broadly club-shaped to bladder-shaped, transparent, with clamp connections and four basidia stalks, 9-12 × 7-10 μm; the pseudo-basidiodes are pear-shaped to fusiform, 8-12 × 7-11 µm.
[0213] 3. Microbial culture
[0214] 3.1 Mother culture medium and its preparation
[0215] (1) Mother culture medium
[0216] ① The mother culture PDA medium consists of the following ingredients by weight: 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, and 990-1010 parts water;
[0217] (2) Preparation of mother culture medium
[0218] ① Process flow for preparing mother culture medium: material selection → accurate weighing (according to formula) → material processing → quantitative preparation → dispensing into test tubes → sterilization and placement on slant culture.
[0219] ② Preparation of mother culture medium
[0220] A. Cooking: Peel the potatoes, wash and slice them. Weigh 200 g, add 1000 mL of water, heat and boil until the potato slices are tender but not mushy, then filter through six layers of gauze.
[0221] B. Preparation: Add 20 g of glucose and 20 g of agar to the filtrate, add water to a final volume of 1L, and stir to dissolve.
[0222] C. Dispensing and Sterilization: After dissolving, dispense the solution while still hot into test tubes, generally filling them to 1 / 5-1 / 4 of their length. After dispensing, plug the tubes with cotton plugs (5 plugs per bundle), and secure one end of the tube opening with kraft paper. Place the tubes in an autoclave and sterilize at 121°C for 20 minutes.
[0223] D. Slant placement: After sterilization, remove the test tubes while they are still hot and place them on the workbench in a slant. Usually, the length of the slant is 1 / 2 of the length of the test tube. After solidification, place them in a clean and dry place for later use.
[0224] ③ The mother culture is isolated using the tissue isolation method, which has the advantages of being simple and convenient, having stable genetic traits, and strong regeneration ability. Simply take a piece of fruiting body tissue under aseptic conditions, place it on an agar slant culture medium, and encourage it to develop into the vegetative growth stage to obtain a good strain.
[0225] A. For the separated fruiting bodies, select those that are large, thick, free from pests and diseases, slightly firm in texture, and robust in growth and development.
[0226] B. Collect fresh fruiting bodies, scrape off impurities at the base with a knife, wipe with a cotton ball (after squeezing out the alcohol solution), place in a petri dish, and transfer to a clean bench. Disinfect hands, and sterilize inoculation needles, tweezers, and blades over an alcohol lamp flame for later use. Use a scalpel to cut an appropriate size tissue block and inoculate it into the culture medium. The isolation site should ideally be the junction of the stipe and cap, as the basal tissue has strong cell regeneration ability, making it easier to obtain strains with excellent characteristics.
[0227] C. Wrap the inoculated test tubes with sealing film and place them in a 24°C incubator. During the incubation process, check the mycelial growth daily and remove any contaminating bacteria promptly. 24 hours after inoculation, short, weak, white mycelia will grow around the inoculation block. The test tubes will generally be fully colonized in 7-10 days.
[0228] 3.2 Production of primary and cultivars
[0229] (1) Culture substrate formulation
[0230] The original culture medium in the original culture bottle includes the following raw materials by weight: 72-74 parts hardwood sawdust, 23-25 parts wheat bran, 0.9-1.1 parts white sugar, 0.9-1.1 parts gypsum powder, and 0.8-1.2 parts lime powder; pH value 6-8, moisture content 55-65%;
[0231] The cultivation substrate in the cultivation bags comprises the following raw materials by weight: 77-79 parts hardwood sawdust, 16-18 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.8-1.2 parts lime powder; pH value 6-8, moisture content 55-65%;
[0232] (2) Production of original seeds and cultivated seeds
[0233] ① Ingredients and pretreatment: Weigh the ingredients according to the formula. Among them, the sawdust and wheat bran need to be pre-wetted with water before being mixed with other auxiliary materials; the buckwheat needs to be soaked in water with 0.2% lime beforehand.
[0234] ② Mixing and bottling (bagging): Mix the prepared main material with other ingredients until the water content is 55-65%. Use breathable cap tissue culture bottles for the original culture and use mushroom bags for the cultivated culture. Pack the bottles (bags) tightly and punch holes in the center for easy inoculation.
[0235] ③ Sterilization: Before sterilization, cold air must be completely removed to ensure that any bacteria in the sterilization package are completely killed. The original culture bottle is placed in an autoclave and sterilized at 121 ℃ and 0.103 MPa for 2 hours.
[0236] ④ Inoculation: After inoculation, sterilize the original culture bottles in the inoculation room and sterilize them with a UV lamp for half an hour before inoculation. Strict aseptic procedures must be followed during the operation. Cut the mother culture into small pieces and inoculate them into the central cavity of the culture medium, placing the fruiting body pieces on the surface. After inoculation, transfer all the original culture bottles into the culture room and maintain the temperature at 26℃. Check the original culture bottles for contamination with other microorganisms at least once a week. If contaminated bottles are found, remove them from the culture room immediately and record the mycelial growth of the Ganoderma lucidum variety.
[0237] 3.3 Preparation of liquid culture
[0238] Liquid spawn promotes rapid mycelial growth, inoculating 10-20 days faster than traditional solid spawn. Using liquid spawn for propagation shortens the production cycle, enabling the cultivation of large quantities of spawn in a short period, thus saving cultivation costs and meeting production demands. Liquid spawn offers advantages such as high quality, consistent mycelial age, convenient inoculation, and lower cost.
[0239] Recipe for preparing liquid culture in shake flasks (1 L):
[0240] 200 g potatoes, 20 g glucose, 2 g yeast powder, 0.2 g ferric chloride, 1000 mL water, pH 7.0;
[0241] Seed liquid preparation:
[0242] Prepare the liquid culture medium according to the formula, dispense it into 500 mL Erlenmeyer flasks, sterilize at 121 ℃ for 20 minutes, and after cooling, inoculate the Ganoderma lucidum mycelium blocks into the liquid culture medium. Incubate at 27.5-28.5 ℃ for 7-10 days to obtain the seed culture.
[0243] ③ Fermentation tank construction:
[0244] The liquid culture formula (100L) is as follows: 600 g soluble starch, 2400 g glucose, 100 g peptone, 100 g yeast powder, 120 g potassium dihydrogen phosphate, 60 g ferric chloride, 100,000 g water, and pH 7.0.
[0245] B. Prepare the fermentation liquid according to the formula, and cool it for later use;
[0246] C. Inoculate the cooled fermentation broth into the fermentation tank with 1% of the Ganoderma lucidum strain L4905 seed liquid;
[0247] D. After inoculation, the fermenter can be used after being cultured at 23.5-24.5℃ for 8-11 days.
[0248] 3.4 Cultivation Bag Production
[0249] (1) Cultivation substrate formula
[0250] The cultivation substrate in the cultivation bags comprises the following raw materials by weight: 77-79 parts hardwood sawdust, 17-19 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.5-0.8 parts lime powder; pH value 6-8, moisture content 55-65%;
[0251] (2) Production of cultivation bags
[0252] ①Ingredient preparation and pretreatment:
[0253] Weigh out the ingredients according to the formula. The sawdust and wheat bran need to be pre-wetted with water 24 hours in advance. Dissolve the required soybean meal, gypsum and lime in water first, then sprinkle them on the sawdust and wheat bran. Add water while stirring, pile and let it sit for 1 hour, then stir again until uniform.
[0254] ②Bagging:
[0255] Use 17cm×35cm×0.05cm polypropylene bags for packing. The packing should be appropriately tight, compacting the substrate as you add it. After packing, use a perforator to punch holes with a diameter of 1.5~2.0cm in the center of the substrate surface for inoculation. The bag height should be approximately 20cm after packing. Then, attach the ring and cap. Each bag of substrate has a dry weight of 0.5kg and a wet weight of 1.0~1.2kg.
[0256] Sterilization:
[0257] Sterilize using atmospheric pressure steam. During the heating process, vent cold air in advance. When the temperature reaches 110℃, start timing and maintain this temperature for 8~10 hours. Then stop heating and allow it to cool naturally. When the internal temperature of the sterilizer drops below 60℃, the bags can be transferred to the cooling chamber for natural cooling.
[0258] Inoculation in cultivation bags:
[0259] Place the cultivation bags and cultured inoculum into the inoculation room and sterilize them with a UV lamp for half an hour before inoculation. Strict aseptic technique must be followed during the procedure. Thoroughly disinfect hands, cultivation bags, and tools with 75% alcohol swabs. Flame and cool the scalpel and forceps over an alcohol lamp. Then, use the scalpel to transfer the inoculum at a 1:20 propagation ratio or 20 mL of liquid inoculum per bag. Seal the bag with a sterilized sponge. After inoculation, transfer the cultivation bags to the incubation room and incubate in the dark at 26 ℃. The bags will fully colonize in 25-30 days. During the incubation process, promptly discard any cultivation bags contaminated with other microorganisms.
[0260] 4. Small-scale preliminary screening
[0261] The Ganoderma lucidum was cultivated using a substrate-based soil covering method. Following the requirements of GB / T 21125-2007 (Edible Fungus Variety Selection Standard), the small-scale preliminary screening experiment was designed with 12 bags per group and 3 replicates. Each bag contained 550 g of dry substrate, and liquid inoculation was used at 10 mL per bag. The bags were opened at a small opening and tilted at a 45-degree angle for soil covering. Each group of bags contained 6.6 kg of dry substrate.
[0262] 4.1 Experimental Design
[0263] Each group consists of 12 bags, with 120 mL of liquid inoculum per group and 6.6 kg of dry substrate per bag. The experiment is repeated 3 times. For Ganoderma lucidum strain L4905, the liquid inoculum is 360 mL and the dry substrate per bag is 19.8 kg.
[0264] 4.2 Results and Analysis
[0265] Table 4. Statistics on fruiting yield and traits of Ganoderma lucidum strain L4905 in the initial screening of small-scale trials.
[0266]
[0267] Note: "M±SD" represents the mean ± standard deviation. Five bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured. Ten fruiting bodies were randomly selected to calculate the average value of the fruiting body characteristics.
[0268] Table 4 shows that the fruiting of Ganoderma lucidum strain L4905 in the small-scale preliminary screening test was good. The yield results showed that the average yield of group 1 was 63 g / bag, group 2 was 71 g / bag, and group 3 was 68 g / bag, with an average yield of 67.33 g / bag for the three groups. The experimental results were good, with uniform fruiting, large caps, thick flesh, and a yellowish-brown to pale yellow surface with distinct white to light yellow edges, obvious ring patterns and radial longitudinal ridges. The average cap length was 13.10 cm and the average width was 5.12 cm. The stipe was long, flat cylindrical, brownish-red, and lateral, with an average length of 10.17 cm. The average fresh weight of a single fruiting body was 67.33 g, and the biological efficiency was 12.24%.
[0269] 5. Small-scale secondary screening
[0270] The Ganoderma lucidum was cultivated using a substrate-covered soil method. Following the requirements of GB / T 21125-2007 Technical Specifications for the Breeding of Edible Fungi, the small-scale screening experiment was designed with 30 cultivation bags per group and 3 replicates. Each bag contained 550 g of dry substrate, and liquid inoculation was used, with an inoculation volume of 10 mL per bag. Therefore, the inoculation volume per group was 300 mL, and the total dry substrate per bag was 16.5 kg.
[0271] 5.1 Experimental Design
[0272] Each group consists of 30 bags, with 300 mL of liquid inoculum and 16.5 kg of dry substrate per bag. There are 3 replicates. For Ganoderma lucidum strain L4905, the liquid inoculum is 900 mL and the dry substrate per bag is 49.5 kg.
[0273] 5.2 Results Analysis
[0274] Table 5. Statistics on fruiting yield and traits of Ganoderma lucidum strain L4905 in small-scale secondary screening.
[0275]
[0276] Note: "M±SD" represents the mean ± standard deviation. Five bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured. Twenty fruiting bodies were randomly selected to calculate the average value of the fruiting body characteristics.
[0277] As shown in Table 5, the Ganoderma lucidum strain L4905 exhibited good fruiting characteristics in the small-scale re-screening, with good uniformity and stable cultivation traits. The fruiting bodies were yellowish-brown with a glossy, lacquer-like surface. The caps were large, thick, and had distinct ring patterns and radial longitudinal ridges. The average cap length was 12.37 cm and the average width was 6.18 cm. The fleshy layer was brown with an average thickness of 1.5 cm. The average stipe length was 10.47 cm. The average fresh weight of a single bag of fruiting bodies was 72 g, the average dry weight was 28.33 g, the average spore yield was 20.72 g, and the average biological efficiency was 13.09%.
[0278] 6. Intermediate Experiment
[0279] The Ganoderma lucidum was cultivated using a substrate-covered soil method, following the requirements of GB / T 21125-2007 Technical Specifications for the Breeding of Edible Fungi. The intermediate trial design involved 1200 bags per group, with 3 replicates. Each bag contained 550g of dry substrate, and liquid inoculation was used, with an inoculation volume of 10mL per bag. Therefore, the inoculation volume per group was 12L, and the total dry substrate per group was 660kg.
[0280] 6.1 Experimental Design
[0281] Each group consists of 1200 bags, with 12L of liquid inoculum per group and 660kg of dry substrate per bag. With three replicates, the total liquid inoculum for Ganoderma lucidum strain L4905 is 36L, and the total dry substrate per bag is 1980kg.
[0282] 6.2 Results and Analysis
[0283] Table 6. Statistics on fruiting yield and traits of Ganoderma lucidum strain L4905 in intermediate experiments.
[0284]
[0285] Note: "M±SD" represents the mean ± standard deviation. 30 bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured. For the fruiting body characteristics, 30 fruiting bodies were randomly selected and the average value was calculated.
[0286] Table 6 shows that the Ganoderma lucidum strain L4905 has a high yield. The fruiting bodies are yellowish-brown, with an average cap length of 13.37 cm, an average width of 6.53 cm, and an average thickness of 1.52 cm, exhibiting a relatively soft texture. The stipe is reddish-brown, with an average length of 10.37 cm. The average fresh weight of a single fruiting body is 77.67 g, and the average dry weight is 30 g, with a biological efficiency of 14.12%. From initial screening in small-scale trials to secondary screening in small-scale trials and intermediate trials, due to increasingly mature artificial domestication and cultivation management techniques, the strain matures on average at 59 days and begins to release spores, resulting in a stable increase in yield. This indicates that the Ganoderma lucidum strain L4905 has good stability, a short fruiting cycle, high fruiting rate, high yield, and high spore production.
[0287] 7. Years of demonstration cultivation
[0288] 7.1 Experimental Design
[0289] The Ganoderma lucidum strain L4905 was used for substrate-covered bag cultivation. Following the requirements of GB / T 21125-2007 Technical Specifications for Edible Fungi Variety Breeding, the demonstration cultivation experiment was designed with 10,000 bags per group (three replicates per site, approximately 3,600 bags per replicate). Each bag contained 550 g of dry substrate, and liquid inoculation was used at 10 mL per bag, resulting in an inoculation volume of 36.0 L per group and 1980 kg of dry substrate per group. Ganoderma lucidum strain L4287 served as a control. The same batch of inoculum and cultivation bags were used at each site to ensure consistent inoculum quantity and demonstration cultivation management techniques.
[0290] 7.2 Selection of Demonstration Sites
[0291] Songming County, Kunming City, Panlong District, Kunming City, Wuding County, Chuxiong Prefecture, and Xundian County, Kunming City, Yunnan Province.
[0292] 7.3 Cultivation Methods
[0293] 1) Seasonal selection
[0294] Depending on natural conditions and the growth characteristics of Ganoderma lucidum, seed production (bags) begins from mid-December to early March of the following year. The cultivation season for Ganoderma lucidum is from early April to mid-June each year, and the harvest season is from late June to mid-September. Ganoderma lucidum can be cultivated using natural (environmental) temperatures.
[0295] 2) Site selection
[0296] Cultivation sites are mostly greenhouses, and should be sunny, sheltered from the wind, dry, hygienic, and close to a water source. For semi-wild Ganoderma lucidum cultivation, the planting site should be a mountain forest with convenient transportation, no pollution, dense forests, gentle slopes, high humidity, and deep soil.
[0297] 3) Ganoderma lucidum substrate cultivation method
[0298] ① Formula selection:
[0299] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 77-79 parts hardwood sawdust, 16-18 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.8-1.2 parts lime powder; pH value 6-8, moisture content 55-65%; ② Culture medium preparation
[0300] Ingredients: Weigh out all ingredients according to the formula. The sawdust and wheat bran need to be pre-moistened.
[0301] Mixing: Pre-wet the raw materials in advance. Dissolve the required soybean cake powder, lime, and gypsum in water, then sprinkle them on the sawdust and bran. Add water while stirring. Adjust the pH with quicklime, pile and let it sit for 1 hour, then stir again until uniform.
[0302] Bagging: Use 17 cm × 35 cm × 0.05 cm polypropylene bags. The packing should be appropriately tight, compacting the culture medium as you fill. After packing, use a perforator to punch holes with a diameter of 1.5–2.0 cm in the center of the medium surface for inoculation. The bag height should be approximately 20 cm after packing. Then, attach the ring and cap. Each bag of culture medium has a dry weight of 0.55 kg and a wet weight of 1.0–1.2 kg.
[0303] Sterilization: Sterilize using atmospheric pressure steam. During the heating process, vent cold air in advance. When the temperature reaches 100 ℃, start timing and maintain this temperature for 8~10 hours. Then stop heating and allow it to cool naturally. When the internal temperature of the sterilizer drops below 60 ℃, the bags can be transferred to the cooling chamber for natural cooling.
[0304] Cooling: After sterilization, remove the product and place it in a pre-cooling room or inoculation room to cool.
[0305] ③ Vaccination
[0306] Once the temperature of the spawn bag has cooled to around 25°C, it is moved to the inoculation table. Following aseptic procedures, one person is responsible for opening the plastic cover, removing the ring cap, and pulling out the inoculation stick, while another person uses an inoculator to inoculate the spawn, and then replaces the ring cap and cover. Different varieties are labeled, and the spawn is then placed in the culture room for cultivation.
[0307] ④ Mycelial Culture
[0308] After inoculation, the cultivation bags are placed on a culture rack and incubated in the dark at room temperature, maintaining an air humidity of 60-65%. They are observed once a week, and contaminated cultivation bags are discarded. The relevant growth status is recorded.
[0309] Planting and Growing Management
[0310] After the mycelium has matured, transport the bags to the cultivation base (which can be a greenhouse or under commercial forest). Allow them to continue ripening for 5-7 days under shaded conditions, then open the bags with small holes at a 45° angle and cover them with soil for planting (e.g., ...). Figure 7 For commercial forests, plant 3000-4000 bags per acre under the trees, and 6000-8000 bags per acre in greenhouses. Under the trees, adjust light intensity by tending or constructing small arched sheds; in the greenhouses, adjust light intensity using shade netting. During the bud and stipe differentiation stages, control the light intensity at 1000-1300 Lux; during the cap differentiation stage, control the light intensity at 2000-3000 Lux. In the greenhouses, maintain soil moisture at 20-30%, air humidity at 70-90%, and CO2 concentration below 0.05%. Allow the understory to grow naturally. Once the pale yellow growth ring at the edge of the cap disappears and a small number of spores are emitted, begin bagging and harvesting spores.
[0311] Harvesting
[0312] The standard for harvesting mature Ganoderma lucidum is as follows: the cap stops growing, the pale yellow or white ring around the edge of the cap disappears, the single fruiting body changes from pale yellow to yellowish-brown, the cap begins to leathery, and basidiospores begin to be ejected from the pores beneath the cap. The fruiting body can be harvested when the spores are released and the color deepens. When harvesting, use a sharp blade to cut the stipe, leaving 0.4-0.6 cm. If the primary purpose is to collect spores, bag the fruiting body for collection, maintaining soil moisture at 20-30% and air humidity at 70-80%. Collect spores for 40-50 days, until no more spores are ejected, then cut the fruiting body along the base of the stipe and collect the spores.
[0313] ⑥ Data statistics
[0314] Surveys and data collection were conducted at various demonstration sites in different years. The main observations focused on the key characteristics of the tested strains, and yield was recorded. Yields were also tallied after harvest. Simultaneously, a qualified testing company was commissioned to determine the content of major nutrients, heavy metals, and pesticide residues.
[0315] 7.4 Results and Analysis
[0316] The fruiting results of the demonstration cultivation are shown in the figure. Figure 5 See Tables 7 through 9.
[0317] Table 7. Yield and cultivation cycle of Ganoderma lucidum strain L4905 at the demonstration site
[0318]
[0319] Table 8. Main agronomic traits of Ganoderma lucidum strain L4905 as a demonstration strain.
[0320]
[0321] Table 9. Main agronomic traits of Ganoderma lucidum strain L4287
[0322]
[0323] Notes in Tables 7-9: “M±SD” represents the mean ± standard deviation. For each group, 30 bags were randomly selected, and the average weight of the fruiting body in a single bag was measured. For the fruiting body characteristics, 30 fruiting bodies were randomly selected and their average values were calculated.
[0324] Specificity: Demonstration results from four locations over two years (2023-2024) showed that compared to Ganoderma lucidum strain L4287, strain L4905 exhibited superior fruiting body characteristics, higher yield, greater cultivation stability, higher fruiting rate, and higher conversion rate. The fruiting bodies are yellowish-brown, with kidney-shaped caps, mostly single or double kidney-shaped, featuring distinct rings and radial longitudinal ridges. The average cap length is 13.08 cm and the average cap width is 7.32 cm. The flesh is grayish-white to grayish-brown, with an average thickness of 1.44 cm and a relatively soft texture. The stipe is reddish-brown, with an average length of 10.85 cm, darker than the cap, and an average diameter of 1.73 cm. The average fresh weight of a single mushroom is 81.28 g, the average dry weight is 31.51 g, the biological conversion rate is 14.78%, the average spore yield is 24.9 g, and the average cultivation period is 59 days. Compared with the control strain L4287, strain L4905 exhibits better overall fruiting performance, a shorter cycle, larger and thicker fruiting bodies, longer stipes, and larger diameters. In contrast, strain L4287, when grown in bags, produces more fruiting bodies with shorter stipes and thinner caps (average cap length 11.03 cm, cap width 6.59 cm). The flesh ranges from brown to dark brown, with an average thickness of 1.08 cm. The average fresh weight of a single fruiting body is 73.60 g, the average dry weight is 29.66 g, the average spore yield is 21.19 g, the biological efficiency is 13.38%, and the average cultivation cycle is 65 days. Therefore, strain L4905 can be promoted and applied as a new Ganoderma lucidum variety, enabling short-cycle, high-quality understory and facility-based cultivation of Ganoderma lucidum.
[0325] Uniformity: Through two years of cultivation demonstration observation, Ganoderma lucidum strain L4905 showed uniformity.
[0326] Stability: The Ganoderma lucidum strain L4905 exhibits consistency and is, in principle, stable.
[0327] 8. Variety resistance identification
[0328] 8.1 Identification Methods
[0329] Determination of mycelial growth rate at high and low temperatures: The *Ganoderma lucidum* strain L4905 and the control strain L4287, grown on PDA medium, were perforated using a 0.5 cm punch and placed on fresh PDA medium for a temperature gradient growth experiment. Eleven culture temperatures were set: 5 ℃, 10 ℃, 15 ℃, 20 ℃, 22 ℃, 24 ℃, 26 ℃, 28 ℃, 30 ℃, 32 ℃, and 35 ℃, with three replicates for each temperature. The growth rate was measured after 5 days of culture.
[0330] Growth rate =
[0331] Where R: colony diameter (mm); T: incubation time (d);
[0332] PDA medium formula: 200 g potato (peeled), 16 g agar, 20 g glucose, 2 g yeast extract, 2 g peptone, 0.2 g potassium dihydrogen phosphate, 0.2 g magnesium sulfate.
[0333] Method for detecting Aspergillus violaceus resistance: First, 0.5 cm diameter holes were punched in Ganoderma lucidum strains L4905 and L4287, and Aspergillus violaceus grown on PDA medium. Then, the holes were placed on new PDA plates, with one side containing the Ganoderma lucidum strain and the other side containing Aspergillus violaceus. Each resistance experiment was performed in triplicate, and the inhibition rate was calculated.
[0334]
[0335] Among them, R CK R1: Radius of normally growing contaminating bacteria (cm); R2: Radius of contaminating bacteria in the two-point confrontation experiment (cm)
[0336] 8.2 Low Temperature Resistance Test Results
[0337] Table 10. Mycelial growth rate of Ganoderma lucidum strains L4905 and L4287 (unit: mm / d)
[0338]
[0339] Results of the low-temperature tolerance test: As shown in Table 10, after culturing for 5 days at temperatures of 5 ℃, 10 ℃, 15 ℃, 20 ℃, 22 ℃, and 24 ℃, the mycelial growth rate of Ganoderma lucidum strain L4905 was generally slightly stronger than that of the control strain, Ganoderma lucidum strain L4287. After culturing for 5 days at low temperatures of 5 ℃ and 10 ℃, the mycelial germination and growth of both strains were relatively slow. After culturing for 5 days at 15 ℃, the mycelial growth rate of Ganoderma lucidum strain L4905 was slightly higher than that of Ganoderma lucidum strain L4287. The results of culturing at 20 ℃, 22 ℃, and 24 ℃ indicate that the growth patterns of Ganoderma lucidum strains L4905 and L4287 are consistent under low-temperature conditions, with little difference in growth rate. Compared with Ganoderma lucidum strain L4287, Ganoderma lucidum strain L4905 germinates more easily under low-temperature conditions and has stronger low-temperature tolerance.
[0340] 8.3 High Temperature Resistance Test Results
[0341] Table 11. Mycelial growth rate of Ganoderma lucidum strains L4905 and L4287 (unit: mm / d)
[0342]
[0343] Results of high-temperature resistance test: As shown in Table 11, after culturing for 5 days at temperatures of 26 ℃, 28 ℃, 30 ℃, 32 ℃, 35 ℃, and 40 ℃, the mycelial growth rate of Ganoderma lucidum strain L4905 was generally faster than that of Ganoderma lucidum strain L4287. As the temperature increased, the mycelial growth slowed down significantly and even stopped. At temperatures of 26 ℃ to 28 ℃, there was no significant difference in mycelial growth between Ganoderma lucidum strains L4905 and L4287, but the mycelia of Ganoderma lucidum strain L4905 were denser and whiter than those of Ganoderma lucidum strain L4287. As the temperature increased, the growth rate of both strains slowed down. At 30 ℃, the mycelial growth rate of Ganoderma lucidum strain L4905 was still faster than that of Ganoderma lucidum strain L4287. When the temperature reaches 32 ℃ and 35 ℃, the mycelial growth rate of Ganoderma lucidum strains L4905 and L4287 slows down, but the growth rate of Ganoderma lucidum strain L4905 is still better than that of Ganoderma lucidum strain L4287; neither of them germinates at 40 ℃.
[0344] Based on the results of the low-temperature resistance test, it can be found that the optimal temperature for mycelial culture of Ganoderma lucidum strain L4905 is 28 ℃~30 ℃, and the optimal temperature for mycelial culture of Ganoderma lucidum strain L4287 is 28 ℃~30 ℃. Ganoderma lucidum strain L4905 is more resistant to high temperatures than Ganoderma lucidum strain L4287.
[0345] 8.4 Results of the resistance test to Aspergillus variegata
[0346] Table 12. Inhibition rates of Ganoderma lucidum strains L4905 and L4287 against Aspergillus versicolor.
[0347]
[0348] Results: From Table 12 and Figure 6 As can be seen from the results, in the antibacterial test of Ganoderma lucidum against Aspergillus versicolor, the inhibition rate of Ganoderma lucidum strain L4905 was higher than that of strain L4287, indicating that strain L4905 has stronger resistance to contamination. Furthermore, strain L4905 exhibits a low contamination rate in seed production, consumes materials quickly, and is less susceptible to contamination by other fungi, demonstrating strong resistance to contamination. In multiple batches of cultivation trials, it showed low rates of contamination and pest / disease occurrence. Therefore, the records indicate that strain L4905 has strong disease resistance.
[0349] 8.5 Conclusion
[0350] The *Ganoderma lucidum* strain L4905 exhibits strong mycelial growth, rapid germination, and a fast growth rate. It shows a higher inhibition rate against *Aspergillus variegata* than strain L4287, demonstrating strong resistance to adverse conditions. The mycelium can grow normally between 10 and 32 °C. When cultured at 22–32 °C for 4 days, the mycelial growth rate of strain L4905 is faster and the mycelium is denser than that of strain L4287. The optimal fruiting temperature is 10–30 °C, compared to 15–28 °C for the control; the optimal fruiting temperature is 22–28 °C, compared to 20–26 °C for the control.
[0351] 9. Differential identification
[0352] 9.1 Characteristics of Solid Culture
[0353] After the mother culture PDA medium was prepared and mixed, it was sterilized at 121℃ and 0.103MPa for 30 min, and then poured into 90 mm petri dishes to prepare plates. The Ganoderma lucidum strain L4905 was activated and transferred to the mother culture PDA medium. After the mycelium had fully grown in the petri dishes, it was ready for use.
[0354] 9.1.1 Single-factor screening experiment for carbon sources
[0355] The basal culture medium consists of the following ingredients by weight: 200 parts potato, 20 parts glucose, 2 parts peptone, 0.2 parts magnesium sulfate, and 1000 parts water.
[0356] Based on the basal medium, maltose, lactose, sucrose, and soluble starch were added to replace glucose as test media, without glucose as a blank control. A 7 mm diameter punch was used to create holes, and mycelial blocks were inoculated into the center of the solid medium. The media were then incubated at 22 ℃ in the dark, with five replicates per experiment. Colony diameter was measured every 24 hours using the streak method. Mycelial morphology and growth were observed and recorded. Data were compared using the Duncan method in SPSS 20.0 software to determine statistical significance (P < 0.05). A bar chart of mycelial growth rate (V) was created using Excel 2019. The formula for mycelial growth rate (V) is:
[0357] (1)
[0358] In the formula:
[0359] L: Colony diameter (cm);
[0360] D: Number of days of cultivation (d);
[0361] 7: The diameter of the inoculated bacterial block is 7 mm.
[0362] 9.1.2 Single-factor screening experiment for nitrogen sources
[0363] Based on the basal culture medium, without adding peptone as a blank control, ammonium chloride, ammonium sulfate, yeast extract, and urea were used as test culture media to replace peptone. The inoculation, culture, replication, and data processing methods were the same as in 9.1.1.
[0364] 9.1.3 Inorganic Salt Single-Factor Screening Experiment
[0365] Based on the basal culture medium, without magnesium sulfate as a blank control, ferric chloride, calcium carbonate, zinc sulfate heptahydrate, and sodium chloride were used as the test culture media instead of magnesium sulfate. The methods for inoculation, culture, setting up replicates, and data processing were the same as in 9.1.1.
[0366] 9.1.4 Temperature Single-Factor Screening Test
[0367] The bacterial blocks were inoculated into the basal culture medium and incubated in constant temperature incubators at 20 ℃, 22 ℃, 24 ℃, 26 ℃, and 28 ℃ in the dark. The methods for inoculation, incubation, setting up replicates, and data processing were the same as in 1.1.
[0368] 9.1.5 pH Single-Factor Screening Test
[0369] Using HCl (1 mol·L⁻¹) -1 ) and NaOH (1 mol·L -1The pH of the basal culture medium was adjusted to 5.0, 5.5, 6.0, 6.5 and 7.0 respectively to be used as test culture media. The methods for inoculation, culture, setting up replicates and data processing are the same as in 9.1.1.
[0370] 9.2 Results Analysis
[0371] 9.2.1 Effects of carbon source on mycelial growth rate and morphology
[0372] The effects of different carbon sources on mycelial growth rate and morphology are shown in the figure. Figure 8 .
[0373] Depend on Figure 8 It can be seen that the mycelia are whitest and densest when glucose is used as a carbon source, and the growth rate is the fastest at (15.00±0.17) mm·d. -1 There was no significant difference compared to sucrose. When lactose was used as a carbon source, the mycelial growth rate was the slowest, at (7.25±0.37) mm·d. -1 There was no significant difference compared to soluble starch, and the mycelial growth was whiter and denser than under other carbon source conditions.
[0374] 9.2.2 Effect of nitrogen source on mycelial growth rate
[0375] The effects of different carbon sources on mycelial growth rate and morphology are shown in the figure. Figure 9 .
[0376] Depend on Figure 9 It can be seen that when yeast powder is used as a nitrogen source, the mycelia are the whitest and densest, and the growth rate is the fastest, at (7.77±0.49) mm / d, which is not significantly different from that of ammonium chloride, peptone, and ammonium sulfate. When urea is used as a nitrogen source, the mycelial growth rate is the slowest, at (1.60±0.40) mm / d, which is significantly different from that of other nitrogen source conditions.
[0377] 9.2.3 Effects of Inorganic Salts on Mycelial Growth Rate
[0378] Depend on Figure 10 It can be seen that ferric chloride has the fastest growth rate as an inorganic salt, at (14.83±0.22) mm / d, which is not significantly different from sodium chloride, but is significantly different from other inorganic salts. Ferrous sulfate has the slowest mycelial growth rate as an inorganic salt, at (8.67±0.67) mm / d.
[0379] 9.2.4 Effect of temperature on mycelial growth rate
[0380] Depend on Figure 11 It can be seen that as the temperature gradually increases, the mycelial growth rate first increases and then decreases; the mycelial growth rate is fastest at 30 ℃, which is (7.28±0.21) mm·d. -1The growth rate at 28℃ showed no significant difference compared to that at 5℃, 10℃, and 40℃. Mycelia did not germinate at 5℃, 10℃, and 40℃; the growth rate was relatively slow at 15℃~26℃ and 35℃, with significant differences observed at 30℃ and 32℃. 9.2.5 Effect of pH on mycelial growth rate
[0381] The effects of different pH conditions on mycelial growth rate are shown in the figure. Figure 12 .
[0382] Depend on Figure 12 It can be seen that the mycelial growth rate is fastest at a pH of 5.5, which is (14.8±0.15) mm·d. -1 The mycelium was significantly different from other pH conditions. At pH 5.0, the mycelium was the whitest and densest, but the growth rate was the slowest, at (12.17±0.16) mm·d. -1 It differs significantly from other pH conditions.
[0383] Subsequent research revealed that the best mycelial growth was achieved when glucose was used as the carbon source, yeast powder as the nitrogen source, ferric chloride as the inorganic salt, and the temperature was 28℃ with a pH of 6.0-7.0.
[0384] 10. Quality Analysis
[0385] Ganoderma lucidum strain L4905 and control CK (L4287) – Jindi Ganoderma lucidum, are Ganoderma lucidum varieties approved by Sichuan Province in 2008. Statistical analysis of nutrients and functional components; quality analysis report is shown in Table 13.
[0386] Table 13 Statistical Table of Components of Ganoderma lucidum strain L4905 and Ganoderma lucidum var. jindi (L4287)
[0387]
[0388] Note: *Essential amino acids
[0389] The Ganoderma lucidum strain L4905 and Ganoderma lucidum var. jindi, which were planted and grown to maturity in 2023, were sampled and dried at low temperature. The dried samples were then sent to the Guangdong Provincial Center for Microbiology Analysis and Testing for testing. The total content of 16 amino acids in Ganoderma lucidum strain L4905 was 8.84 g / 100g, while that in Ganoderma lucidum from Jindi was 10.50 g / 100g. The protein content of Ganoderma lucidum strain L4905 was 12.3 g / 100g, while that in Ganoderma lucidum from Jindi was 13.70 g / 100g. The fat content of Ganoderma lucidum strain L4905 was 1.4 g / 100g, while that in Ganoderma lucidum from Jindi was 2.40 g / 100g. The polysaccharide content of Ganoderma lucidum strain L4905 was 1.37%, while that in Ganoderma lucidum from Jindi was 1.07%. The triterpenoids and sterols content of Ganoderma lucidum strain L4905 was 4.28%, while that in Ganoderma lucidum from Jindi was 4.64%. Ganoderma lucidum strain L4905 had a higher polysaccharide content than Ganoderma lucidum from Jindi, but lower triterpenoids and sterols.
[0390] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A strain of Ganoderma lucidum L4905, characterized in that, The Ganoderma lucidum strain L4905, classified as Ganodermasp., was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC No: 63866.
2. The cultivation method of Ganoderma lucidum strain L4905 according to claim 1, characterized in that, Includes the following steps: Step (1), propagation of mother culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and place it in a 24℃ incubator for constant temperature culture for 7-10 days; The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, and 990-1010 parts water; Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 26 ℃ culture room for constant temperature culture for 25-30 days to obtain the original seed; The original culture medium in the original culture bottle comprises the following raw materials by weight: 72-74 parts hardwood sawdust, 23-25 parts wheat bran, 0.9-1.1 parts white sugar, 0.9-1.1 parts gypsum powder, and 0.8-1.2 parts lime powder; pH value 6-8, moisture content 55-65%; Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into a cultivation bag and placed in a 26 ℃ incubation room for 25-30 days to obtain the spawn; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 77-79 parts hardwood sawdust, 16-18 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.8-1.2 parts lime powder; pH value 6-8, moisture content 55-65%; Step (4), soil covering cultivation: After the mycelium in the cultivation bag is fully grown, transport it to the cultivation base and continue to ripen for 5-7 days under shade. Then, open the bag with small holes at a 45° angle and cover it with soil for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be shot out, cover the bag to harvest spores or harvest fruiting bodies.
3. The cultivation method of Ganoderma lucidum strain L4905 according to claim 2, characterized in that, In step (4), the cultivation base is a greenhouse or commercial forest; 3,000-4,000 bags are planted per mu in commercial forest, and 6,000-8,000 bags are planted per mu in greenhouse.
4. The cultivation method of Ganoderma lucidum strain L4905 according to claim 3, characterized in that, In step (4), the light intensity in the greenhouse is adjusted by using a shade net; the light intensity in the commercial forest is adjusted by tending and harvesting or by building small arched sheds. In step (4), after covering with soil, the plants can be harvested 58-60 days later.
5. The cultivation method of Ganoderma lucidum strain L4905 according to claim 1, characterized in that, Includes the following steps: Step A, Propagation of Mother Culture: Under aseptic conditions, take Ganoderma lucidum strain L4905 and inoculate it onto the mother culture PDA medium, and incubate at 24 ℃ for 7-10 days to obtain mycelial blocks; The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, and 990-1010 parts water; Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5 ℃ for 7-10 days to obtain the seed liquid; The shake flask culture medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 1.9-2.1 parts yeast powder, 0.19-0.21 parts ferric chloride, 990-1010 parts water, with a pH of 6.0-7.
0. Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 23.5-24.5℃ for 8-11 days to obtain liquid inoculum; The fermentation broth culture medium comprises the following raw materials by weight: 600 parts soluble starch, 2350-2450 parts glucose, 90-110 parts peptone, 90-110 parts yeast extract, 115-125 parts potassium dihydrogen phosphate, 59-61 parts ferric chloride, and 99000-101000 parts water, with a pH of 6.0-7.
0. Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a 26℃ incubation room for 25-30 days; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 77-79 parts hardwood sawdust, 17-19 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.5-0.8 parts lime powder; pH value 6-8, moisture content 55-65%; Step E, Soil Covering Cultivation: After the mycelium has fully grown in the cultivation bag, transport it to the cultivation base and continue to ripen under shade for 5-7 days. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. During the bud stage and stipe differentiation stage, control the light intensity at 1000-1300 Lux, and during the cap differentiation stage, control the light intensity at 2000-3000 Lux. When the pale yellow growth ring on the edge of the cap disappears and spores begin to be emitted, cover the bag and harvest the spores or harvest the fruiting bodies.
6. The cultivation method of Ganoderma lucidum strain L4905 according to claim 5, characterized in that, In step E, the cultivation base is either a greenhouse or under commercial forest; 3,000-4,000 bags are planted per acre under commercial forest, and 6,000-8,000 bags are planted per acre in greenhouses.
7. The cultivation method of Ganoderma lucidum strain L4905 according to claim 6, characterized in that, In step E, the light intensity in the greenhouse is adjusted by using shade nets; the light intensity under the commercial forest is adjusted by tending and harvesting or by building small arched sheds; in step E, after covering with soil, the trees can be harvested 58-60 days later.
8. The cultivation method of Ganoderma lucidum strain L4905 according to claim 7, characterized in that, In step E, the greenhouse maintains soil moisture of 20-30%, air humidity of 70-90%, and CO2 concentration of less than 0.05%; the canopy closure of the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.
9. The mycelium, fermentation broth, fruiting body or spore powder of the Ganoderma lucidum strain L4905 as described in claim 1 may be used in the preparation of antitumor drugs or sedative and sleep-inducing drugs.
10. The use of the mycelium, fermentation broth, fruiting body or spore powder of the Ganoderma lucidum strain L4905 as described in claim 1 in the preparation of whitening and anti-inflammatory products.
Citation Information
Patent Citations
Lucid ganoderma strain L4968 and cultivation method thereof
CN114958615A
Zhongzhong ganoderma lucidum strain L4741 and application thereof
CN116162551A