Method for promoting development of xylem in poplar by increasing expression of pagbeh3b gene in poplar
By increasing the expression of the PagBEH3b gene in poplar and utilizing biological materials such as promoters and terminators, the development of poplar lignite was promoted, solving the problem of insufficient timber yield and achieving a significant increase in timber yield and plant height.
Patent Information
- Application Number
- CN202411967883.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2044-12-30
AI Technical Summary
Existing technologies are insufficient to effectively address timber consumption and cannot improve poplar wood development, resulting in insufficient timber production.
By increasing the expression of the PagBEH3b gene in poplar, the development of the xylem in poplar can be promoted. The PagBEH3b protein and its related biological materials and plant reagents, including promoters, terminators, and enhancers, are introduced into poplar for gene modification and expression, thereby promoting xylem development and increasing yield.
It significantly improves the xylem development rate and plant height of poplar trees, increases timber production, provides a new means of forest tree genetic engineering, and solves the contradiction between timber supply and demand.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, and relates to a method for promoting xylem development in poplar by increasing expression of a gene in poplar. PagBEH3b TECHNICAL FIELD BACKGROUND
[0002] With the rapid economic development, the consumption of wood is continuously increasing, and the demand for wood is dramatically increasing, and the wood safety problem is increasingly prominent, and it is urgent to create new germplasm of fast-growing high-yield plantations through modern biological breeding technology to alleviate the contradiction between supply and demand of wood and guarantee the national wood safety. Molecular design breeding technology is developing rapidly, but the selection of target genes requires very high, and the selection of genes that play a key role in the regulation process of wood formation and have a thorough mechanism contributes to improving the success rate of molecular design breeding of fast-growing high-yield plantations.
[0003] The formation of wood is mainly derived from the annual accumulation of secondary xylem, and the development of secondary xylem is affected by the synergistic effect of multiple external environmental factors and endogenous hormones, and brassinosteroids have an important influence on the development of secondary xylem. Previous studies have shown that brassinosteroids can promote the thickening of secondary xylem. BEH is a key factor in the brassinosteroid signaling pathway, and regulates many downstream genes. Using the model woody plant poplar, the molecular mechanism of BEH regulating secondary xylem is studied, and the target gene regulating wood yield is locked, which is of great significance for molecular design breeding of fast-growing high-yield poplar. SUMMARY
[0004] The technical problem to be solved by the present application is how to promote the development of xylem in poplar and thereby increase the yield of poplar.
[0005] In order to solve the above technical problem, the present application provides a method for promoting the development of xylem in poplar and / or increasing the height of poplar and / or increasing the yield of poplar by increasing the expression of a gene in poplar. PagBEH3b PagBEH3b The gene is a gene encoding a PagBEH3b protein, and the PagBEH3b protein is a protein of A1, A2 or A3 as follows:
[0006] A1, the amino acid sequence is a protein of SEQ ID No. 2 in the sequence listing;
[0007] A2, a protein obtained by substitution, deletion and / or addition of one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, which has more than 80% identity with the protein shown in A1 and is functionally similar;
[0008] A3, a fusion protein obtained by connecting a protein tag to the N-terminal or / and C-terminal of A1 or A2.
[0009] In the above method, SEQ ID No. 2 in the sequence listing consists of 333 amino acid residues.
[0010] In the above method, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using the homology search site on the Internet, such as the BLAST page of the NCBI homepage website. For example, the identity of a pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and performing a search in Advanced BLAST 2.1, and then the value of the identity (%) can be obtained.
[0011] In the above method, the identity of more than 80% can be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100%.
[0012] In the above method, the PagBEH3b protein can be derived from poplar.
[0013] In the above method, the PagBEH3b The gene can be a nucleic acid molecule encoding the coding sequence of the coding strand, which is SEQ ID No. 1 in the sequence listing.
[0014] In the above method, the step of introducing the PagBEH3b introducing the gene into a recipient poplar to obtain a poplar with accelerated xylem development and / or a poplar with increased height and / or a poplar with increased yield; the xylem development speed of the poplar with accelerated xylem development is higher than that of the recipient poplar; the height of the poplar with increased height is higher than that of the recipient poplar; the yield of the poplar with increased yield is higher than that of the recipient poplar.
[0015] In the above method, the PagBEH3b The gene can be modified before being introduced into the recipient poplar to achieve better expression effect:
[0016] 1) modifying the gene sequence adjacent to the initial methionine to enable effective translation initiation; for example, using a known effective sequence in plants for modification;
[0017] 2) linked to a variety of plant-expressible promoters to facilitate expression in plants; the promoters can include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters; the choice of promoter will vary with the temporal and spatial needs of expression and will also depend on the target species; for example, tissue- or organ-specific expression promoters, depending on what stage of development the desired recipient is at; ideally, dicot promoters are selected for expression in dicots and monocot promoters are selected for expression in monocots; in one embodiment of the present application, the 35S promoter is used to drive PagBEH3b the gene;
[0018] 3) linked to a suitable transcription terminator, which can also increase the efficiency of expression of the gene of the present application; for example, tml from CaMV, E9 from rbcS; any available terminator known to function in plants can be linked to the gene of the present application;
[0019] 4) introduction of enhancer sequences, such as intron sequences (for example, from Adhl and bronze 1) and viral leader sequences (for example, from TMV, MCMV and AMV).
[0020] The PagBEH3b The gene can be introduced into plant cells by using Ti plasmids, plant viral vectors, direct DNA transformation, microinjection, electroporation and other conventional biotechnological methods (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).
[0021] In the above method, the poplar with enhanced xylem development and / or increased height and / or increased yield can be a transgenic poplar or a poplar obtained by conventional breeding techniques such as crossing.
[0022] The present application also provides a protein, which is the PagBEH3b protein.
[0023] The present application also provides a biological material related to the PagBEH3b protein, which also falls within the protection scope of the present application.
[0024] The biological material related to the PagBEH3b protein provided by the present application is any one of the following B1 to B5:
[0025] B1. A nucleic acid molecule encoding a PagBEH3b protein;
[0026] B2. An expression cassette comprising the nucleic acid molecule of B1;
[0027] B3. A recombinant vector comprising the nucleic acid molecule of B1, or a recombinant vector comprising the expression cassette of B2;
[0028] B4. A recombinant microorganism comprising the nucleic acid molecule of B1, or a recombinant microorganism comprising the expression cassette of B2, or a recombinant microorganism comprising the recombinant vector of B3;
[0029] B5. A transgenic plant cell line comprising the nucleic acid molecule of B1, or a transgenic plant cell line comprising the expression cassette of B2, or a transgenic plant cell line comprising the recombinant vector of B3.
[0030] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; or the nucleic acid molecule can be RNA, such as mRNA or hnRNA, etc.
[0031] In the above biological materials, the nucleic acid molecule of B1 is the nucleic acid molecule encoding the PagBEH3b gene, specifically, a nucleic acid molecule whose coding sequence of the coding strand is SEQ ID No. 1 in the sequence listing.
[0032] In the above biological materials, the expression cassette of B2 (gene expression cassette) refers to DNA capable of expressing the PagBEH3b gene in a host cell, which can include not only a promoter for initiating transcription of the PagBEH3b gene, but also a terminator for terminating transcription of the PagBEH3b gene. PagBEH3bterminator. Further, the expression cassette can also include an enhancer sequence. Promoters useful in the present application include, but are not limited to, constitutive promoters, tissue, organ, and developmental specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of the cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); the chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); the tomato protease inhibitor II promoter (PIN2) or the LAP promoter (both inducible with jasmonate acid methyl ester); the heat shock promoter (U.S. Patent 5,187,267); the tetracycline inducible promoter (U.S. Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1 0099169.7), the seed storage protein-specific promoters (e.g., the promoters for phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and opine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141 ; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627). 985 ) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141 ; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).
[0033] Existing plant expression vectors can be used to construct structures containing the aforementioned... PagBEH3b Recombinant expression vectors for gene expression cassettes. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pMDC32, pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor, such as Agrobacterium crown gall induction (Ti) plasmid genes (e.g., carmine synthase genes). Nos The untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes, including the HPT gene that confers resistance to the antibiotic hygromycin. hph Genes, and the genes that confer resistance to methatrexate dhfr Genes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose, can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.
[0034] In the aforementioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.
[0035] In order to solve the above technical problems, the present application further provides a plant reagent for promoting xylem development of poplar and / or increasing yield of poplar and / or increasing plant height of poplar, wherein the active ingredient of the plant reagent is a substance for promoting or increasing the abundance of the PagBEH3b gene, the abundance of the PagBEH3b protein.
[0036] The active ingredient of the plant reagent can further contain other biological components or / and non-biological components, and other active ingredients of the plant reagent can be determined by those skilled in the art according to the effect of promoting xylem development of poplar and / or increasing yield of poplar and / or increasing plant height of poplar.
[0037] The present application further protects the application of the method, the PagBEH3b protein or the biological material in poplar breeding or poplar wood production.
[0038] The present application further protects the application of the plant reagent in poplar wood production.
[0039] The present application takes the silver gland poplar variety 84K as a material, and screens and identifies the PagBEH3b gene, and the phenotype identification of the overexpression plant based on the gene shows that the gene can regulate xylem development of poplar, and indicates that the PagBEH3b gene is a key regulatory factor for regulating xylem development of poplar, provides a new selection for the regulation means of xylem development, and has important application value in the field of forest genetic engineering. BRIEF DESCRIPTION OF DRAWINGS
[0040] Figure 1 is a structural schematic diagram of the plant expression vector pMDC32- PagBEH3b of the present application.
[0041] Figure 2 is a real-time quantitative detection diagram of the transcription level of the transgenic poplar overexpressing the PagBEH3b gene of the present application, wherein ** represents a significant analysis result of P<0.01.
[0042] Figure 3 is a growth diagram of the non-transgenic poplar 84K (WT) and the PagBEH3b transgenic poplar (OE5, OE11, OE17) of the present application, wherein * represents a significant analysis result of P<0.05, and ** represents a significant analysis result of P<0.01.
[0043] Figure 4 is a stem cross-section diagram of the non-transgenic poplar 84K (CK) and the PagBEH3b transgenic poplar (OE5, OE11, OE17) of the present application. DETAILED DESCRIPTION
[0044] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0045] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.
[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0047] The poplar variety 84K described in the following examples is described in the non-patent literature “KNAT2 / 6b, a class I KNOX gene, impedes xylem differentiation by regulating NAC domain transcription factors in poplar. Zhao et al. (2020) New Phytol. 225: 1531-1544.”, which can be obtained from the applicant to repeat the experiments of the present invention.
[0048] Example 1
[0049] I. Cloning PagBEH3b Gene
[0050] With 84K ( P. alba X P. glandulosa Using *Populus alba* as material, total RNA was extracted from one-month-old soil-cultured seedlings using the RNeasy Plant Mini kit and the RNase-free DNase I kit (Qiagen, Hilden, Germany). 1.0 μg of RNA was taken from each sample. The first strand of cDNA was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers (containing start and stop codons) were designed using Primer 5 software based on the published *Populus alba* genome sequence to amplify the full-length gene (GATEWAY adapters were introduced into the primers).
[0051] in, PagBEH3b The forward primer for ORF is PagBEH3b ORF-F, reverse primer is PagBEH3b ORF-R, primer sequences are as follows:
[0052] PagBEH3b ORF-F: 5'- GGGGACAACTTTGTACAAAAAAGTTGGAATGACGTCGGGGACGAGAAT -3' (as shown in SEQ ID No. 3 in the sequence listing, wherein positions 1-28 are GATEWAY adapters, wherein positions 29-48 are identical to the sequence of SEQ ID No. 1 at positions 1-20);
[0053] PagBEH3b ORF-R: 5'- GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTACTATCTGGTACTAGAGTTTC -3' (as shown in SEQ ID No. 4 in the sequence listing, wherein positions 1-35 are GATEWAY adapters, wherein positions 36-55 are the reverse complement of the sequence of SEQ ID No. 1 at positions 983-1002).
[0054] The PCR reaction system was as follows: TaKaRa high-fidelity amplification enzyme mixture PrimeSTAR 12.5 μl, forward primer (10 μM) 1 μl, reverse primer (10 μM) 1 μl, template (84K poplar cDNA) 1 μl, sterile ddH2O supplemented to 25 μl. The reaction program was as follows: pre-denaturation 98℃, 5 min; 98℃, 30 s; 56℃, 30 s; 72℃, 1 min, 10 cycles; 98℃, 30 s; 60℃, 30 s; 72℃, 1 min, 25 cycles; 72℃ 10 min.
[0055] The full-length cDNA sequence of the gene was finally obtained as 1002 bp, named as PagBEH3b The gene is shown in SEQ ID No. 1 in the sequence listing, and the expressed PagBEH3b protein sequence is shown in SEQ ID No. 2 in the sequence listing.
[0056] SEQ ID No. 1
[0057]
[0058] SEQ ID No.2
[0059] MTSGTRMPTWKERENNKRRERRRRAIAAKIYAGLRMYGSYKLPKHCDNNEVLKALCNEAGWTVEEDGTTYRKGCKPVERMDIIGGSASASPCSSYHQSPCASYNPSPASSSFPSPVSSRYAANGNGNVDADANSLIPWLRNLSSGSSSASPKHPNHLFIHTGSISAPVTPPLSSPTARTPRTRNDWDDPAAGQSWMGQNYSFLPSSMPSSTPPSPGRQVLPDSGWLAGIQIPQSGPSSPTFSLVSRNPFGFKEEALSGAGSRMWTPGQSGTCSPAVPAGIDQTADVPMADSMAAEFAFGSNTAGLVKPWEGERIHEECVSDDLELTLGNSSTR
[0060] Two, PagBEH3b Construction of plant expression vector
[0061] The entry vector PDNOR207 is described in the non-patent document “Mechanism of Populus tomentosa Carr. Growth and Development Regulated by KNAT2 / 6b Gene [D]; Zhao, Y. Q.; Chinese Academy of Forestry; 2020”, which is publicly available from the applicant for repeating the experiments of the present application.
[0062] The plant expression vector pMDC32 is described in the non-patent document “KNAT2 / 6b, a class I KNOX gene, impedes xylem differentiation by regulating NAC domain transcription factors in poplar. Zhao et al. (2020) New Phytol. 225: 1531-1544.”, which is publicly available from the applicant for repeating the experiments of the present application.
[0063] Using GATEWAY technology, the construction of PagBEH3b The overexpression vector of the gene: using specific PCR primer pair (consisting of PagBEH3b ORF-F and PagBEH3b ORF-R), 84K cDNA as template, PCR amplification to obtain PagBEH3b Gene ORF (as shown in SEQ ID No. 1 in the sequence listing), and PagBEH3bThe gene ORF was constructed into the entry vector PDNOR207. The reaction system was 80 ng of PCR product; 0.4 μl of pDNOR207 vector; 0.6 μl of BP enzyme (No. invitrogen 11789020); and sterile ddH2O was added to 5 μl. The reaction procedure was 25 °C for 5 h.
[0064] The positive clone was picked from the screening plate and subjected to PCR detection and sequencing verification. The positive clone was subjected to PCR detection and sequencing verification. PagBEH3b The entry vector of the gene was linearized by Mlu I restriction enzyme, and then was constructed into the plant expression vector pMDC32 by the Gateway system.
[0065] The reaction system for the LR reaction was: 50 ng of the linearized pDNOR207 vector of the gene after ligation; 75 ng of the pMDC32 vector; 0.6 μl of LR enzyme (No. invitrogen 11791020); and water was added to 5 μl. The reaction condition was 25 °C for 5 h. PagBEH3b After the LR reaction, PagBEH3b the gene was introduced into the plant expression vector pMDC32 to obtain the overexpression vector (pMDC32- PagBEH3b ). PagBEH3b The strong expression promoter CaMV35S was assembled at the 5' end of the gene, which can make the gene highly expressed in the poplar body. PagBEH3b The strong terminator NOS was assembled at the 3' end of the gene, which can effectively terminate the transcription of the gene. PagBEH3b Figure 1
[0066] As shown in Figure 1, it is the structure of the plant expression vector pMDC32- PagBEH3b in Example 1 of the present application. From the top left, they are the strong terminator NOS, the hygromycin selection marker sequence, the kanamycin selection marker sequence, the replication region sequence of pBR322, the 2x35S strong expression promoter; the hygromycin phosphotransferase HPT was assembled on the vector as a selection marker of the transgenic poplar, and the transgenic poplar can be screened by hygromycin; the LB and RB sequences were assembled on the vector, which promoted the integration of the gene expression frame and the selection marker gene HPT into the poplar receptor chromosome, and the overexpression vector was constructed successfully through PCR detection and sequencing verification, and was named as pMDC32- PagBEH3b . PagBEH3b The gene is located after the promoter 35S and is driven by the promoter 35S, so that the gene can be highly expressed in the poplar body. PagBEH3b PagBEH3b
[0067] Three, PagBEH3b genetic transformation
[0068] The constructed pMDC32- PagBEH3b was transformed into Agrobacterium GV3101 to obtain Agrobacterium GV3101-pMDC32- PagBEH3b The Agrobacterium GV3101-pMDC32- PagBEH3b was used to transform Populus (Populus alba x Populus tremula, 84K, same below) through Agrobacterium mediation, and the specific transformation steps were as follows:
[0069] The hybrid poplar clone 84K used for genetic transformation was cultured under the conditions of culture temperature of 23-25℃, light of 16 / 8h (day / night), and light intensity of 50μM / m 2 / s.
[0070] The Agrobacterium GV3101-pMDC32- PagBEH3b containing the expression vector pMDC32- PagBEH3b was used to infect 84K leaves at OD600=0.6-0.8, and the infected leaves were co-cultured in the dark at a temperature of 23±2℃ for 3 days; the co-cultured leaves were transferred to the SIM containing 3mg / L hygromycin B and 200mg / L Timentin, and were induced and screened for resistant adventitious buds under the conditions of culture temperature of 23-25℃, light of 16 / 8h (day / night), and light intensity of 50μM / m 2 / s.
[0071] The resistant PagBEH3b gene overexpressing 84K poplar and wild type plants were obtained, and the genomic DNA was extracted, and the resistant gene on the expression vector was amplified by PCR, and a clear band was obtained, which was the transgenic plant; the stem segment of the transgenic plant was selected, and the wild type stem segment was used as a control, and the total RNA was extracted and reverse transcribed, and the PagBEH3b-RT- gene quantitative analysis was performed to determine the expression amount of the target gene of the transgenic plant, and the quantitative primer wasPagBEH3b- F (ACCATCAGAGTCCATGTGCA) and RT- Figure 2 R (GTTTGGATGCTTGGGTGAGG).
[0072] As PagBEH3b shown, it is the quantitative detection chart of the transcription level of wild type 84K poplar and the transgenic poplar overexpressing the gene in the embodiment 1 of the present application, wherein, PagBEH3b the expression amount of the gene in the overexpression transgenic plant OE5, the overexpression transgenic plant OE11 and the overexpression transgenic plant OE17 is significantly improved compared with the wild type 84K poplar. The overexpression transgenic plant OE5, the overexpression transgenic plant OE11 and the overexpression transgenic plant OE17 are asexually propagated in the form of tissue culture, and the overexpression transgenic line OE5, the overexpression transgenic line OE11 and the overexpression transgenic line OE17 are obtained. PagBEH3b Four,
[0073] phenotype observation of transgenic plant PagBEH3b The
[0074] overexpression transgenic lines OE5, OE11 and OE17 and the wild type 84K poplar are planted in the greenhouse, and three batches are planted, 6 plants per line per batch, and the phenotypes of the plants in different batches are determined and photographed, as Figure 3 shown, it is the phenotype comparison chart of the wild type 84K poplar and the transgenic poplar overexpressing the gene in the embodiment 1 of the present application, PagBEH3b Figure 3 showing the phenotype photos after two months of transplanting, compared with the non-transgenic 84K poplar plants, the overexpression plants are higher. PagBEH3b Five,
[0075] observation of transgenic poplar xylem section Figure 4 1. Take 0.5 cm long stem segments of the soil culture seedlings at 2 cm above the ground, fix them in the oscillating section machine Leica VT1200S section groove with LOCTITE 495 glue, cut them into 50 μm thick cross-section sections, and store the sections in 70% alcohol.
[0076] 2. Histological staining and photographic observation and analysis: after 0.05% TBO staining of the fresh sections for 1 min, wash with water for three times to remove the floating color and excess dyeing solution, cover with a cover glass, observe and take photos of the TBO stained sections with an Olympus BX51 general optical microscope to analyze the morphological changes of the stem cross section, and the results are shown in
[0077] PagBEH3b as shown, it is the quantitative detection chart of the transcription level of wild type 84K poplar and the transgenic poplar overexpressing the gene in the embodiment 1 of the present application, wherein, PagBEH3b Transgenic poplar xylem tissue section observation; compared with 84K poplar, PagBEH3b The overexpression plant xylem region is widened. PagBEH3b The gene affects the development of the secondary xylem, i.e., the radial growth.
[0078] Phenotype and microscopic morphological observation of the different transgenic lines obtained above found that, PagBEH3b The overexpression line has a significant increase in plant height and a significant widening of the xylem. The above research results prove that, has a key regulatory role in the development of poplar height and xylem, and has important application value in forest molecular breeding and excellent variety breeding.
[0079] The present application has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.
Claims
1. By improving the poplar's... PagBEH3b A method for promoting the development of poplar lignite and / or increasing poplar height by gene expression, characterized in that: The PagBEH3b The gene is the gene encoding the PagBEH3b protein, which is a protein of type A1 or A2 as follows: A1. The amino acid sequence is that of the protein listed as SEQ ID No. 2 in the sequence listing; A2, a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1.
2. The method according to claim 1, characterized in that: The PagBEH3b The coding sequence of the gene is the DNA molecule with SEQ ID No. 1 in the sequence listing.
3. The method according to claim 1 or 2, characterized in that: The method includes... PagBEH3b The steps of introducing genes into recipient poplar trees to obtain poplar trees with accelerated xylem development and / or increased plant height; wherein the xylem development rate of the poplar trees with accelerated xylem development is higher than that of the recipient poplar trees; and the plant height of the poplar trees with increased plant height is higher than that of the recipient poplar trees.
Citation Information
Patent Citations
Seed specificity highly effective promoter and its application
CN101063139A
Seed specific highly effective promoter and its application
CN101063139B
Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells
US5057422A
Plant proteins, promoters, coding sequences and use
US5187267A