FvemiR172c gene for regulating and controlling anthocyanin accumulation of strawberry fruits and application of FvemiR172c gene

Abstract

The invention relates to the technical field of plant molecular genetic engineering, in particular to an FvemiR172c gene for regulating and controlling anthocyanin accumulation of strawberry fruits and application of the FvemiR172c gene. The nucleotide sequence of the FvemiR172c gene is as shown in SEQ ID NO. 1 (sequence identifier number 1). The invention discloses a nucleotide sequence of an FvemiR172c gene for regulating and controlling the anthocyanin content of strawberry fruits, and experiments show that the FvemiR172c gene or an expression vector containing the FvemiR172c gene can be applied to regulation and control of the anthocyanin content of the strawberry fruits so as to regulate and control the color of the strawberry fruits. The invention provides a new gene resource for creating different colors of strawberries and molecular breeding for promoting / inhibiting anthocyanin accumulation.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular gene engineering, and in particular to an FvemiR172c gene for regulating anthocyanin accumulation in strawberry fruit and an application thereof. Technical Background

[0002] Strawberry fruit has bright color, unique aroma, delicious taste and high nutritional value, and is very popular among consumers. Anthocyanin is a water-soluble pigment in the flavonoid family. It gives strawberry fruit, petiole, petals and other tissues bright colors, affects the quality of the fruit, and has a certain protective effect on plant biological and abiotic stresses. In addition, anthocyanin has antioxidant properties, can scavenge free radicals in the human body, and has the effect of delaying aging. Therefore, optimizing the content of anthocyanins is an important breeding goal for horticultural crops, and analyzing the molecular mechanism of anthocyanin accumulation has far-reaching theoretical and practical application value.

[0003] miRNA is a type of non-coding small RNA with a length of usually about 20-24 nt. It plays a very important role in plant growth and development, and in response to biotic and abiotic stresses. miR172 is an important member of the miRNA family and plays an important regulatory role in many processes such as growth phase transition, flowering time, fruit ripening, and organ morphology. Studies have shown that miR172 can regulate the ripening of respiratory climacteric apples through the ethylene pathway.

[0004] However, strawberry is a typical non-climacteric fruit. Although patent CN107075500A discloses that miR172 can regulate the size of various fruits including strawberries, the patent does not distinguish between climacteric fruits and does not provide real regulation data on the size of strawberry fruits, which reduces the credibility of the results. Therefore, whether and how miR172 family members regulate strawberry fruit development, especially the impact on quality indicators such as color and anthocyanins, remains to be analyzed. So far, there has been no report on the effect of miR172 on the accumulation of anthocyanins in strawberry fruits. Summary of the invention

[0005] In order to solve the problems in the prior art, one of the objectives of the present invention is to provide a FvemiR172c gene for regulating the accumulation of anthocyanins in strawberry fruit. The nucleotide sequence of the FvemiR172c gene is shown in SEQ ID NO.1.

[0006] The second object of the present invention is to provide an application of the above-mentioned FvemiR172c gene in regulating the accumulation of anthocyanins in strawberry fruit.

[0007] The third object of the present invention is to provide an application of the above-mentioned FvemiR172c gene in regulating the color of strawberry fruit.

[0008] Preferably, by inhibiting the expression or activity of the FvemiR172c gene, the accumulation of anthocyanins in strawberry fruits is increased and the redding of strawberry fruits is promoted; or by increasing the expression or activity of the FvemiR172c gene, the accumulation of anthocyanins in strawberry fruits is reduced and the redding of strawberry fruits is delayed.

[0009] Preferably, the expression of the FvemiR172c gene is inhibited by silencing vector STTM-miR172, and the sequence of the STTM-miR172 is shown in SEQ ID NO.2.

[0010] Preferably, the expression of the FvemiR172c gene is increased by an FveMIR172c overexpression vector, wherein the FveMIR172c overexpression vector is pK7WG2D-FvemiR172c, and the PCR product of the FveMIR172c gene is obtained using "Ruegen" strawberry fruit cDNA as a template, and is connected to the pK7WG2D vector.

[0011] A fourth object of the present invention is to provide a construct for increasing the expression level of the FvemiR172c gene in strawberry, wherein the construct contains the FvemiR172c gene as described above.

[0012] The fifth object of the present invention is to provide a construct for reducing or eliminating the expression of the FvemiR172c gene in strawberry, wherein the construct comprises a mimic target of the antisense complementary sequence of the mature form of the strawberry FvemiR172c gene.

[0013] The present invention also provides a host cell comprising the construct described above.

[0014] Finally, the present invention provides a use of the construct as described above in regulating anthocyanin accumulation in strawberry fruit or regulating the color of strawberry fruit.

[0015] The beneficial effects of the present invention are:

[0016] 1) The present invention confirms through experiments of strawberry transient transformation and Arabidopsis stable transformation that miR172c can negatively regulate strawberry fruit coloring and reduce anthocyanin accumulation in mature fruits. The present application provides candidate genes for molecular breeding work on regulating strawberry fruit color and regulating anthocyanin content in fruits.

[0017] 2) Most commercially available strawberries are red, and the white and pink strawberries that have appeared on the market in recent years are sold at much higher prices than ordinary red strawberries due to their scarcity. According to the method provided by the present application, by increasing the expression or activity of the FvemiR172c gene in strawberries, the accumulation of strawberry anthocyanins can be inhibited, the color of strawberries in the mature stage becomes lighter, and white and pink strawberries are produced in batches, which increases the commodity value and has a good commercial prospect.

[0018] 3) According to the method provided in the present application, by inhibiting the expression or activity of the FvemiR172c gene in strawberries, the accumulation of anthocyanins in strawberries can be increased, the color of ripe strawberries can be turned red, and the selling quality of red strawberry varieties can be improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is an analysis of the phenotype of FveMIR172 transgenic Arabidopsis and the relative expression level of FveMIR172 in transgenic Arabidopsis in Example 1 of the present application.

[0020] Figure 2 This is the phenotypic changes of WT and MIR172c overexpressing Arabidopsis in Example 1 of the present application.

[0021] Figure 3 Schematic diagram of the model of STTM-miR172 and miRNA binding in Example 2 of the present application.

[0022] Figure 4 These are the experimental results of FveMIR172c inhibiting the accumulation of anthocyanins in strawberries in Example 3 of the present application. Figure A shows the comparison of the peel colors of the experimental group and the control group, Figure B shows the expression level of FveMIR172c in the fruit, and Figure C shows the anthocyanin content in the fruit.

[0023] Figure 5 These are the experimental results of FveMIR172c-STTM promoting the accumulation of anthocyanins in strawberries in Example 3 of the present application. Figure A shows the comparison of the peel colors of the experimental group and the control group, Figure B shows the expression level of FveMIR172c in the fruit, Figure C shows the anthocyanin content in the fruit, and Figure D shows the anthocyanin extraction results in the fruit. DETAILED DESCRIPTION

[0024] For ease of understanding, the technical solution of the present invention is described in more detail below in conjunction with embodiments:

[0025] Example 1

[0026] FveMIR172c binary expression vector and genetic transformation of Arabidopsis

[0027] Construction of FveMIR172c binary expression vector: The binary expression vector pH7LIC1.0 was digested with restriction endonuclease (Stu1), and the linearized vector was directly used for subsequent use. Then, the high-fidelity Phanta was used to amplify the fragment FveMIR172c using DNA extracted from wild-type Hawaii4 strawberry leaves as templates and FveMIR172c-F: AC TAGTTCCAGGGCGCCCGGGCTAATCCGTTCTGAATGAATCTATG and FveMIR 172c-R: ATCATCGACCCGACGCCCGGGCAAAGCGACCAGCAAGAATCACG as primers. The FveMIR172c target gene fragment was then connected to pH7LIC1.0 using homologous recombinase to obtain the pH7LIC1.0-FveMIR172c vector.

[0028] The ligation product was introduced into E. coli by heat shock method and coated with LB + 50 mg L -1 Spectinomycin. The positive clones were identified by PCR and sequenced to obtain a single clone with a completely matched nucleotide sequence. The plasmid DNA of the single clone was extracted and introduced into Agrobacterium GV3101 to obtain Agrobacterium containing the recombinant vector pH7LIC1.0-FveMIR172c, and Arabidopsis was infected. After the Arabidopsis seeds were harvested, Arabidopsis was screened for positive seedlings using antibiotics through tissue culture and molecular biological detection of transgenic Arabidopsis was performed.

[0029] Experimental results:

[0030] See also Figure 1-Figure 2 . Figure 1 This study was to analyze the phenotype of FveMIR172 transgenic Arabidopsis and the relative expression of FveMIR172 in transgenic Arabidopsis. The results showed that among the Arabidopsis plants identified as positive, the flowering time of Arabidopsis plants overexpressing MIR172c was significantly advanced compared with wild-type Arabidopsis at the same planting time. The bolting time was also advanced by several days, and the number of rosette leaves in the overexpressing Arabidopsis plants was significantly reduced, until the rosette leaves fell to 1-2 leaves in the later stage. This is consistent with the results of previous studies, verifying that MIR172c overexpression can regulate the growth period transition of Arabidopsis and affect leaf development. Next, three transgenic Arabidopsis plants with obvious phenotypes were selected for qRT-PCR analysis to determine the expression level of MIR172c. In Arabidopsis plants overexpressing MIR172c, the expression level of MIR172c increased significantly, and the expression level was about 2-3 times higher than that of wild-type Arabidopsis.

[0031] Figure 2The phenotypic changes of WT and MIR172c overexpressing Arabidopsis. It can be seen that after the wild-type Arabidopsis was treated with high concentrations of sucrose, the anthocyanin accumulation in Arabidopsis seedlings and plants was more obvious, especially the back of the leaves and the stems showed obvious red, while the MIR172c Arabidopsis plants only had very little anthocyanin accumulation in a small area of ​​the leaves, and no obvious anthocyanin accumulation was found in other tissues. This shows that MIR172c can significantly inhibit the accumulation of anthocyanins in Arabidopsis, but MIR172c cannot completely inhibit the accumulation of anthocyanins.

[0032] Experiments show that the FveMIR172c target gene fragment extracted in the present application is an effective fragment, and FveMIR 172c can regulate anthocyanin accumulation.

[0033] Example 2

[0034] Construction of FveMIR172c overexpression vector and STTM silencing vector

[0035] Construction of FveMIR172c overexpression vector: The two-part method was used to construct the vector. First, the pENT1A vector was used for homologous recombination, and then the Gateway system was used to construct the vector. The process is as follows:

[0036] Using the cDNA of "Ruegen" (a diploid red-fruited forest strawberry) fruit as a template, the full-length FveMIR172c gene was amplified and connected to the intermediate vector pENT1A through homologous recombination reaction. The sequence of FveMIR172c (including the precursor sequence) is shown in SEQ ID NO.1. After positive single clone selection, ordinary sequencing and other procedures, the above-constructed vector was subjected to LR reaction with the overexpression vector pK7WG2D. The reaction product was transferred to the competent cell of the large intestine and cultured at 37°C overnight. After PCR verification, the plasmid was transferred to Agrobacterium, cultured at 28°C for 3d, a single clone was grown, and PCR verification was performed.

[0037] Construction of STTM silencing vector of FveMIR172c: The STTM interference system structure reported previously was used to design the STTM-miR172 sequence, with a hairpin structure and a Spacer sequence containing 48 nt nucleotides in the middle of the sequence (Spacr sequence: GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTA AAGAAGAAGAAT), and Target Mimics (simulated targets) with antisense complementary sequences of the mature diploid strawberry miR172 were on both sides of the Spacer.

[0038] A CTA three-base mismatch loop was added between the 11th and 12th nucleotides of the Target Mimics sequence to avoid cleavage by the AGO protein in the strawberry RISC complex so that the STTM system can perform its interference function normally. The Spacer and the Target Mimics sequences on both sides together form the STTM-miR172 sequence.

[0039] The full length of the sequence of STTM-miR172 is 5′-CTGCAGCATCACTATCAAGATTCCGTTG TTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAA AGAAGAAGAATATGGTCTAAAGAAGAAGAATCTGCAGCATCACTATCAAG ATTCC-3′ (SEQ ID NO. 2).

[0040] The STTM-miR172 sequence was connected to the intermediate vector pENT1A by homologous recombination. After positive single clone selection and normal sequencing, the plasmid was extracted and connected to the final vector pK7WG2D by LR reaction, and then transformed into Escherichia coli competent cells, and the positive colonies were verified by PCR after the Agrobacterium competent cells.

[0041] Figure 3 Schematic diagram of the model of STTM-miR172 and miRNA binding.

[0042] Example 3

[0043] Strawberry instant transformation

[0044] The overexpression vector and STTM vector obtained in Example 2 were used to transiently inject strawberries, and the transiently expressed strawberry fruits were taken to perform qRT-PCR experiments and determine the anthocyanin content.

[0045] The specific steps are as follows:

[0046] 1) Pick a single clone and add it to 6 ml of liquid LB containing resistance (LB+Gent 50μg / ml+Rif 50μg / ml+Kam 50μg / ml or Spe 50μg / ml), and culture it at 28℃ with shaking overnight until the OD of the bacterial solution reaches 0.8-1.0;

[0047] 2) Take 2 ml of bacterial solution into a centrifuge tube and centrifuge at 5000 rpm for 5 min;

[0048] 3) Resuspend the bacterial solution in liquid MS containing 2% sucrose to make the OD value of the bacterial solution reach 0.8;

[0049] 4) Select fruits in the white-ripe stage, use a 1 ml syringe to absorb the bacterial solution, insert the needle tip from the fruit tip to the fruit core and inject into the fruit until the injection solution seeps out of the fruit surface. 1 ml of bacterial solution can be injected into 5-8 fruits. Mark them and observe the results about one week after the injection.

[0050] 5) Each gene was injected into more than 10 fruits. The fruit injected with blank buffer was named WT, and each experimental group had three biological replicates, named #1, #2, and #3.

[0051] Determination of anthocyanin content

[0052] Weigh 0.5 g of instantaneously transformed strawberry fruit, add liquid nitrogen and grind to powder, add 5 ml of methanol: water: formic acid: trifluoroacetic acid (70:27:2:1) extract, and place in a 4°C refrigerator away from light for 12 h. Filter the supernatant with filter paper and set aside, and use an ultraviolet spectrophotometer (Hoefer Vision, SP-2001) to detect the absorbance of the extract at 530 nm and 657 nm.

[0053] Total anthocyanin content = (A530–0.25*A657) / M, where A530 and A657 refer to the absorbance at 530nm and 657nm, respectively, and M refers to the fresh weight of the fruit. The significant differences were analyzed using IBM SPSS Statistis22 software, * represents P < 0.05, and ** represents P < 0.01.

[0054] Experimental results:

[0055] See also Figure 4-Figure 5 . Figure 4 The results show that FveMIR172c inhibits anthocyanin accumulation in strawberry. Figure 4 In Figure A, the skin color of the strawberry fruit after transient transformation was significantly lighter than that of the blank control, and the expression level of FveMIR172c in the fruit was significantly increased ( Figure 4 The expression level of the injected strawberry fruit was about 3 times higher than that of the control group. The anthocyanin content in the strawberry fruit after injection was then measured. The results showed that the anthocyanin content in the fruit had a relatively obvious downward trend ( Figure 4 Therefore, it is speculated that MIR172c can inhibit the accumulation of anthocyanins in strawberry.

[0056] Figure 5 The results of the experiment of FveMIR172c-STTM promoting the accumulation of anthocyanins in strawberries. After silencing the expression of MIR172c, the color of the strawberry fruit skin was redder than that of the control group. After silencing the expression of MIR172c, the expression level of miR172c was significantly reduced ( Figure 5 In B), compared with the fruit overexpressing FveMIR172c, the anthocyanin content was significantly increased, and the anthocyanin content was slightly higher than that of the blank control group ( Figure 5 (C, D).

[0057] The above results show that overexpression of FveMIR172c can inhibit the accumulation of anthocyanins in strawberry fruits, while silencing FveMIR172c can promote the accumulation of anthocyanins in strawberry fruits. Based on this, FveMIR172c can be used to regulate anthocyanins in strawberry fruits.

[0058] The above implementation modes are only used to illustrate the technical solutions of the present invention, but not to limit the present invention. Although the present invention has been described in detail with reference to the above implementation modes, those skilled in the art should understand that any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A FvemiR172c gene that regulates anthocyanin accumulation in strawberry fruit, characterized in that: The nucleotide sequence of the FvemiR172c gene is shown in SEQ ID NO.

1.

2. An application of the FvemiR172c gene as claimed in claim 1 in regulating the accumulation of anthocyanins in strawberry fruit.

3. Use of the FvemiR172c gene as claimed in claim 1 in regulating the color of strawberry fruit.

4. The use according to claim 2 or 3, characterized in that By inhibiting the expression or activity of the FvemiR172c gene, the accumulation of anthocyanins in strawberry fruits is increased and the redding of strawberry fruits is promoted; or by increasing the expression or activity of the FvemiR172c gene, the accumulation of anthocyanins in strawberry fruits is reduced and the redding of strawberry fruits is delayed.

5. The use according to claim 4, characterized in that The expression of the FvemiR172c gene is inhibited by the silencing vector STTM-miR172, and the sequence of the STTM-miR172 is shown in SEQ ID NO.

2.

6. The use according to claim 4, characterized in that The expression of the FvemiR172c gene was increased by using an FveMIR172c overexpression vector, wherein the FveMIR172c overexpression vector was pK7WG2D-FvemiR172c. The PCR product of the FveMIR172c gene was obtained using "Ruegen" strawberry fruit cDNA as a template and connected to the pK7WG2D vector.

7. A construct for increasing the expression of the FvemiR172c gene in strawberry, characterized in that: Contains the FvemiR172c gene as described in claim 1.

8. A construct for reducing or eliminating the expression of the FvemiR172c gene in strawberry, characterized in that: The mimic target contains the antisense complementary sequence to the mature form of the strawberry FvemiR172c gene.

9. A host cell, characterized in that Containing the construct according to claim 7, or containing the construct according to claim 8.

10. Use of the construct according to claim 7 or 8 in regulating anthocyanin accumulation or regulating the color of strawberry fruit.

Images