Phyllostachys edulis pe masr1 gene, biological material and application thereof

By cloning and expressing the PeMASR1 gene of moso bamboo, the problem of resistance breeding of moso bamboo under abiotic stress was solved. Through genetic engineering, overexpression of the PeMASR1 gene in Arabidopsis thaliana significantly improved its cold resistance, salt resistance and drought resistance, revealing the important role of this gene in plant stress resistance.

CN119752927BActive Publication Date: 2026-03-24NANJING FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411669041.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-21
Publication Date
2026-03-24
Estimated Expiration
2044-11-21

AI Technical Summary

Technical Problem

In the current technology, the key genes of moso bamboo to abiotic stress have not been reported, which makes it difficult to carry out effective breeding for resistance to abiotic stress, especially under natural disasters such as heat damage, salinity damage and drought.

Method used

The PeMASR1 gene of moso bamboo was cloned and expressed. The gene was overexpressed in Arabidopsis thaliana through genetic engineering to improve its cold resistance, salt resistance and drought resistance. The gene was introduced into plant cells using plasmids, plant virus vectors and other methods to construct transgenic plants.

Benefits of technology

It significantly improved the cold, salt and drought tolerance of Arabidopsis plants and enhanced their resistance to abiotic stresses, revealing the biological function of the PeMASR1 gene in plant stress resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752927B_ABST
    Figure CN119752927B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of plant genetic engineering, and particularly relates to a Phyllostachys edulis PeMASR1 gene, biological material and application thereof. The PeMASR1 gene provided by the present application is a new gene discovered in the study of cold tolerance of Phyllostachys edulis leaves, the nucleotide sequence of which is shown as SEQ ID NO:1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO:2. Through gene cloning, expression and comparative analysis, the phylogenetic position of the Phyllostachys edulis PeMASR1 gene and the important role thereof in the research of plant response to abiotic stress mechanism and photosynthesis are revealed. Overexpression in Columbia-type Arabidopsis plants can make the rosette leaves of the plants early senesce; and the plants show a more stress-tolerant phenotype than wild-type Arabidopsis in response to cold stress, drought stress and salt stress and other abiotic stresses.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to a PeMASR1 gene of moso bamboo, biomaterials and their applications. Background Technology

[0002] bamboo( Phyllostachys edulis Bamboo (Phyllostachys pubescens) is a large herbaceous plant belonging to the subfamily Bambusoideae of the Poaceae family (Li et al. (2018), Plant Biotechnology Journal l16(1):72–85; Wang et al. (2017), Plant Journal 91(4):684–699). It has important ecological, cultural and economic significance and is the most important economic bamboo species in my country, supporting about 70% of the output value of my country's bamboo industry (Peng et al. (2013), PlosOne 8(11):e78944). At present, the drastic changes in the global environment have led to frequent natural disasters such as heat damage, salinity damage and drought. For example, in 2013, the continuous high temperature and low rainfall in southern China caused a large number of bamboo shoots to die, resulting in a sharp decline in its yield (Zhang et al. (2022), Plant Physiology and Biochemistry 186:121–134.). Similarly, soil salinization severely affects the growth and geographical distribution of moso bamboo (Gao et al. (2019), Journal of Plant Growth Regulation 38(3):1127–1140; Hou et al. (2020), Tree Physiology 40(12):1792–1806). Researchers have found that even short-term treatment with 150 mmol / L NaCl cannot save one-year-old moso bamboo seedlings (Xu et al. (2021), PlantCell Reports 40(10):1971–1987). Therefore, exploring the molecular mechanisms of moso bamboo stress resistance and identifying key resistance genes are crucial for the molecular breeding creation of new stress-resistant moso bamboo germplasm.

[0003] Meanwhile, as a representative bamboo species of temperate bamboo, moso bamboo can adapt to winter temperatures as low as -10°C in southeastern my country. ◦ Low temperatures of C indicate high cold resistance. Wang et al. (2022) (Tree Physiology 42(11):2336–2352) used cold-sensitive bamboo species—Dendrobium nobile (Bambusa ventricosa)—as an example. Bambusa ventricosa) For control, from the perspective of anatomy, physiology, metabolomics and transcriptomics, the adaptive mechanism of Phyllostachys edulis leaves to winter low temperature was explored. It was found that compared with the leaves of Oligostachyum lubricum, the cold-resistant related anatomical structure of Phyllostachys edulis leaves was less than that of Oligostachyum lubricum, the bubble cell was smaller, the water content and the stomatal density were lower, but the epidermal hair was more. Non-targeted metabolomics analysis of the leaves of the two kinds of bamboo showed that under the conditions of winter warm day and cold day, the anti-stress metabolites such as glutathione, trehalose and ascorbic acid in the leaves of Phyllostachys edulis were 10-1000 times higher than those in the leaves of Oligostachyum lubricum; compared with the winter warm day condition, the metabolites such as glutathione and trehalose in the leaves of Phyllostachys edulis under the winter cold day condition were further increased, while those in the leaves of Oligostachyum lubricum were obviously decreased; the transcriptome comparative analysis of the leaves of Phyllostachys edulis under the conditions of winter warm day and cold day showed that the metabolism related genes such as trehalose, glutathione, flavonoid, DNA repair and active oxygen degradation and the hormone related genes such as jasmonic acid, abscisic acid and ethylene constituted the molecular network of the cold stress response of the leaves of Phyllostachys edulis; among various transcription factors, the HSF, MYB, NAC and WRYK transcription factors in the leaves of Phyllostachys edulis were significantly up-regulated under low temperature; in addition, a large number of newly expressed Phyllostachys edulis genes were also identified to participate in the regulation network. It can be seen that the leaves of Phyllostachys edulis have evolved special anatomical structure, metabolic pathway and cold stress response molecular regulation network to adapt to the cold winter environment. However, the key genes of the cold resistance of the leaves of Phyllostachys edulis have not been reported so far.

[0004] PeMASR1 ( M multiple A biotic S tress R esistant 1) gene is a new gene found in the study of the cold resistance mechanism of the leaves of Phyllostachys edulis, which is significantly up-regulated and expressed in the leaves of Phyllostachys edulis under the condition of winter cold day, and the expression amount is nearly 30 times that under the condition of winter warm day (Wang et al. (2022), Tree Physiology 42(11):2336-2352), but the function of the gene and its orthologous genes in other plants has not been reported so far. SUMMARY

[0005] In view of the deficiencies of the prior art, the present application provides a kind of Phyllostachys edulis PeMASR1 Gene, biological material and its application can be used to study plant leaf senescence, leaf growth and plant stress resistance molecular mechanism and further application in plant improvement breeding, play an important role in improving plant stress resistance and other plant genetic engineering.

[0006] The technical scheme provided by the present application is as follows:

[0007] The present application provides a kind of Phyllostachys edulis PeMASR1A gene that encodes either (a) or (b) a protein:

[0008] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2;

[0009] (b) Proteins derived from (a) with the sequence shown in SEQ ID NO:2 substituted, deleted or added with one or more amino acids and having the same function.

[0010] Furthermore, moso bamboo PeMASR1 The nucleotide sequence of the gene is shown in SEQ ID NO:1. The gene was cloned using the following method. PeMASR1 Gene:

[0011] (1) Extracting total RNA from bamboo leaves. In this invention, the total RNA of bamboo can be extracted using methods commonly used in the field for extracting total RNA from cells, such as the Novizan FastPure Universal Plant Total RNA Isolation Kit.

[0012] (2) The extracted total RNA from moso bamboo is reverse transcribed to synthesize cDNA. In this invention, conventional cDNA synthesis methods in the art can be used, such as the Tiangen (Beijing) One-Step cDNA Synthesis Kit.

[0013] (3) After obtaining cDNA, proceed with... PeMASR1 PCR amplification of the gene yields the target fragment. In this invention, the amplification... PeMASR1 The nucleotide sequences of the gene primers are as follows:

[0014] PeMASR1 -F: 5'-ATGGGGGATGTGTCGTTG-3'

[0015] PeMASR1 -R:5'-TTATGTTGCTTGATCATTGCT-3'.

[0016] (4) After obtaining the target fragment by PCR amplification, the target fragment is sequenced to obtain... PeMASR1 Gene.

[0017] (5) The target fragment was ligated into the pCAMBIA1302 vector, introduced into Escherichia coli DH5α competent cells, and sequenced after being verified as a positive clone by colony PCR.

[0018] This law also provides bamboo-containing products. PeMASR1 Biological materials for genes, wherein the biological materials are any one or more of recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or non-renewable plant cells or tissues.

[0019] The present application also provides a bamboo PeMASR1 application of the gene or the biological material containing the gene in promoting early senescence of a plant, regulating leaf growth of a plant and / or plant stress resistance regulation (increasing plant stress resistance); wherein the stress resistance refers to drought tolerance, salt tolerance and cold tolerance; and the plant is Arabidopsis thaliana.

[0020] The present application also provides a bamboo PeMASR1 application of the gene or the biological material containing the gene in preparing a transgenic plant. The breeding purpose is to increase the stress resistance of the plant.

[0021] The present application also provides a method for increasing the cold tolerance, salt tolerance and / or drought tolerance of a plant, comprising: overexpressing the gene according to claim 1 in the plant by using genetic engineering means; and the overexpression mode is selected from any one or a combination of modes (1)-(5) as follows:

[0022] (1) by introducing a plasmid containing the gene;

[0023] (2) by increasing the copy number of the gene on the chromosome of the plant;

[0024] (3) by changing the promoter sequence of the gene on the chromosome of the plant;

[0025] (4) by operably linking a strong promoter to the gene;

[0026] (5) by introducing an enhancer;

[0027] The plant is Arabidopsis thaliana. In the present application, the expression vector carrying the target gene can be introduced into the plant cell by using the conventional biological technology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

[0028] Further, the bamboo PeMASR1 gene is introduced into Arabidopsis thaliana plants to obtain transgenic plants overexpressing the bamboo PeMASR1 gene.

[0029] Further, the bamboo PeMASR1 gene is constructed into a plant expression vector pCAMBIA1302, transformed into Agrobacterium, then the Arabidopsis thaliana inflorescences are immersed and transgenic plants are screened.

[0030] The present application also provides application of the transgenic plant obtained by the above-mentioned method in plant breeding.

[0031] Further, the breeding method comprises transgenesis, hybridization, backcrossing, selfing or vegetative reproduction.

[0032] Beneficial effects

[0033] The present application discloses for the first time a Phyllostachys edulis PeMASR1 gene and its biological function. Through gene cloning expression and comparative analysis, the Phyllostachys edulis PeMASR1 gene encodes the evolutionary status of the gene system, and provides a method for applying the gene. Overexpression of the gene can make the Columbia-type Arabidopsis thaliana plants more cold-resistant, salt-resistant and drought-resistant. The PeMASR1 gene will play an important role in plant response to abiotic stress. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 Figure 1 is a gel electrophoresis map of the amplification product of the gene. PeMASR1 Figure 2 is a sequence alignment diagram of the gene and the amino acid sequence of the rice Os10g25060 gene.

[0035] Figure 2 Figure 3 is a phenotype photo of the transgenic plants and the Col-0 plants before cold treatment, drought treatment and salt treatment, wherein Col-0 represents the Columbia wild-type Arabidopsis thaliana plant, and OE10 and OE11 represent different strains of the transgenic plants, respectively. PeMASR1 Figure 4 is a phenotype diagram of the transgenic Arabidopsis thaliana and the wild-type Arabidopsis thaliana plants under cold stress, wherein Col-0 represents the Columbia wild-type Arabidopsis thaliana plant, and OE10 and OE11 represent different strains of the transgenic plants, respectively.

[0036] Figure 3 Figure 5 is a phenotype diagram of the transgenic Arabidopsis thaliana and the wild-type Arabidopsis thaliana plants under drought stress, wherein Col-0 represents the Columbia wild-type Arabidopsis thaliana plant, and OE10 and OE11 represent different strains of the transgenic plants, respectively. PeMASR1 Figure 6 is a phenotype diagram of the transgenic Arabidopsis thaliana and the wild-type Arabidopsis thaliana plants under salt stress, wherein Col-0 represents the Columbia wild-type Arabidopsis thaliana plant, and OE10 and OE11 represent different strains of the transgenic plants, respectively. PeMASR1 DETAILED DESCRIPTION

[0037] Figure 4

[0038] Figure 5 PeMASR1

[0039] Figure 6 PeMASR1

[0040] Figure 7 PeMASR1 DETAILED DESCRIPTION

[0041] ​​​​​​​The application will be further described below in connection with specific examples. The experimental methods of molecular biology not specifically described in the following examples were all performed according to the specific methods listed in the book of Molecular Cloning Experiment Guide (3rd edition) by J. Sambrook, or according to the instructions of the reagent kit and product.

[0042] Example 1: Phyllostachys edulis PeMASR1 Obtaining of gene sequence

[0043] 1. RNA extraction

[0044] The extraction material was the leaf of Phyllostachys edulis, and the RNA extraction was performed using the Nuoyuan FastPure universal plant total RNA separation kit according to the operation instruction, and was stored at -80℃ for standby.

[0045] 2. Synthesis of cDNA first strand and reverse transcription PCR

[0046] The total RNA was reversely transcribed into cDNA using the One-Step cDNA synthesis kit of Tiangeng (Beijing) according to the operation guide. The reaction system and reaction conditions were as follows: 1 µg of prepared total RNA, Anchored Oligo(dT)18 Primer 1 µL, 10 µL of 2×TS Reaction Mix, 1 µL of TransScript RT / RI Enzyme Mix, 1 µL of gDNA Remover, and RNase-free Water was added to 20 µL, and was mixed gently and centrifuged. The PCR instrument was set at 42℃ for reverse transcription for 30 min, 85℃ for 5 s; cooled on ice; and stored at -20℃ after centrifugation for standby.

[0047] 3. PCR amplification PeMASR1 CDS region of the gene

[0048] According to the results of the transcriptome sequencing of bamboo leaves, the sequence of the gene was obtained. Two primers, -F (5'-ATGGGGGATGTGTCGTTG-3') and -R (5'-TTAT GTTGCTTGATCATTTGCT-3'), were designed in the upstream and downstream of the CDS region of the gene as the primers for PCR reaction. PeMASR1 PeMASR1

[0049] ​​The PCR enzyme used was Nanjing Novozyme high-fidelity enzyme P525 for PCR amplification, and the reaction system was 20 μL: ddH2O, 9.5 μL; 2xPhantaMax Master Mix (DyePlus) enzyme, 12.5 μL; forward primer, 1 μL; reverse primer, 1 μL; cDNA, 1 μL. The PCR program was: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 15 s, 72℃ for 36 s, for 35 cycles; 72℃ for 5 min. The obtained PCR product was separated by 1.2% agarose gel electrophoresis to obtain a 597 bp fragment (CDS length 597 bp), as shown in Figure 1 After purification and recovery, it was sent to GenScript Biotech Co., Ltd. (Nanjing) for sequencing.

[0050] Example 2: Phyllostachys edulis PeMASR1 Gene function analysis

[0051] 1. Sequence comparison analysis

[0052] The homology of the gene and its closest relative Os10g25060 amino acid sequence was analyzed by DNAMAN8. The analysis results are shown in PeMASR1 , the sequence similarity of the gene and Os10g25060 is 66.83%. Figure 2 PeMASR1

[0053] 2. Arabidopsis thaliana transgenic analysis

[0054] 2.1 Vector construction

[0055] Vector linearization: use endonuclease NcoI and BstEII to double enzyme cut the vector, the reaction system is: pCAMBIA1302 vector, 10 μL; NcoI, 1 μL; BstEII, 1 μL; rcut smart, 5 μL; ddH2O, 33 μL.

[0056] 2.2 Overexpression vector construction: use Novozyme C115 homologous recombinase for homologous recombination, the reaction system is: pCAMBIA1302 linearized vector, 1 μL; DNA, 1.5 μL; 2xClonExpreesMix, 2.5 μL. Use a pipette to mix gently, the reaction program is 50℃, 5 min.

[0057] ​​2.3 Transformation: Take 50 μL of competent cells DH5α on ice, add 5 μL of the above-mentioned ligated DNA, mix gently, and place on ice for 30 min; heat shock at 42°C for 45 s, immediately place on ice for 2 min; add 900 μL of room temperature LB medium without antibiotics, incubate at 200 rpm and 37°C for 1 h; centrifuge at 5000 rpm for 5 min to obtain bacterial cells, remove most of the supernatant, and resuspend the bacterial cells with the remaining medium. Use a sterile swab to lightly smear the kanamycin-containing LB plate, and seal it; incubate in a 37°C incubator for 12-16 h.

[0058] 2.4 Bacterial liquid PCR: Add 0.5 mL of LB culture medium to a 1.5 mL EP tube, and select 5 colonies of appropriate size on the plate. Label them 1-5 with a pen, and make sure they are not too close to each other. Prepare 5 sterile and enzyme-free centrifuge tubes in advance, and add 2x RapidTaq Master Mix, 10 μL; ddH2O, 7 μL; vector upstream primer, 1 μL; and vector downstream primer, 1 μL, to each tube. Dip a toothpick in the single colony, and transfer the colony to the centrifuge tube. The colony PCR program is as follows: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, 72°C for 9 s, for 35 cycles; and 72°C for 5 min. Subject the obtained colony PCR product to 1.2% agarose gel electrophoresis, and select the remaining colonies with the correct length band to a 500 μL test tube containing kanamycin-containing LB medium, and shake the bacteria on a shaker for 4 h. Then, send them to Genescript Biotech Co., Ltd. for sequencing. The sequencing results are consistent with the sequence of the plasmid extracted from the bacterial liquid to be transformed into Agrobacterium. PeMASR1

[0059] 3 Arabidopsis Transformation

[0060] 3.1 Seeding

[0061] Mix peat soil, vermiculite, and perlite in a ratio of 8:4:1, and add dinotefuran (about 3-4 spoons per basket of soil). Fill the soil into small flowerpots, and water the bottom (the first watering can add flower without defects with a concentration of 1 g / L). When the soil in the pot is wet, sow the seeds. Take the seeds of wild-type Columbia Col-0 and place them in a 4°C refrigerator for about three days. After taking them out, transplant them into the soil, cover them with plastic wrap, and place them in an artificial climate chamber with a temperature of 24°C and light intensity of 120 UM. After about 2 days, remove the plastic wrap, and cultivate them to the flowering stage for use.

[0062] 3.2 Agrobacterium Transformation

[0063] ​The agrobacterium kept at -80℃ was taken out and thawed by hand, and was inserted into ice when it was in the ice water mixed state; 5 μL of the constructed plasmid containing the target gene was added to each 50 μL of the competent cells, which were mixed by gently stirring the bottom of the centrifugal tube and then were sequentially placed on ice for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, and ice bath for 5 min; 700 μL of LB liquid medium without antibiotics was added, and the mixture was cultured at 28℃ for 2-3 h; centrifugation was performed at 6000 rpm for 1 min, most of the supernatant was removed, and the bacterial cells were resuspended by gently blowing 100 μL or so of the supernatant, and then the cells were spread on LB plates containing kanamycin and rifampicin, and were cultured for 2-3 d.

[0064] The agrobacterium single colony was picked and subjected to colony PCR, and the correct band was picked and subjected to small shaking and large shaking for one day each at 28℃ and 200 rpm, and the OD value was about 0.8-1; centrifugation was performed at 4500 rpm for 10 min, the supernatant was removed, and the bacterial cells were resuspended with a sucrose suspension (5% sucrose and 0.03% surfactant Silwet), and the OD value was adjusted to 0.8-1.0, and the cells were activated under light for 2-3 h. 600

[0065] 3.3 Floral dip method for transforming Arabidopsis

[0066] The Arabidopsis in the flowering stage was taken, the ripe fruits and the already bloomed flowers were cut off in advance, the inflorescences were immersed in the activated suspension for about 1 min, and were taken out after being cultured in a humid dark environment for 24 h, and were placed in a culture box for normal culture.

[0067] 3.4 Screening, observation and identification

[0068] 1) When the Arabidopsis siliques turned yellow or brown, the plants were slowly killed after being bagged and watering was stopped, and the transgenic T0 seeds were collected; the harvested T0 seeds were placed in a 4℃ refrigerator for low-temperature treatment for about 3 d; 1 / 2MS solid medium was prepared, was placed in an ultra-clean bench after high-pressure sterilization, and the medium temperature was slowly reduced to about 50℃, and then hygromycin was added, and the concentration of the hygromycin was 20 mg / L. Meanwhile, 1 / 2MS medium without hygromycin was prepared for standby; a proper amount of the vernalized transgenic T0 seeds were sterilized with 75% ethanol for 5 min, and then were blown with anhydrous ethanol using a cut-off syringe, and were sprinkled on sterilized filter paper, and after the anhydrous ethanol was volatilized, the seeds were evenly spread on the 1 / 2MS plates containing hygromycin, and the Col-0 seeds were spread on the 1 / 2MS medium without antibiotics as a control; the plates were placed in a culture box, and when the seedlings on the resistant 1 / 2MS medium were rooted and the first pair of true leaves were unfolded, the seedlings were transplanted into the prepared soil, and were watered, and the plastic wrap was removed after 2-3 d.

[0069] ​2) Take 1-2 pieces of rosette leaves of transgenic positive seedlings of different strains to extract RNA with Novizen FastPure kit, and the operation steps refer to the instructions. The centrifuge tubes, gun heads and other consumables used are Rnase-free.

[0070] a. Take 1-2 pieces of leaves and grind them in liquid nitrogen, add 600 μL Buffer EL, vortex vigorously for 30 s to mix the sample and the lysis solution evenly, centrifuge at 12000 rpm for 5 min, and immediately proceed to the next step.

[0071] b. Take about 500 μL of supernatant to FastPure gDNA-Filter Columns III, centrifuge at 12000 rpm for 30 s, discard the FastPure gDNA-Filter Columns III, and collect the filtrate.

[0072] c. Add 0.5 times the filtrate (about 250 μL) to the collection tube and mix well for 15 s.

[0073] d. Transfer the above mixture to FastPure RNA Columns V, centrifuge at 12000 rpm for 30 s, and discard the filtrate.

[0074] e. Add 700 μL Buffer RWA to FastPure RNA Columns V, centrifuge at 12000 rpm for 30 s, and discard the filtrate.

[0075] f. Add 500 μL Buffer RWB (check if 48 mL of absolute ethanol has been added before use) to FastPure RNA Columns V, centrifuge at 12000 rpm for 30 s, centrifuge at 12000 rpm for 30 s, and discard the filtrate.

[0076] g. Repeat step 6.

[0077] h. Place FastPure RNA Columns V back into the collection tube and centrifuge at 12000 rpm for 2 min.

[0078] i. Transfer FastPure RNA Columns V to a new RNase-free Collection Tubes 1.5 ml centrifuge tube, and add 40 μL of RNase-free ddH2O to the central suspended drop, centrifuge at 12000 rpm for 1 min (the first eluate can be added back to the adsorption column for elution to improve recovery efficiency).

[0079] j. 1.2% agarose gel electrophoresis to detect the integrity of the extracted RNA.

[0080] 3) Use qRT-PCR technology, and take Arabidopsis thalianaACTIN1 Genes were used as internal controls to identify transgenic plants. PeMASR1 Expression levels. The reverse transcription method followed the cDNA first-strand synthesis and reverse transcription PCR described in Example 1. The cDNA was diluted 10-fold before use. The qRT-PCR enzyme used was ChamQ from Nanjing Novizan. TM UniversalSYBR, system composition: 20 μL H2O, 7.2 μL; Mix, 10 μL; upstream / downstream primers, 0.4 μL; cDNA template, 2 μL. Program: Pre-denaturation 95℃ 30 s; 95℃ 10 s, 60℃ 30 s, 40 cycles; 95℃ 15 s, 60℃ 60 s, 95℃ 15 s. Specific primers are as follows:

[0081] PeMASR1 -F:5'-TACCAAGCAGGGCGATCAAA-3',

[0082] PeMASR1 -R: 5'-ACCGGAATTGCGTGGTCTAA-3';

[0083] AtActin-F :5'-CTCTCCCGCTTTGAATTGTCTCGTTG-3',

[0084] AtActin-R :5'-GGTACCATTGTCACACACGATTGGT-3'.

[0085] income PeMASR1 Transgenic Arabidopsis OE10 and OE11 lines PeMASR1 The relative expression levels were 175.7 and 238.2, respectively; their phenotypes exhibited characteristics such as premature leaf senescence and smaller leaves. Figure 3 ).

[0086] 3.5 Cold stress, drought stress and salt stress in transgenic plants

[0087] 3.5.1 Cold stress treatment

[0088] The treatment material was three-week-old Arabidopsis thaliana, which was grown in a low-temperature incubator at 4°C. After 4 days, the leaves of the Col-0 Arabidopsis thaliana Colombian wild-type plants were clearly observed to wilt and die. PeMASR1 The transgenic plants OE10 and OE11 showed good growth (see...) Figure 5 ).

[0089] 3.5.2 Drought Stress Treatment

[0090] The treatment material is three-week-old Arabidopsis, and four-week-old transgenic lines enter the aging stage after stopping watering for 10 days, and the leaves turn yellow. After 14 days of drought, the leaves of Col-0 Arabidopsis Columbia wild type plants wilt and turn yellow, and the overall state is worse than OE10 and OE11 (see Figure 6 ).

[0091] 3.5.3 Salt stress treatment

[0092] The treatment material is three-week-old Arabidopsis, and four-week-old transgenic lines enter the aging stage after stopping watering for 10 days, and the leaves turn yellow. After 14 days of drought, the leaves of Col-0 Arabidopsis Columbia wild type plants wilt and turn yellow, and the overall state is worse than OE10 and OE11 (see Figure 7 ).

[0093] Figure 4 The growth state of Arabidopsis before cold treatment, drought treatment and salt treatment.

[0094] SEQ ID NO: 1:

[0095] ATGGGGGATGTGTCGTTGAACCAGCCGATTAACGCCGAGCCGCTGCCCTGCAGTGTTACCAAGCAGGGCGATCAAATTCTAGACTTGATGTCGGCTGGATGGACAAATGAGAGGCACAGCTTGTACATAAGCTCCATGGAGGCATCCTTCATGGAGCAACTCTATGGCCATGAGCACCATGGGCCCGACGCGAATTGGAGCCATGTGGGTGGCAATGGGTTCAAGGTGCTCCAGGAGGGCGTGTCGGAGAACCTCAGAATTAAGAGGAATGATGCCCACGCCCGTGATGGAGGCGTAATCTGTCTGCCTGACAATCCGTGGATAAGGCGTTTTAGACCACGCAATTCCGGTATAAACCGCCATGGTGATGGGGTGAGGGCCTCGGTGGATGATGGTGAATCGGGTACTGATACGGTCCAAGAGAGGGTTCGGACGCATGGAAGAGAAGTGAAGAGTTGTGTTGGAGAAAATCTTGCTGAAGTCTGTGATCAGAACTTTCCTGATGAGGATGTTAAAGCCAATGCTGAAGCAAGTAAATCATGCAAGAAAAGGAGGCCTACTCTTTCCACGGCTGCAGCAAATGATCAAGCAACATAA.

[0096] SEQ ID NO: 2:

[0097] MGDVSLNQPINAEPLPCSVTKQGDQILDLMSAGWTNERHSLYISSMEASFMEQLYGHEHHGPDANWSHVGGNGFKVLQEGVSENLRIKRNDAHARDGGVICLPDNPWIRRFRPRNSGINRHGDGVRASVDDGESGTDTVQERVRTHGREVKSCVGENLAEVCDQNFPDEDVKANAEASKSCKKRRPTLSTAAANDQAT.

Claims

1. The application of biomaterials containing the PeMASR1 gene from moso bamboo in the regulation of plant stress resistance, characterized in that, The stress resistance refers to drought resistance, salt resistance, and cold resistance; the plant is Arabidopsis thaliana; the bamboo PeMASR1 gene is a gene encoding a protein composed of the amino acid sequence shown in SEQ ID NO:2; the nucleotide sequence of the bamboo PeMASR1 gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The biological material is any one or more of recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or non-renewable plant cells or tissues.

3. A method for improving the cold resistance, salt resistance, and / or drought resistance of plants, characterized in that, include: Using genetic engineering techniques, the PeMASR1 gene of moso bamboo was overexpressed in plants; the PeMASR1 gene of moso bamboo is a gene encoding a protein composed of the amino acid sequence shown in SEQ ID NO:2; the nucleotide sequence of the PeMASR1 gene of moso bamboo is shown in SEQ ID NO:

1. The overexpression mode is selected from any one or a combination of the following (1)-(5): (1) By introducing a plasmid containing the gene; (2) By increasing the copy number of the genes mentioned above on plant chromosomes; (3) By altering the promoter sequence of the genes described on plant chromosomes; (4) By operatively linking a strong promoter to the gene; (5) By introducing enhancers; The plant in question is Arabidopsis thaliana.

4. The method according to claim 3, characterized in that, The PeMASR1 gene of moso bamboo was transferred into Arabidopsis thaliana plants to obtain transgenic plants that overexpress the PeMASR1 gene of moso bamboo.

5. The method according to claim 4, characterized in that, The PeMASR1 gene of moso bamboo was constructed into the plant expression vector pCAMBIA1302, transformed into Agrobacterium, and then Arabidopsis inflorescences were inoculated to screen transgenic plants.