ArsL mutant and application thereof in synthesis of Arsinothricin

Abstract

The invention belongs to the technical field of bioengineering, and relates to an ArsL mutant and an application of the ArsL mutant in synthesis of Arsinothricin. The ArsL mutant is a mutant obtained by mutating the 428th cysteine C of the amino acid sequence of wild AST synthetase ArsL into alanine A, and the amino acid sequence of the ArsL mutant is as shown in SEQ ID No.2. The invention also discloses a preparation method of the ArsL mutant. The invention also further provides an application of the ArsL mutant in catalysis of sodium methyl arsenate and S-adenosylmethionine to synthesize Arsinothricin. The invention further provides an application of the ArsL mutant in catalysis of sodium methyl arsenate and S-adenosylmethionine to synthesize Arsinothricin. The ArsL mutant disclosed by the invention has higher catalytic activity and thermal stability, the process of converting high-concentration MMA into AST is realized by utilizing the ArsL mutant, and the catalytic activity of the ArsLC428A mutant is obviously improved compared with that of wild type AST synthetase. In addition, compared with an organic synthesis path, a semi-organic enzyme synthesis path and a natural biological synthesis path, the yield of the synthesis path provided by the invention is obviously improved, and the ArsL mutant can be used as a potential industrial application enzyme and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and relates to an ArsL mutant and its application in the synthesis of Arsinothricin. Specifically, the present application relates to an ArsL mutant and its encoding nucleic acid, a recombinant expression vector and a recombinant expression transformant containing the ArsL mutant nucleic acid, a catalyst containing the ArsL mutant, and its application in the synthesis of Arsinothricin. Background Art

[0002] Arsenic compounds have a long history of use as drugs. For example, arsenic trioxide is still the drug of choice for the treatment of acute promyelocytic leukemia. There are also some organic arsenic compounds used to treat cancer and microbial infections, including melarsoprol, atoxyl and roxarsone. In addition to humans, microorganisms in nature also use arsenic to synthesize antibiotics to protect themselves. Arsenic-containing antibiotics can be used as new antibiotics to address the increasingly serious problem of drug resistance in pathogenic bacteria.

[0003] Arsinothricin (AST) is a broad-spectrum arsenic-containing antibiotic recently discovered in the culture medium of Burkholderia gladioli, a soil bacterium in rice rhizosphere. It has a good inhibitory effect on both Gram-negative and Gram-positive bacteria, and also has an inhibitory effect on Plasmodium falciparum, the malaria-causing parasite. At present, the synthesis methods of AST mainly include organic total synthesis method and semi-organic enzyme synthesis method. These methods all involve multi-step chemical methods, with complex processes, numerous procedures, and relatively low reaction efficiency.

[0004] The natural biosynthetic pathway of AST uses the water-soluble form of arsenic trioxide, trihydroxyarsenic, as a substrate. First, the ACP free radical produced by ArsL cleavage of S-adenosylmethionine (SAM) is added to the arsenic atom to form the intermediate AST-OH. Then, AST-OH is synthesized into AST by the SAM-dependent methylase ArsM.

[0005] ArsL from Burkholderia gladioli has been expressed and purified, and its catalytic activity towards trihydroxyarsenic and its ability to cleave SAM to produce ACP free radicals have been demonstrated. However, in the process of reproducing the natural biosynthetic pathway of AST in vitro, ArsL showed a very low catalytic activity towards trihydroxyarsenic, and the synthesis required two steps of enzyme reactions, so its final synthesis efficiency was not ideal. Summary of the invention

[0006] The existing organic total synthesis method and semi-organic synthetase method used to synthesize AST both require chemical methods and are complex processes, and the catalytic activity of ArsL to trihydroxyarsenic is low, and the synthesis efficiency is not high. Based on this problem, the present invention provides an ArsL mutant and its application in the synthesis of Arsinothricin. Specifically, the present application relates to an ArsL mutant and its encoding nucleic acid, a recombinant expression vector and a recombinant expression transformant containing the ArsL mutant nucleic acid, a catalyst containing the ArsL mutant, and its application in the synthesis of Arsinothricin.

[0007] The invention uses protein engineering technology to carry out molecular transformation on ArsL, obtains an ArsL mutant with significantly improved activity, and realizes the application of the ArsL mutant in the synthesis of Arsinothricin.

[0008] The technical solution of the present invention provides a new pathway for synthesizing Arsinothricin (AST). The ArsL mutant can directly convert sodium methyl arsenate (MMA) into AST, and its catalytic ability is significantly improved compared with the original ArsL, which has a very broad application space for the production of AST.

[0009] The purpose of the present invention can be achieved by the following technical solutions:

[0010] One of the technical solutions adopted by the present invention is to provide an ArsL mutant, wherein the ArsL mutant is a mutant obtained by mutating the 428th cysteine ​​C in the amino acid sequence of the wild-type AST synthase ArsL to alanine A, and is named ArsL C428A .

[0011] Among them, the amino acid sequence of the wild-type AST synthase ArsL is shown in SEQ ID No. 1; it is an S-adenosylmethionine free radical enzyme derived from Burkholderia gladioli, NCBI Reference Sequence: WP_219608243.1.

[0012] The nucleotide sequence of the gene encoding the wild-type AST synthase ArsL is shown in SEQ ID No.3.

[0013] In one embodiment of the present invention, the amino acid sequence of the ArsL mutant is shown in SEQ ID No.2.

[0014] ArsL provided by the present invention C428A It can directly convert sodium methylarsenate (MMA) into AST, and its catalytic ability is significantly improved compared with the wild-type AST synthase ArsL.

[0015] Furthermore, the method for obtaining the mutant is specifically as follows:

[0016] The gene sequence of the wild-type AST synthase ArsL from Burkholderia gladioli was used as a template, a mutant library was constructed by site-directed saturation mutagenesis, and each round of constructed mutant library was subjected to high-throughput screening to obtain mutants. The high-throughput screening refers to: random mutation or single-point saturation mutation of the wild-type AST synthase ArsL, activity detection using the substrate sodium methylarsenate (MMA), and screening for mutants with significantly improved activity.

[0017] The whole plasmid PCR amplification for construction of the site-directed saturation mutation library is a conventional technique in the art, and the PCR amplification reaction system and PCR amplification procedure can be carried out using conventional techniques in the art.

[0018] The second technical solution adopted by the present invention is to provide an isolated nucleic acid, wherein the nucleic acid encodes the ArsL mutant described in the first technical solution.

[0019] Furthermore, the preparation method of the nucleic acid is a conventional preparation method in the art, and the preparation method includes: obtaining a nucleic acid molecule encoding the ArsL mutant by gene cloning technology, or obtaining a nucleic acid molecule encoding the ArsL mutant by an artificial full sequence synthesis method; preferably, using the ArsL mutant DNA sequence obtained in technical solution one as a template, PCR amplification is performed on the desired target gene to obtain the nucleic acid molecule with a point mutation.

[0020] The PCR amplification technology is a conventional technology in the art, and the system and procedure of PCR amplification reaction can be carried out by conventional techniques in the art.

[0021] In one embodiment of the present invention, the isolated nucleic acid (ArsL C428A The nucleotide sequence of the synthetic gene) is shown in SEQ ID No.4.

[0022] The third technical solution adopted by the present invention is to provide a recombinant expression vector containing the above-mentioned nucleic acid.

[0023] Furthermore, the recombinant expression vector can be obtained by conventional methods in the art, that is, the nucleic acid molecule of the synthetic gene of the ArsL mutant of the present invention is connected to various commercially available expression vectors to construct; the expression vector is preferably plasmid pET-28a(+). Taking plasmid pET-28a(+) as an example, the recombinant expression plasmid of the present invention can be obtained by the following method: the nucleic acid product obtained by PCR amplification and the expression vector pET-28a(+) are double-digested with restriction endonucleases NdeI and EcoRI respectively to form complementary sticky ends, and connected by ligase to form a recombinant expression plasmid containing the ArsL mutant gene of the present invention. That is, the recombinant vector is a DNA fragment in the NdeI and EcoRI recognition sequences of the pET28a(+) vector replaced with ArsL C428A The recombinant plasmid obtained by expressing the gene.

[0024] Based on the same method, the DNA fragment in the NdeI and EcoRI recognition sequences in the pET28a(+) vector can also be replaced with the ArsL expression gene to obtain a recombinant plasmid. The ArsL expression gene sequence is shown in SEQ ID NO.3. C428A The expression gene sequence of ArsL is shown in SEQ ID NO.4. C428A The expression gene is obtained by mutating the TG at position 1342-1343 of the expression gene of ArsL to GC.

[0025] The fourth technical solution adopted by the present invention is to provide a recombinant expression transformant comprising the above-mentioned recombinant expression vector.

[0026] The method for preparing the recombinant expression transformant is preferably: transforming the above-mentioned recombinant expression vector into a host microorganism; the host microorganism is preferably Escherichia coli (abbreviated as E. coli), more preferably Escherichia coli BL21 (DE3). The aforementioned recombinant expression vector is transformed into Escherichia coli BL21 (DE3) to obtain a preferred recombinant expression transformant (a genetically engineered strain) of the present invention. The plasmid transformation method can be selected from conventional methods in the art, such as electroporation, heat shock method, etc.

[0027] The fifth technical solution adopted by the present invention is to provide an ArsL mutant catalyst, wherein the catalyst can be in any of the following forms:

[0028] (1) culturing the recombinant expression transformant of the present invention, and isolating transformant cells containing the ArsL mutant, i.e., resting cells of the recombinant expression transformant;

[0029] (2) culturing the recombinant expression transformant of the present invention, isolating and crushing the transformant cells containing the ArsL mutant to obtain a lysate, or purifying and separating the lysate to obtain a pure enzyme solution;

[0030] (3) Cultivating the recombinant expression transformant of the present invention, isolating and crushing the transformant cells containing the ArsL mutant to obtain a lysate, and freeze-drying the lysate to obtain enzyme powder.

[0031] The preparation method of the ArsL mutant catalyst is preferably:

[0032] ArsL C428A Single colonies of the expressing bacteria were picked out and cultured overnight in 10 mL of LB medium containing 50 μg / mL kanamycin. Then they were transferred to 1 L of LB medium containing 50 μg / mL kanamycin for expansion culture until the OD of the bacterial solution reached 1.5. 600 When the pH reaches 0.6-0.8, add 200 μl of 1M IPTG and induce the expression of the gene at 18°C ​​and 100 rpm. The required expression time is 18 hours.

[0033] After expression, the bacterial solution was collected by centrifugation, the supernatant medium was completely removed, and the bacteria were resuspended in 30 mL of 50 mM Tris-HCl (pH 8.0) buffer. In an anaerobic glove box, the bacteria were broken using an ultrasonic disruptor and centrifuged to remove cell debris. The supernatant was the ArsL expression medium. C428A The lysate is freeze-dried to obtain enzyme powder.

[0034] The purification operation is an operation that is easily understood and implemented by those skilled in the art, and is preferably a Ni column affinity chromatography method; the freeze-drying refers to precooling the crude enzyme solution and then placing it in a freeze dryer for freeze drying for about 30 to 80 hours to obtain a freeze-dried enzyme powder.

[0035] Based on this, the present invention further provides a catalyst based on the wild-type AST synthase ArsL, wherein the catalyst can be in any of the following forms:

[0036] (1) culturing a recombinant expression transformant of a wild-type AST synthase ArsL, and isolating transformant cells containing the wild-type AST synthase ArsL, i.e., resting cells of the recombinant expression transformant;

[0037] (2) culturing a recombinant expression transformant of wild-type AST synthase ArsL, isolating and crushing transformant cells containing wild-type AST synthase ArsL to obtain a lysate, or purifying and separating the lysate to obtain a pure enzyme solution;

[0038] (3) Cultivating the recombinant expression transformant of the wild-type AST synthase ArsL, isolating and crushing the transformant cells containing the wild-type AST synthase ArsL to obtain a lysate, and freeze-drying the lysate to obtain enzyme powder.

[0039] The sixth technical solution adopted by the present invention: providing the use of wild-type AST synthetase ArsL, the ArsL mutant, a catalyst based on the wild-type AST synthetase ArsL or an ArsL mutant catalyst in catalyzing the synthesis of Arsinothricin from sodium methylarsenate (MMA) and S-adenosylmethionine (SAM).

[0040] In one embodiment of the present invention, sodium methyl arsenate (MMA) and S-adenosylmethionine (SAM) are used as substrates, and a catalytic reaction is carried out using the wild-type AST synthase ArsL, the ArsL mutant, a catalyst based on the wild-type AST synthase ArsL or an ArsL mutant catalyst, dithiothreitol (DTT) is used as an arsenic reducing agent, and titanium (III) citrate is used as a reducing agent for the iron-sulfur cluster in the ArsL enzyme to obtain Arsinothricin (AST).

[0041] In one embodiment of the present invention, after the reaction is completed, hydrogen peroxide solution and trifluoroacetic acid are added to terminate the reaction.

[0042] In one embodiment of the present invention, the reaction system of the catalytic reaction can be obtained by adding SAM, DTT, MMA and titanium (III) citrate to 200 microliters of the enzyme solution of the wild-type AST synthase ArsL or the ArsL mutant, and the volume is fixed to 300 microliters with 50mMTris hydrochloric acid buffer (pH 8.0). The final concentrations of SAM, DTT, MMA and titanium (III) citrate in the reaction system are 10-20mM, 10-20mM, 5-15mM and 10-20mM, respectively.

[0043] In one embodiment of the present invention, the reaction system of the catalytic reaction can be obtained by adding SAM, DTT, MMA and titanium citrate (III) to 200 microliters of the enzyme solution of the wild-type AST synthase ArsL or the ArsL mutant, and the volume is fixed to 300 microliters with 50mMTris hydrochloric acid buffer (pH 8.0). The final concentrations of SAM, DTT, MMA and titanium citrate (III) in the reaction system are 12mM, 15mM, 10mM and 15mM respectively. After the reaction is completed, 10 microliters of 30% hydrogen peroxide solution and 10 microliters of trifluoroacetic acid are added to terminate the reaction.

[0044] Technical solution seven of the present invention: Provide a method for synthesizing Arsinothricin, using MMA and SAM as substrates, DTT as an arsenic reducing agent, titanium (III) citrate as a reducing agent for the iron-sulfur cluster in the ArsL enzyme, and utilizing the wild-type AST synthase ArsL, the ArsL mutant, a catalyst based on the wild-type AST synthase ArsL or an ArsL mutant catalyst to carry out a catalytic reaction to obtain Arsinothricin.

[0045] Compared with the prior art, the present invention has the following advantages and effects:

[0046] (1) The ArsL mutant of the present invention has higher catalytic activity and thermal stability. The ArsL mutant is used to realize the process of converting high-concentration MMA into AST. C428A The catalytic activity of the mutant was significantly improved compared with the wild-type AST synthase.

[0047] (2) The existing organic total synthesis method and semi-organic enzyme synthesis method for synthesizing AST both require chemical methods and are complex processes, while the enzyme catalyst catalyzed reaction provided by the present invention has the advantages of mild reaction conditions, safe operation, and green and environmentally friendly process, and has a good prospect for industrial application. In addition, the yield of this synthetic route is significantly improved compared to the catalytic yield of the organic synthesis route, semi-organic enzyme synthesis, and natural biosynthesis route. The ArsL mutant can be used as a potential industrial application enzyme and has a broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Schematic diagram of the pathway for synthesizing AST designed in the present invention.

[0049] Figure 2 The following is a test chart of the antibacterial effect of AST. The left picture shows Escherichia coli, the left point is the blank control, and the right point is the inhibition ring produced by AST on the LB solid medium grown with Escherichia coli. The right picture shows Staphylococcus aureus, the left point is the blank control, and the right point is the inhibition ring produced by AST on the LB solid medium grown with Staphylococcus aureus.

[0050] Figure 3 This is the HR-MSMS spectrum of AST.

[0051] Figure 4 It is a comparison chart of mass spectrometry signals of AST in the reaction products of different catalytic systems in the present invention.

[0052] Figure 5 It is a comparison diagram of the mass spectrometry signals of MMA(V) in the reaction products of different catalytic systems in the present invention. DETAILED DESCRIPTION

[0053] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is described in detail below in conjunction with specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, several variations and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0054] Unless otherwise stated, the specific experiments in the following examples were performed according to conventional methods and conditions in the art, or in accordance with the commercial instructions of the kits.

[0055] Sodium methylarsenate: Shanghai Bailingwei Chemical Technology Co., Ltd., product number P-279N;

[0056] Plasmid pET28a-ArsL was constructed by the inventors according to conventional methods in the art;

[0057] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0058] Example 1

[0059] ArsL C428A Construction of expression plasmid

[0060] Plasmid pET28a-ArsL was used as a template, and the primers in Table 1 were used as upstream and downstream primers for PCR construction. The PCR program was: pre-denaturation at 98°C for 3 minutes, denaturation at 98°C for 15 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 7 minutes, and finally at 72°C for 10 minutes. The denaturation to extension program was set to 25 cycles.

[0061] Table 1 Primers used for transformation of ArsL

[0062]

[0063] The sequence of ArsL C428AF is shown in SEQ ID NO.5, and the sequence of ArsL C428A R is shown in SEQ ID NO.6.

[0064] Add 1 μl of Dpn I enzyme to the PCR product to eliminate the original plasmid template, and digest overnight in a 37°C constant temperature water bath to ensure complete digestion of the original template. Take 5 μl of the enzyme-digested PCR product and add it to 100 μl of E. coli DH5α competent cells. After incubation on ice for 30 minutes, heat shock in a 42°C water bath for 1 minute, and then transfer to ice to cool for 3 minutes. Add 800 μl of LB medium and culture in a 37°C constant temperature incubator for 1 hour. Collect the cells by centrifugation, discard most of the supernatant medium, resuspend the cells with the remaining medium, and spread the bacterial solution on a kanamycin-resistant (concentration of 50 μg / ml) LB plate, and continue to culture in a 37°C constant temperature incubator until a single colony grows. Pick out multiple single colonies on the plate and send them for sequencing to verify that the mutation is complete. Then use a plasmid extraction kit to extract ArsL C428A Expression plasmids.

[0065] Take 5 μl of ArsL C428A The expression plasmid was added to 100 μL of E. coli BL21 (DE3) competent cells, incubated on ice for 30 minutes, heat-shocked in a 42°C water bath for 1 minute, and then transferred to ice for 3 minutes. 800 μL of LB medium was added and cultured in a 37°C constant temperature incubator for 1 hour. The cells were collected by centrifugation, most of the supernatant medium was discarded, the cells were resuspended with the remaining medium, and the bacterial solution was spread on a kanamycin-resistant (concentration of 50 μg / ml) LB plate, and cultured continuously in a 37°C constant temperature incubator until a single colony grew. The single colony is ArsL C428A Expression bacteria.

[0066] According to the same method, the original ArsL expression plasmid was transferred into Escherichia coli BL21 (DE3) competent cells to obtain ArsL expression bacteria.

[0067] Example 2

[0068] ArsL and ArsL C428A Expression

[0069] First, ArsL or ArsL C428A Single colonies of the expressing bacteria were picked out and cultured overnight in 10 mL of LB medium containing 50 μg / mL kanamycin. Then they were transferred to 1 L of LB medium containing 50 μg / mL kanamycin for expansion culture until the OD of the bacterial solution reached 1.5. 600 When the pH reaches 0.6-0.8, add 200 μl of 1M IPTG and induce the expression of the gene at 18°C ​​and 100 rpm. The required expression time is 18 hours.

[0070] After expression, the bacterial solution was collected by centrifugation, the supernatant medium was completely removed, and the bacteria were resuspended in 30 mL of 50 mM Tris-HCl (pH 8.0) buffer. In a glove box, the bacteria were broken up using an ultrasonic disruptor and centrifuged to remove cell debris. The supernatant was the medium expressing ArsL or ArsL C428A Lysate of recombinant cells.

[0071] Example 3

[0072] ArsL and ArsL C428A Purification

[0073] The lysate obtained in Example 2 was transferred to a Ni-NTA resin column, so that the target enzyme was adsorbed on the nickel column. 50 mM Tris-HCl (pH 8.0) buffer was used to wash away the impurities, and then 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM imidazole was used to elute the target protein.

[0074] In the process of reconstructing the iron-sulfur cluster, DTT was first added to 10 mM, and then ferrous sulfate was added to 1 mM twice, with an interval of 20 minutes each time. Sodium sulfide was added to 1 mM twice, with an interval of 20 minutes each time. After incubation on ice overnight, the precipitate was removed by centrifuge, and the supernatant was desalted on a PD-10 column (Bio-Rad). The PD-10 column was pre-equilibrated with desalting buffer (50 mM Tris, 25 mM NaCl, and 10% glycerol, pH 8.0), and the target side was also eluted with this desalting buffer.

[0075] Example 4

[0076] Antibacterial effect of Arsinothricin (AST) as a broad-spectrum antibiotic

[0077] The antibacterial effect test of AST is shown in the figure below: Figure 2 As shown, the left picture shows Escherichia coli, the left dot is the blank control, and the right dot is the inhibition ring produced by AST on the LB solid medium grown by Escherichia coli. The right picture shows Staphylococcus aureus, the left dot is the blank control, and the right dot is the inhibition ring produced by AST on the LB solid medium grown by Staphylococcus aureus. It can be seen that AST has a good inhibitory effect on both Escherichia coli and Staphylococcus aureus.

[0078] The HR-MSMS spectrum of AST is as follows Figure 3 shown.

[0079] Example 5

[0080] Synthesis of AST

[0081] refer to Figure 1, using MMA and SAM as substrates, DTT as an arsenic reductant, and titanium(III) citrate as a reductant for the iron-sulfur cluster in the ArsL enzyme, using wild-type AST synthase ArsL or the ArsL mutant ArsL C428A The catalytic reaction was carried out to obtain Arsinothricin.

[0082] Add 200 μl of ArsL or ArsL C428A The enzyme solution was prepared by adding SAM, DTT, MMA and titanium (III) citrate, and the volume was adjusted to 300 μl with 50 mM Tris hydrochloric acid buffer (pH 8.0). The final concentrations of SAM, DTT, MMA and titanium (III) citrate in the reaction system were 12 mM, 15 mM, 10 mM and 15 mM, respectively.

[0083] The reaction needs to be carried out in an anaerobic glove box, and the required reaction time is 2 hours. After the reaction is completed, 10 microliters of 30% hydrogen peroxide solution and 10 microliters of trifluoroacetic acid are added to terminate the reaction and release the product from the enzyme. The obtained product is detected in the mass spectrometer for the amount of AST and raw material MMA.

[0084] SAM, DTT, MMA and titanium (III) citrate were added to 2 ml of lysate of recombinant cells expressing ArsL or ArsL mutants (obtained in Example 3). The final concentrations of SAM, DTT, MMA and titanium (III) citrate in the reaction system were 12 mM, 15 mM, 10 mM and 15 mM, respectively. The reaction needed to be carried out in an anaerobic glove box, and the required reaction time was 2 hours. After the reaction was completed, 100 microliters of 30% hydrogen peroxide solution and 100 microliters of trifluoroacetic acid were added to terminate the reaction and release the product from the enzyme.

[0085] The obtained product was tested for the amount of AST and the amount of raw material MMA in the mass spectrometer. The mass spectrometer was tested in ESI positive ion mode. For AST, the signal intensity of the mass-to-charge ratio was 226.00-226.01; for MMA, the signal intensity of the sum ratio was 140.95-140.96. The specific signal spectrum is shown in Figure 4 , Figure 5 shown.

[0086] The signals of AST in the catalytic products are shown in Table 2, and the signals of MMA in the catalytic products are shown in Table 3.

[0087] Table 2 Signals of AST in catalytic products

[0088]

[0089] Table 3 Signals of MMA in catalytic products

[0090]

[0091] The results are shown in Table 2 and Table 3. C428A The catalytic ability of MMA is significantly improved, and 10mM MMA can be completely converted into AST. After the reaction is completed, the signal of the raw substrate MMA cannot be detected in the mass spectrometer. The catalytic activity of the lysate is lower than that of the enzyme solution, but the purification step is omitted, which is conducive to large-scale reactions.

[0092] In summary, the conversion of high-concentration MMA to AST was achieved by using the mutant of ArsL. C428A The mutant has significantly improved catalytic activity compared to the original ArsL. And the yield using this synthetic route is significantly higher than the catalytic yield of organic synthesis routes, semi-organic enzyme synthesis and natural biosynthesis routes, and can be used as a potential industrial application enzyme.

[0093] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0094] The sequences involved in the present invention are as follows:

[0095] SEQ ID No.1: Amino acid sequence of wild-type AST synthase ArsL

[0096]

[0097] SEQ ID No.2: ArsL mutant ArsL C428A The amino acid sequence

[0098]

[0099]

[0100] SEQ ID No.3: Nucleotide sequence of the gene encoding the wild-type AST synthase ArsL

[0101]

[0102] SEQ ID No.4: ArsL C428A The nucleotide sequence of the synthetic gene

[0103] SEQ ID NO.5: Sequence of primer ArsL C428A F tgcctgaaag ccccgaattc gagctccgtcgacaagctt 39 SEQ ID NO.6: Sequence of primer ArsL C428A R cgaattcggg gctttcaggcagcaacgttt gaaaacgcc 39.

Claims

1. An ArsL mutant, characterized in that The ArsL mutant is a mutant obtained by mutating the 428th cysteine ​​C in the amino acid sequence of the wild-type AST synthase ArsL to alanine A. The amino acid sequence of the ArsL mutant is shown in SEQ ID No.

2.

2. An isolated nucleic acid, characterized in that The nucleic acid encodes the ArsL mutant as claimed in claim 1, and the nucleotide sequence of the isolated nucleic acid is shown in SEQ ID No.

4.

3. A recombinant expression vector, characterized in that: Comprising the nucleic acid as claimed in claim 2.

4. A recombinant expression transformant, characterized in that: Comprising the recombinant expression vector as claimed in claim 3.

5. An ArsL mutant catalyst, characterized in that Is any of the following forms: (1) culturing the recombinant expression transformant according to claim 4, and isolating transformant cells containing the ArsL mutant, i.e., resting cells of the recombinant expression transformant; (2) culturing the recombinant expression transformant according to claim 4, isolating and disrupting the transformant cells containing the ArsL mutant to obtain a lysate, or purifying and separating the lysate to obtain a pure enzyme solution; (3) Cultivating the recombinant expression transformant according to claim 4, isolating and disrupting the transformant cells containing the ArsL mutant to obtain a lysate, and freeze-drying the lysate to obtain an enzyme powder.

6. Use of wild-type AST synthetase ArsL, the ArsL mutant according to claim 1, a catalyst based on the wild-type AST synthetase ArsL, or the ArsL mutant catalyst according to claim 5 in catalyzing the synthesis of Arsinothricin from sodium methylarsenate and S-adenosylmethionine.

7. The use according to claim 6, characterized in that The amino acid sequence of the wild-type AST synthase ArsL is shown in SEQ ID No. 1; Catalysts based on the wild-type AST synthase ArsL are either: (1) culturing a recombinant expression transformant of a wild-type AST synthase ArsL, and isolating transformant cells containing the wild-type AST synthase ArsL, i.e., resting cells of the recombinant expression transformant; (2) culturing a recombinant expression transformant of wild-type AST synthase ArsL, isolating and crushing transformant cells containing wild-type AST synthase ArsL to obtain a lysate, or purifying and separating the lysate to obtain a pure enzyme solution; (3) Cultivating the recombinant expression transformant of the wild-type AST synthase ArsL, isolating and crushing the transformant cells containing the wild-type AST synthase ArsL to obtain a lysate, and freeze-drying the lysate to obtain enzyme powder.

8. The use according to claim 6 or 7, characterized in that Arsinothricin is obtained by taking sodium methyl arsenate and S-adenosylmethionine as substrates, using the wild-type AST synthase ArsL, the ArsL mutant, a catalyst based on the wild-type AST synthase ArsL or the ArsL mutant catalyst to carry out a catalytic reaction, using dithiothreitol as an arsenic reducing agent, and using titanium citrate as a reducing agent for the iron-sulfur cluster in the ArsL enzyme.

9. The use according to claim 8, characterized in that After the reaction was completed, hydrogen peroxide solution and trifluoroacetic acid were added to terminate the reaction.

10. The use according to claim 8, characterized in that The final concentrations of S-adenosylmethionine, dithiothreitol, sodium methylarsenate, and titanium (III) citrate in the reaction system were 10-20 mM, 10-20 mM, 5-15 mM, and 10-20 mM, respectively; Based on 300-400 μl of the reaction system, the amount of the wild-type AST synthase ArsL or the ArsL mutant enzyme solution used in the reaction system is 200 μl.

Images