Wheat salicylic acid receptor npr3 gene and application thereof in wheat disease resistance
By knocking out the wheat salicylic acid receptor NPR3 gene, wheat resistance to stripe rust, powdery mildew and leaf rust is enhanced, solving the problem of insufficient wheat disease resistance in existing technologies and providing a solution for broad-spectrum disease-resistant breeding.
Patent Information
- Application Number
- CN202411962691.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2044-12-30
AI Technical Summary
Existing technologies are insufficient to effectively improve wheat resistance to stripe rust, powdery mildew, and leaf rust, and there is a lack of broad-spectrum disease-resistant gene resources.
By utilizing the wheat salicylic acid receptor NPR3 gene and its encoded protein, the disease resistance of wheat can be enhanced through gene editing or knockout of the NPR3 gene.
To improve wheat's resistance to stripe rust, powdery mildew, and leaf rust, and to provide theoretical guidance and genetic resources for broad-spectrum disease-resistant breeding.
Smart Images

Figure CN119776373B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant genetic engineering technology, and in particular to a wheat salicylic acid receptor NPR3 gene and its application in wheat disease resistance. BACKGROUND
[0002] Wheat is one of the most important crops in the world and China, with a planting area second only to corn and rice, providing food for about 35% of the world's population. Ensuring the safe and efficient production of wheat is crucial to global food and nutrition security. However, several serious fungal diseases continue to and frequently harm the yield and quality of wheat during its growth, posing a serious challenge to the safe production of wheat. These include stripe rust caused by Puccinia striiformis f. sp. tritici, leaf rust caused by Puccinia recondita f. sp. tritici, and powdery mildew caused by Blumeria graminis f. sp. tritici. Planting wheat varieties with resistance is a very effective, economical, and environmentally friendly measure to prevent disease.
[0003] Disease-susceptible genes encode proteins that help pathogens recognize, invade, reproduce, and spread within host cells, and have a negative regulatory effect on plant immunity. They can be divided into two categories: one is a positive regulator of pathogen infection, which can be hijacked by pathogen effectors to suppress immune response or promote pathogen infection; the other is a negative regulator of plant immune response. Editing or knocking out disease-susceptible genes can enhance the potential of plant broad-spectrum disease resistance, so disease-susceptible genes are considered to be used instead of disease-resistant genes for plant disease resistance breeding. The typical disease-susceptible gene is the MLO gene, which is highly conserved in higher plants. Mutating the MLO gene can confer broad-spectrum resistance to powdery mildew in wheat, barley, and tomato plants. A recent major discovery showed that inactivating the cytoplasmic receptor kinase gene TaPsIPK1, wheat has resistance to multiple physiological races of Puccinia striiformis without affecting important agronomic traits. This gene is the first disease-susceptible gene hijacked by pathogen effectors, and the pathogenicity protein PsSpg1 of Puccinia striiformis binds to TaPsIPK1, enhancing its phosphokinase activity and nuclear localization. TaPsIPK1 binds and phosphorylates TaCBF1d in the nucleus, mediating wheat susceptibility to stripe rust. Obtaining more genes that can enhance plant resistance to pathogens is of great significance for wheat disease resistance breeding. SUMMARY
[0004] The purpose of the present application is to provide a wheat salicylic acid receptor NPR3 gene and its application in wheat disease resistance, to solve the problems existing in the prior art. The salicylic acid receptor NPR3 gene can be used for broad-spectrum resistance breeding of wheat.
[0005] To achieve the above purpose, the present application provides the following solutions:
[0006] Technical solution one: application of wheat salicylic acid receptor NPR3 gene or its related biological material, for the application of any one of the following:
[0007] A1, improving the resistance of wheat to stripe rust;
[0008] A2, improving the resistance of wheat to powdery mildew;
[0009] A3, improving the resistance of wheat to leaf rust;
[0010] The nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO. 3.
[0011] Further, the related biological material is a transgenic material comprising the protein encoded by the wheat salicylic acid receptor NPR3 gene and the wheat salicylic acid receptor NPR3 gene.
[0012] Further, the amino acid sequence of the protein encoded by the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO. 4.
[0013] Further, the recombinant vector comprises the wheat salicylic acid receptor NPR3 gene with the sequence shown in SEQ ID NO. 3.
[0014] Further, the recombinant microorganism comprises the wheat salicylic acid receptor NPR3 gene with the sequence shown in SEQ ID NO. 3.
[0015] Technical solution two: a knockout material for editing wheat salicylic acid receptor NPR3 gene, the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO. 3.
[0016] Technical solution three: application of the knockout material in improving the resistance of wheat to stripe rust, powdery mildew and leaf rust.
[0017] Technical solution four: a method for improving the resistance of wheat to stripe rust, powdery mildew and leaf rust, comprising the step of blocking or inhibiting the expression of NPR3 gene, the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO. 3.
[0018] Technical solution five: a method for breeding wheat strains resistant to stripe rust, powdery mildew and leaf rust, comprising the steps of knocking out the wheat salicylic acid receptor NPR3 gene, and breeding wheat strains resistant to stripe rust, powdery mildew and leaf rust, the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO. 3.
[0019] The present application discloses the following technical effects:
[0020] This invention involves homologous cloning of the NPR3 gene from Urartu wheat and common wheat materials. Virus-induced gene silencing technology was used to preliminarily verify the resistance of wheat negatively regulated by the NPR3 gene to stripe rust. Further gene editing was used to knock out the NPR3 gene in Fielder, a common hexaploid wheat, to verify its resistance to stripe rust. Stripe rust resistance identification results showed that the NPR3 gene knockout lines were resistant to different stripe rust physiological races CYR17, CYR32, CYR33, and CYR34. Further resistance identification showed that the NPR3 gene knockout lines were resistant to powdery mildew and leaf rust. This invention, by knocking out a susceptible gene, NPR3, confers broad-spectrum resistance to pathogens in wheat, providing theoretical guidance and genetic resources for wheat disease resistance breeding. The salicylic acid receptor NPR3 gene disclosed in this invention can be used for broad-spectrum resistance breeding in wheat and has significant application value. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 To investigate the effect of silencing TuNPR3 with barley mosaic virus in the Urartu wheat material G1812 on resistance to stripe rust fungus CYR34, the following indicators were observed: A: Relative expression levels of the TuNPR3 gene in BSMV:GFP and BSMV:TuNPR3 plants; B: Silencing TuNPR3 enhanced resistance of susceptible material G1812 to stripe rust fungus CYR34; C: Stripe rust biomass in infected leaves of BSMV:TuNPR3 plants was significantly lower than that of BSMV:GFP plants.
[0023] Figure 2 Knocking out the NPR3 gene in the common wheat variety Fielder enhanced its resistance to the stripe rust fungus CYR34. The results show: A: three NPR3 gene mutant sites created through gene editing; B: NPR3 protein accumulation in the three NPR3 gene-edited mutants and wild-type Fielder; C: significantly lower stripe rust biomass in the leaves of NPR3 gene-edited mutants compared to wild-type Fielder; D: growth of stripe rust uredinia on the leaf surface of NPR3 gene-edited mutants and wild-type Fielder.
[0024] Figure 3Knocking out the NPR3 gene enhanced Fielder's resistance to stripe rust fungi CYR17, CYR32, and CYR33;
[0025] Figure 4 To demonstrate that knocking out the NPR3 gene enhances the resistance of Fielder plants to powdery mildew E09, the following data were collected: A: Observation of cell death on the leaf surface of NPR3 gene-edited mutant plants and wild-type Fielder plants 48 h after inoculation with powdery mildew E09; B: Accumulation of H2O2 in the leaves of NPR3 gene-edited mutant plants and wild-type Fielder plants 48 h after inoculation with powdery mildew E09; C: Growth of powdery mildew on the leaf surface of NPR3 gene-edited mutant plants and wild-type Fielder plants.
[0026] Figure 5 Knocking out the NPR3 gene enhanced Fielder's resistance to leaf rust fungus Pt23a. A: Phenotypes of NPR3 gene-edited mutant plants and wild-type Fielder plants after inoculation with leaf rust fungus Pt23a for 14 days. B: Leaf rust biomass in leaves infected by NPR3 gene-edited mutant plants was significantly lower than that in wild-type Fielder plants. Detailed Implementation
[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0028] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0029] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0030] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0031] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0032] Example 1
[0033] Obtaining the NPR3 gene sequence of salicylic acid receptor
[0034] Obtaining the TuNPR3 gene sequence from Urartu wheat: Gene-specific primers were designed based on the CDS sequence TuG1812G0300003503 of G1812 from the Urartu wheat database. The full-length TuNPR3 sequence was obtained by amplifying cDNA samples from leaves of Urartu wheat material G1812. The specific procedure is as follows: Urartu wheat material G1812 (from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture, Henan Agricultural University) was planted in seedling pots at room temperature. After 10 days of growth, leaves were harvested, and RNA was extracted using Trizol reagent and reverse transcribed using First-strand cDNA Synthesis Mix. Then, using FP: 5'-ATGGAGCCGTCGTCGTCC-3' (SEQ ID NO.1) and RF: 5'-TCACTTCATCGCCGAGGACGAG-3' (SEQ ID NO.2) as primers, and G1812 leaf cDNA as a template, PCR amplification was performed using KOD-FX high-fidelity enzyme (amplification program: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 20 s, 58℃ annealing for 15 s, 68℃ extension for 2 min, 35 cycles; 68℃ extension for 10 min). The reaction volume was 50 μL, and its components were: 2 μL cDNA, 1.5 μL 10 μM primer FP, 1.5 μL 10 μM primer RF, 10 μL 2 mM dNTPs, 1 μL KOD-FX Taq (Toyobo), and 25 μL 2×KOD-FX PCR enzyme. The full-length CDS sequence of TuNPR3 was obtained by mixing Buffer and 9 μL ddH2O, as shown in SEQ ID NO.3, and the amino acid sequence it encodes is shown in SEQ ID NO.4.
[0035] SEQ ID NO.3:
[0036]
[0037] SEQ ID NO.4:
[0038] MEPSSSITFASSSSYLSNGSSPCSGALAPLPAADGWGGGGGGGGGGSSSSVEAVSLNRLSSNLERLLLDSELDCSDADVDVADGGPPIPVHRCILAVRSSFFHDLFRARGSRSDGAVTASASATGGGAGGDVNGRPQYKMEDLVPGGRVGREAFLAFMGYLYTGRLRPAPLDVVSCADLVCPHDSCPPAIRFAVELMYAAWTFRIPELMSLFQRRLMNFVDKTLAEDVLPILQVAFHSELTQVREKCVQRIARSDLDILSLDKELPPEIADEIKKIRQKSPPIDGDTIISDPVHEKRVRRIHRALDSDDVELVKLLLNESEITLDDANALHYAAAYCDSKVLTELLGLELANLNLKNSRGYTALHLAAMRREPAIIMCLLSKGAVASQLTDDGRLASNICRRLTRLKDYNAKMEQGQESNKDRMCIDILEREMMRNPMTAEDSVTSPLLADDLHMKLSYLENRVAFARLFFPAEAKVAMQIAQADVTPEVGGFSAASTSGKLREVDLNETPVTKNKRLRSRVDALAKTVELGRRYFPNCSQVLDKFLEDGLPDGLDAFQQQSGTPDEQQVKKMRFCEVKENVRKAYSKDTADNSMFSALSSNSSSSAMK*。
[0039] This invention further transfers the NPR3 gene into common susceptible wheat (Fielder) (from the Crop Genomics and Molecular Breeding Center Laboratory, College of Agriculture, Henan Agricultural University). The TaNPR3 gene sequence in common wheat (Fielder) was obtained as follows: Gene-specific primers were designed based on the CDS sequences of TraesFLD3A01G330300, TraesFLD3B01G384600, and TraesFLD3D01G334000 from the wheat database. Amplification was performed on cDNA samples from Fielder leaves to obtain the full-length NPR3 sequence. The specific procedure is as follows: Fielder was planted in seedling pots at room temperature. After 10 days of growth, leaves were harvested, RNA was extracted using Trizol reagent, and reverse transcribed using First-strand cDNA Synthesis Mix. Then, using FP: 5'-ATGGAGCCGTCGTCGTCC-3' (SEQ ID NO.5) and RF: 5'-TCACTTCATCGCCGAGGA-3' (SEQ ID NO.6) as primers, and Fielder leaf cDNA as a template, PCR amplification was performed using KOD-FX high-fidelity enzyme (amplification program: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 20 s, 58℃ annealing for 15 s, 68℃ extension for 2 min, 35 cycles; 68℃ extension for 10 min). The reaction volume was 50 μL, and its components were 2 μL cDNA, 1.5 μL 10 μM primer FP, 1.5 μL 10 μM primer RF, 10 μL 2 mM dNTPs, 1 μL KOD-FX Taq (Toyobo), 25 μL 2×KOD-FX PCR Buffer, and 9 μL... The full-length CDS sequence of TaNPR3 was obtained by ddH2O, ligated into the pEASY-Blunter vector, and sequenced to obtain the full-length sequence of TaNPR3 in the ABD subgenome of common wheat, as shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, and the encoded amino acid sequences are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12.
[0040] SEQ ID NO.7:
[0041]
[0042] SEQ ID NO.8:
[0043]
[0044] SEQ ID NO.9:
[0045]
[0046] SEQ ID NO.10:
[0047] MEPSSSITFASSSSYLSNGSSPCSGALAPLPAADGWGGGGGGGGGGSSSSVEAVSLNRLSSNLERLLLDSELDCSDADVDVADGGPPIPVHRCILAVRSSFFHDLFRARGSRSDGAVTASASATGGGAGGDVNGRPQYKMEDLVPGGRVGREAFLAFMGYLYTGRLRPAPLDVVSCADLVCPHDSCPPAIRFAVELMYAAWTFRIPELMSLFQLQARNVRLMRRLMNFVDKTLAEDVLPILQVAFHSELTQVREKCVQRIARSDLDIMSLDKELPPEIADEIKKIRQKSPPIDGDTIISDPVHEKRVRRIHRALDSDDVELVKLLLNESEITLDDANALHYAAAYCDSKVLTELLGLELANLNLKNSRGYTALHLAAMRREPAIIMCLLSKGAVASQLTDDGRLASNICRRLTRLKDYNAKMEQGQESNKDRMCIDILEREMMRNPMTAEDSVTSPLLADDLHMKLSYLENRVAFARLFFPAEAKVAMQIAQADVTPEVGGFSAASTSGKLREVDLNETPVTKNKRLRSRVDALAKTVELGRRYFPNCSQVLDKFLEDGLPDGLDAFQQQSGTPDEQQVKKMRFCEVKEDVRKAYSKDTADNSMFSALSSNSSSSAMK;
[0048] SEQ ID NO.11:
[0049] ;
[0050] SEQ ID NO.12:
[0051] *
[0052] Example 2: Functional verification of the salicylic acid receptor NPR3 gene in wheat resistance to stripe rust.
[0053] The function of the NPR3 gene was verified by the VIGS assay. First, a 135bp sequence (SEQ ID NO.15) was reverse-engineered into the RNA γ chain of barley mosaic virus using primers NPR3-VIGS (SEQ ID NO.13 and SEQ ID NO.14) to form the recombinant plasmid BSMV:NPR3. Then, the NPR3 fragment was introduced into wheat leaves using barley mosaic virus.
[0054] SEQ ID NO.13:
[0055] GATTCTTCTTCCGTTGCTAGCCCTTCCTAGCGTTCATGGGGTACCT;
[0056] SEQ ID NO.14:
[0057] TTTTTTTTTTTTAGCTAGCACATGAGCTCGACGGCGAACCTGAT;
[0058] SEQ ID NO.15:
[0059] CCTTCCTAGCGTTCATGGGGTACCTCTACACGGGCAGGCTCCGGCCGGCGCCGCTG GACGTGGTGTCATGTGCTGATCTTGTGTGCCCGCACGACTCGTGCCCGCCGGCTATCAG GTTCGCCGTCGAGCTCATGT.
[0060] During the one-leaf-one-heart stage of wheat, the recombinant viral vector BSMV:NPR3 and the control viral vector BSMV:GFP were respectively inoculated by friction onto the second leaf of 15 G1812 plants. On the 14th day after inoculation, RNA was extracted from the fourth leaf to detect the silencing efficiency of the NPR3 gene. Plants with successful silencing were inoculated with stripe rust fungus CYR34 (from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture, Henan Agricultural University). Disease resistance phenotypes were observed 14 days after inoculation, and fungal biomass was measured. The specific method for measuring fungal biomass was as follows: DNA was extracted from infected leaves 14 days after inoculation and amplified by qRT-PCR (primers: TaEF1a FP: 5'-TGGTGTCATCAAGCCTGGTATGGT-3' (SEQ ID NO.16), RP1: ACTCATGGTGCATCTCAACGGACT (SEQ ID NO.17); PsEF1 FP: 5'-TTCGCCGTCCGTGATATGAGACAA-3' (SEQ ID NO.18), RP2: 5'-ATGCGTATCATGGTGGTGGAGTGA-3' (SEQ ID NO.19). The amplification program was: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 20 s, for 40 cycles. The reaction volume was 10 μL, consisting of 1 μL genomic DNA and 10 μM primers TaEF1a. 0.2 μL each of FP, PsEF1, RP1, and RP2, 5 μL of Taq SYBR·@Green qPCR premix (Lambolid), and 3.6 μL of ddH2O were added. Stripe rust biomass was calculated as the relative value of stripe rust elongation factor (PsEF1) to wheat elongation factor (TaEF1a). The results showed that transient silencing of the NPR3 gene in the G1812 material enhanced the resistance of G1812 to stripe rust CYR34. Figure 1 ).
[0061] This invention utilizes gene editing technology to simultaneously knock out three TaNPR3 homologous genes in Fielder wheat. First, sgRNAs were designed based on the full-length CDS sequence of TaNPR3, and primers SEQ ID NO.20 and SEQ ID NO.21 were synthesized and ligated into the gene editing vector PLH3.
[0062] SEQ ID NO.20:
[0063] AGCACTCGTCCCAGGTGGCCGTGT;
[0064] SEQ ID NO.21:
[0065] AAACACACGGCCACCTGGGACGAG.
[0066] The pLH3 vector containing the TaNPR3 gene sgRNA was introduced into common wheat Fielder via Agrobacterium-mediated transformation, resulting in transgenic plants with simultaneous TaNPR3 gene editing in three locations. The TaNPR3 gene editing sites in the transgenic plants were verified by PCR sequencing. Three stable homozygous positive editing lines, tanpr3, were obtained. fld -a1b1d1-1,tanpr3 fld -a1b1d1-2 and tanpr3 fld -a1b1d1-3 and the control Fielder were grown in a greenhouse under 16 hours of light and 8 hours of darkness at 22°C for 10 days. They were then inoculated with stripe rust fungus CYR34. After 14 days, the disease resistance phenotype and stripe rust biomass were observed. The results showed that knocking out the TaNPR3 gene enhanced Fielder's resistance to stripe rust fungus CYR34. Figure 2 ).
[0067] To verify the function of the salicylic acid receptor NPR3 gene in wheat resistance to multiple physiological races of stripe rust, the homozygous positive edited line tanpr3 was used. fld -a1b1d1-1,tanpr3 fld Fielder strains -a1b1d1-2 and the control were grown in a greenhouse under a 16-hour light-8-hour dark environment at 22°C for 10 days. They were then inoculated with stripe rust fungi CYR17 (from the stripe rust inoculation laboratory of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences), CYR32 (from the stripe rust inoculation laboratory of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences), and CYR33 (from the stripe rust inoculation laboratory of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences). After 14 days, the resistance phenotype was observed. The results showed that knocking out the TaNPR3 gene enhanced the resistance of Fielder strains to stripe rust fungi CYR17, CYR32, and CYR33. Figure 3 ).
[0068] Example 3: The role of the salicylic acid receptor NPR3 gene in broad-spectrum disease resistance in wheat.
[0069] To verify the role of the salicylic acid receptor NPR3 gene in broad-spectrum disease resistance in wheat, TaNPR3-edited lines were inoculated with powdery mildew E09 (from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture, Henan Agricultural University) and leaf rust Pt23a (from the Zheng Wenming Laboratory of the College of Life Sciences, Henan Agricultural University) for disease resistance phenotype identification.
[0070] To verify the role of the salicylic acid receptor NPR3 gene in wheat resistance to powdery mildew, the homozygous positive edited line tanpr3 was used. fld -a1b1d1-1,tanpr3 fld -a1b1d1-2,tanpr3 fld -a1b1d1-3 and the control Fielder were grown in a greenhouse under a 16-hour light-8-hour dark environment at 22°C for 10 days. They were then inoculated with powdery mildew E09. Samples were taken 48 hours after inoculation. Mycelial growth and development were observed using Coomassie brilliant blue staining, cell death was observed using trypan blue staining, and hydrogen peroxide accumulation was observed using DAB staining. The results showed that compared to wild-type Fielder, the edited strain tanpr3... fld -a1b1d1-1,tanpr3 fld -a1b1d1-2,tanpr3 fld In leaves infected with the -a1b1d1-3 gene, mycelial growth was slower, showing more area of cell death and greater hydrogen peroxide accumulation. Phenotypic observation 7 days after inoculation showed that the TaNPR3 gene knockout line had fewer spores on the leaf surface and was more resistant to disease. Figure 4 ).
[0071] To verify the role of the salicylic acid receptor NPR3 gene in wheat resistance to leaf rust, the homozygous positive edited line tanpr3 was used. fld -a1b1d1-1,tanpr3 fld -a1b1d1-2,tanpr3 fld -a1b1d1-3 and the control Fielder were grown in a greenhouse under a 16-hour light-8-hour dark environment at 22°C for 10 days. They were then inoculated with leaf rust fungus Pt23a. After 14 days, the biomass and phenotypic characteristics of the leaf rust fungus were measured. The results showed that knocking out the TaNPR3 gene enhanced the resistance of Fielder to leaf rust fungus Pt23a. Figure 5 ).
[0072] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of the NPR3 gene in improving wheat resistance to stripe rust, powdery mildew, and leaf rust, characterized in that, The nucleotide sequence of the NPR3 gene is shown in SEQ ID NO.3; By knocking out the NPR3 gene, wheat lines resistant to stripe rust, powdery mildew, and leaf rust were bred.
2. A method for improving the resistance of wheat to stripe rust, powdery mildew, and leaf rust, characterized in that, This includes knocking out or inhibiting the expression of the NPR3 gene in wheat, the nucleotide sequence of which is shown in SEQ ID NO.
3.
3. A method for breeding wheat lines resistant to stripe rust, powdery mildew, and leaf rust, characterized in that, This includes knocking out the NPR3 gene in wheat to breed wheat lines resistant to stripe rust, powdery mildew, and leaf rust, wherein the nucleotide sequence of the NPR3 gene is shown in SEQ ID NO.3.