Method for improving citrus canker resistance through CsAHL15 gene and application of CsAHL15 gene

Abstract

The invention discloses a method for improving citrus canker resistance through a CsAHL15 gene and application of the CsAHL15 gene, and relates to the field of agricultural biological genes. A method for improving citrus canker resistance through CsAHL15 comprises the following steps that 1, a citrus CsAHL15 coding sequence is cloned, and the CsAHL15 coding sequence is shown as SEQ ID No.1; (2) constructing a CsAHL15 overexpression vector; and (3) CsAHL15 overexpression vector transformation citrus, and identification is carried out to obtain a transgenic plant with improved canker resistance. According to the invention, the citrus CsAHL15 coding sequence is cloned, the overexpression vector is constructed, and then the citrus is transformed, so that the canker attack degree of the obtained transgenic plant can be maximally reduced to 40.09% of that of the existing citrus, the canker attack degree can be obviously reduced, and the scab area can be reduced. In conclusion, the method is a potential biological engineering technology for improving the citrus canker resistance, and has a great value for citrus canker resistance molecular breeding.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological genes, and in particular to a method and application of a CsAHL15 gene to improve resistance to citrus canker. Background Art

[0002] Citrus is the largest fruit in southern my country and an important economic crop in the world. However, citrus canker has seriously hindered the healthy development of the citrus industry (Hu Junhua et al., 2015). Citrus canker is caused by Xanthomonas citrisubsp.citri (Xcc), which originated in India, Java and other places (Hu Junhua et al., 2015). The main citrus producing areas in Fujian, Hunan, Guangdong and other places in my country are seriously affected by citrus canker. The canker bacteria mainly infect citrus leaves, branches, fruits, etc., among which seedlings and young trees are more seriously affected (He Xiuling et al., 2007). Diseased trees will experience leaf fall, dead branches, weak tree vigor and fruit drop, which seriously affects the yield and quality of citrus. There are dozens of Rutaceae plants affected by citrus canker, most of which are economic cultivars. Studies have found that sweet orange is most susceptible to the disease, followed by sour orange and pomelo (Yuan et al., 1997; Li et al., 2013).

[0003] At present, comprehensive prevention and control strategies are usually adopted to control the damage of citrus canker, with chemical control as the main method and biological control as the auxiliary method. However, since chemical control measures are not environmentally friendly, they are very likely to cause environmental pollution, and require a lot of manpower and material resources, and biological control has poor effects and high costs, it is urgent to reduce the losses caused by canker by breeding new disease-resistant varieties (Chen Li et al., 2008; Zhu Xuemei et al., 2017). The long hybrid breeding cycle makes breeding efficiency low. With the rise of molecular biology, people began to study the pathogens themselves and the disease resistance of plants from the direction of disease-resistant genetic engineering. Genetic engineering methods have also been tried in the study of anti-ulcer disease (Duan Minjie et al., 2016; Jia Ruirui et al., 2017), and some transgenic materials resistant to canker disease have been obtained. For example, Chen Shanchun et al. obtained Jincheng, Xinhuicheng and Navelcheng orange lines that were resistant to citrus canker by carrying the antimicrobial peptide D gene of the silkworm (Chen Shanchun et al., 1996); the exogenous genes NLS, chit42, Xa21 and PthA were resistant to citrus canker after being transferred to Bingtangcheng, Ponkan and Sweet Orange (Mendes et al., 2010; Yang et al., 2011); CsBZIP40 is an important transcription factor that responds to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway (Li et al., 2017); the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more sensitive to canker (Li et al., 2014); CRISPR / Cas9 targeted knockout of the promoter of the citrus canker susceptibility gene CsLOB1 can obtain plants with improved resistance to citrus canker (Penget al., 2017).

[0004] The AT-hook motif nuclear localization (AHL) gene family is a highly conserved transcription factor that is essential for plant growth, development, and stress tolerance (Karami O et al., 2023). For example, overexpression of AtAHL15 in Arabidopsis can inhibit plant maturation and senescence (Rahimi A et al., 2023); Brassica rapa BrAHL16 is upregulated 4 hours after drought stress to improve plant tolerance to drought stress (Zhang X et al., 2023); Arabidopsis AtAHL13 knockout mutant plants have reduced ability in pathogen-associated molecular pattern (PAMP)-induced reactive oxygen species production, defense gene expression, and PAMP-induced immunity (Rayapuram Net al., 2021). At present, there is no research and application of using AHL to improve citrus resistance to citrus canker.

[0005] Based on the above situation, it is still necessary to explore the genes closely related to the citrus anti-ulcer disease response pathway in a targeted manner and deeply analyze their functions and molecular mechanisms in order to obtain transgenic citrus strains with significant resistance to ulcer disease. Summary of the invention

[0006] The technical problem to be solved by the present invention is that the existing citrus has poor resistance to ulcer disease, and a new option is provided to improve the resistance of citrus to ulcer disease. The purpose is to provide a method and application of CsAHL15 gene to improve the resistance of citrus to ulcer disease. By integrating a citrus transcription factor encoding gene into citrus through an expression vector, the resistance of citrus to ulcer disease is effectively improved, which has great application value for breeding citrus ulcer disease resistance.

[0007] The present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides an application of overexpressing the CsAHL15 gene to improve resistance to citrus canker, wherein the CsAHL15 gene is a transcription factor containing a DNA-binding hook-based nuclear localization protein.

[0009] As a possible design, the CsAHL15 coding sequence is the nucleotide sequence shown in SEQ ID No.1.

[0010] In a second aspect, the present invention provides a method for improving resistance to citrus canker by using CsAHL15, comprising the following steps:

[0011] (1) cloning the citrus CsAHL15 coding sequence, wherein the CsAHL15 coding sequence is shown in SEQ ID No. 1;

[0012] (2) Construction of CsAHL15 overexpression vector;

[0013] (3) The CsAHL15 overexpression vector was used to transform citrus, and transgenic plants with improved resistance to ulcer disease were obtained through identification.

[0014] As a possible design, in the above step (1), the cloning method of the citrus CsAHL15 coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsAHL15-F and OE-CsAHL15-R to perform PCR amplification and recover the CsAHL15 coding sequence DNA fragment, wherein the primers OE-CsAHL15-F and OE-CsAHL15-R are the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

[0015] As a possible design, in the above step (2), the method for constructing the CsAHL15 overexpression vector is as follows: the CsAHL15 coding sequence DNA fragment recovered by KpnI and EcoRI digestion is ligated to the pLGNe vector recovered by KpnI and EcoRI digestion to construct the overexpression vector pLGNe-CsAHL15.

[0016] As a possible design, in the above step (3), the method for transforming citrus with the CsAHL15 overexpression vector is as follows: the overexpression vector pLGNe-CsAHL15 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

[0017] As a possible design, the transformed citrus explant cells were further identified by GUS staining, PCR, qRT-PCR analysis and CsAHL15 expression to obtain transgenic plants.

[0018] As a possible design, the primers for PCR identification of transgenic plants are: ID-CsAHL15-F and ID-CsAHL15-R, wherein the ID-CsAHL15-F is designed based on the first end sequence of the CsAHL15 gene, and the ID-CsAHL15-R is a sequence taken from the CaMV 35S on the pLGNe vector, and the ID-CsAHL15-F and ID-CsAHL15-R are the nucleotide sequences shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.

[0019] As a possible design, the primers for the above qRT-PCR analysis of CsAHL15 expression are: RT-CsAHL15-F and RT-CsAHL15-R, and the RT-CsAHL15-F and RT-CsAHL15-R are the nucleotide sequences shown in SEQ ID No.6 and SEQ ID No.7, respectively.

[0020] As a possible design, after obtaining the transgenic plants in the above step (3), the resistance of the transgenic plants is evaluated to determine that overexpression of CsAHL15 improves resistance to citrus canker.

[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0022] The present invention clones the citrus CsAHL15 coding sequence, constructs an overexpression vector, and then transforms the citrus. The degree of ulcer disease in the obtained transgenic plants can be reduced to 40.09% of the existing citrus at most, which can significantly reduce the degree of ulcer disease and reduce the area of ​​lesions. In summary, the present invention is a potential bioengineering technology for improving the resistance to citrus ulcer disease, and has great value for molecular breeding of citrus ulcer disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0024] Figure 1 The bioinformatics characteristics of CsAHL15 of the present invention are as follows: A is the chromosome location of the citrus CsAHL15 gene, bp represents base; B is the gene structure of citrus CsAHL15; C is the conserved domain of the citrus CsAHL15 gene, aa represents amino acid;

[0025] Figure 2 The electrophoresis diagram of PCR amplification of CsAHL15 gene clone of the present invention: CDS represents CsAHL15 coding sequence; M represents DNA molecular weight standard, the same below.

[0026] Figure 3 The structure diagram of the CsAHL15 plant overexpression vector of the present invention: GUS represents the β-glucosidase gene; CaMV35S represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the opine synthase gene terminator.

[0027] Figure 4 The figure is a flow chart of citrus genetic transformation according to the present invention.

[0028] Figure 5 This is the GUS staining image of the transgenic plants of the present invention: OE-AHL15-2, OE-AHL15-3, OE-AHL15-4 represent transgenic plants, respectively, and WT represents the wild-type Wanjin Orange plant, the same below.

[0029] Figure 6 This is a PCR identification diagram of the transgenic plant of the present invention, and + represents plasmid pLGNe-CsAHL15.

[0030] Figure 7 This is an analysis diagram of the CsAHL15 expression level in the transgenic plants of the present invention: ** indicates extremely significant difference compared with WT (P=0.01), *** indicates extremely significant difference compared with WT (P<0.001), **** indicates extremely high significant difference compared with WT (P<0.0001), the same below.

[0031] Figure 8 This is a phenotype diagram of the transgenic plant of the present invention.

[0032] Fig. 9This is a symptom picture 10 days after the leaves of the transgenic plants of the present invention were inoculated with ulcer pathogens.

[0033] Fig.10 This is a statistical diagram of the size of lesions on the leaves of the transgenic plants of the present invention 10 days after being inoculated with canker bacteria.

[0034] Fig.11 This is a statistical graph of the disease index 10 days after the leaves of the transgenic plants of the present invention were inoculated with canker bacteria. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with examples and drawings. The illustrative embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention. If specific conditions are not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0036] It should be noted that: the embodiment of the present invention uses Wanjin orange as the test object. In practical applications, the method can also be used to improve the resistance of other citrus varieties to ulcer disease.

[0037] The following examples refer to Figure 4 Flowchart of genetic transformation of citrus.

[0038] Example 1

[0039] Bioinformatics Analysis of Citrus CsAHL15 Gene

[0040] The citrus CsAHL15 gene is located between 833846bp and 836675bp on chromosome 7 of citrus. The chromosome is 2.83Kbp long, and the CDS sequence is 1017bp long, encoding 338 amino acids. Analysis of the protein sequence showed that there is an obvious PPC structural functional domain (refer to Figure 1 ).

[0041] The CsAHL15 gene has a nucleotide sequence shown in SEQ ID NO: 1 (CsAHL15 CDS sequence, ATG to stop codon), which is as follows:

[0042]

[0043] Example 2

[0044] Cloning of the coding sequence of Citrus CsAHL15

[0045] 1. RNA Extraction and cDNA Synthesis

[0046] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0047] 2. PCR amplification of CsAHL15 coding sequence

[0048] The CsAHL15 coding sequence was amplified from citrus cDNA using primers OE-CsAHL15-F (SEQ ID No. 2), OE-CsAHL15-R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTARMaxDNAPolymerase (TaKaRa, CAT: R045Q) to obtain a DNA fragment with a length of 1017 bp (refer to Figure 2 ), the amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsAHL15 gene (SEQ ID No. 1). Under ultraviolet light, a clean blade was used to cut out the agarose gel block containing the target fragment, and a kit (BioFlux, CAT: BSC02M1) was used to recover the DNA fragment.

[0049] PCR amplification program: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0050] The nucleotide sequence of primer OE-CsAHL15-F is shown in SEQ ID No.2 (including restriction enzyme cleavage site), which is as follows:

[0051] GGTACCATGGCTAATCGATGGTGGGC

[0052] The nucleotide sequence of primer OE-CsAHL15-R is shown in SEQ ID No. 3 (including restriction site and 3×flag tag sequence), which is as follows:

[0053] GAATTCTTACTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCCTT ATCATCATCATCCTTGTAATCGTTAAACGGAGGTGGTCGAGG

[0054] Example 3

[0055] Construction of CsAHL15 overexpression vector and transformation of Agrobacterium

[0056] 1. Construction of overexpression vector

[0057] The CsAHL15 coding sequence DNA fragment and the overexpression vector pLGNe were double digested with restriction endonucleases KpnI and EcoRI (ThermoFisher), recovered from the gel and ligated overnight at 16°C using T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsAHL15 overexpression vector pLGNe-CsAHL15 (refer to Figure 3 ).

[0058] 2. Transformation of Agrobacterium with Overexpression Vector

[0059] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, blow and mix, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the pre-dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, blow and mix with a pipette, transfer to a sterile centrifuge tube, and shake and culture at 260 r / min and 28°C for 60 minutes; centrifuge the bacterial solution at 10000 r / min for 1 minute, discard the supernatant (about 100 μL of resuspended bacteria remain), resuspend and spread, and incubate in the dark at 28°C for 2 days; after the growth of plaques, use primers OE-CsAHL15-F (SEQ ID PCR verification was performed on single colonies.

[0060] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0061] Example 4

[0062] Genetic transformation of citrus with CsAHL15 overexpression vector

[0063] according to Figure 4 The process shown in the figure is used for citrus genetic transformation. The specific operations are as follows:

[0064] 1. Obtaining epicotyls of citrus seedlings

[0065] Fresh citrus fruits were washed and surface disinfected with 70% alcohol. The seeds were taken out under sterile conditions, the seed coats were peeled off, and the seeds were germinated on seed germination medium. The seeds were cultured in the dark at 28°C for 2 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were taken under sterile conditions and cut into 1 cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0066] 2. Preparation of Agrobacterium tumefaciens

[0067] Before transfection, streak the Agrobacterium (containing the pLGNe-CsAHL15 vector) for transfection on LB solid medium containing 50 mg / L kanamycin; pick a single colony and inoculate it into 25 mL LB liquid medium containing the same antibiotics, and culture it at 28°C with shaking overnight; dilute the bacterial solution to OD=0.1 and continue to culture it to OD=0.5, centrifuge it at 5000r / min for 10 min, discard the supernatant, and resuspend it in MS liquid medium at pH5.4 for transfection.

[0068] 3. Transformation of Citrus Epicotyls

[0069] Soak the citrus epicotyl stem segments in Agrobacterium solution for 13 minutes and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 26°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and then identify them by GUS staining.

[0070] 4. Seedling Culture of Transformants

[0071] When the seedlings grow to more than 1 cm, they are cut and grafted onto late orange seedlings in sterile test tubes and cultured in seedling medium; when the seedlings grow to about 5 cm, they are grafted onto citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0072] The culture medium used in this embodiment is as follows:

[0073] Seed germination medium: MS + 30g / L sucrose + 2.5g / L Gelrite, PH 5.8.

[0074] Co-culture medium: MS+2mg / L BA+0.5mg / L IAA+1mg / L 2,4–D+100μmolAS+30g / L sucrose+2.5g / L Gelrite, PH 5.8.

[0075] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0076] Seedling medium: MS + 30g / L sucrose, PH 5.8.

[0077] Example 5

[0078] Verification of CsAHL15 overexpressing transgenic plants

[0079] 1. GUS staining identification of transgenic plants

[0080] The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed blue color, while the leaf discs of the WT plants did not show color (refer to Figure 5 ).

[0081] 2. PCR Identification of Transgenic Plants

[0082] 100 mg of leaves from transgenic plants were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsAHL15 coding sequence in the citrus genome. The detection primers were ID-CsAHL15-F (SEQ ID No. 4) and ID-CsAHL15-R (SEQ ID No. 5). A 1051 bp amplified fragment was obtained from positive plants, while no amplification was obtained from WT plants (refer to Figure 6 ).

[0083] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0084] 3. qRT-PCR Analysis of Transgenic Plants

[0085] Total RNA (Aidelai, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsAHL15-F (SEQ ID No. 6) and RT-CsAHL15-R (SEQ ID No. 7). -△△Ct The relative expression of CsAHL15 gene in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, i.e., its CsAHL15 expression level was 1, and then the multiple of the gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. The results showed that the CsAHL15 gene was expressed at a higher level in transgenic plants than in wild-type plants (the lowest was more than 143 times that of the control) (refer to Figure 7 ).

[0086] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0087] 4. Phenotypic observation of transgenic plants

[0088] The phenotypes of the 3 transgenic plants were observed and analyzed, and no obvious abnormalities were found in their appearance and growth (refer to Figure 8 ). This indicates that overexpression of the CsAHL15 gene did not have a significant effect on the phenotype and development of the plant.

[0089] The nucleotide sequence of primer ID-CsAHL15-F is shown in SEQ ID No. 4 (primer ID-CsAHL15-F designed in CDS before PCR identification of transgenic plants), and is as follows:

[0090] GGTGGGCTGGAAATATAGCAATG

[0091] The nucleotide sequence of primer ID-CsAHL15-R is shown in SEQ ID No. 5 (primer ID-CsAHL15-R after PCR identification of transgenic plants, designed after CaMV 35S), and is as follows:

[0092] TCATAGGCGTCTCGCATATCTCATT

[0093] The nucleotide sequence of primer RT-CsAHL15-F is shown in SEQ ID No.6 (pre-primer RT-CsAHL15-F for RT-PCR identification of transgenic plants, designed in CDS), and is as follows:

[0094] ACCGCCACTCACCAAAATCA

[0095] The nucleotide sequence of primer RT-CsAHL15-R is shown in SEQ ID No.7 (primer RT-CsAHL15-R after RT-PCR identification of transgenic plants, designed in CDS), and is as follows:

[0096] TTGGCAATGCTCTCGACGAT

[0097] Example 6

[0098] Resistance evaluation of CsAHL15 overexpressing transgenic plants

[0099] The mature leaves of the transgenic plants were washed, disinfected with 75% alcohol, rinsed with sterile water, and placed on a clean bench. The veins were punctured with needles, and the ulcer pathogen liquid was applied with a pipette. 1 μL (1X 10 5 CFU / mL); cultured in a 28°C constant temperature and light incubator (16 h light / 8 h dark); photos were taken 10 days after the leaves were spotted with bacteria, and the lesion area was counted using Image J V1.47 software.

[0100] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm 2 ), Level 1 (0.25mm 2 <R≤0.5mm 2 ), Level 2 (0.5mm 2 <R≤0.75mm 2 ), Level 3 (0.75mm 2 <R≤1mm 2 ), 4 levels (1.0mm 2 <R≤1.25mm 2 ), 5 levels (1.25mm 2 <R≤1.5mm 2 ), 6 levels (1.5mm 2 <R≤1.75mm 2 ), 7th level (R>1.75mm 2 ); calculate the disease index according to the formula: DI = 100XΣ [number of lesions at each level X corresponding level value] / (total number of lesions X maximum level).

[0101] The results showed that 10 days after inoculation with the ulcer pathogen, the overexpression plants and the WT plants grafted at the same time developed disease to varying degrees, and there were certain differences in the size of the lesions (refer to Fig. 9). According to statistics and analysis, the lesion area of ​​transgenic plants was significantly smaller than that of wild-type controls, ranging from 40.09% to 46.64% of the controls (refer to Fig.10 The disease index of transgenic plants was significantly lower than that of wild-type controls, ranging from 37.08% to 46.25% of the controls (refer to Fig.11 ). It can be seen that overexpression of CsAHL15 can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus bacterial canker.

[0102] It can be seen that overexpression of CsAHL15 can greatly reduce the lesion area of ​​ulcer disease and alleviate the severity of ulcer disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for molecular breeding of citrus ulcer disease resistance.

[0103] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of overexpressing CsAHL15 gene to improve resistance to citrus canker, characterized in that: The CsAHL15 gene is a transcription factor containing a DNA-binding hook-based nuclear localization protein.

2. The use of overexpressing CsAHL15 gene to improve resistance to citrus canker according to claim 1, characterized in that: The CsAHL15 coding sequence is the nucleotide sequence shown in SEQ ID No.

1.

3. A method for improving resistance to citrus canker disease using CsAHL15, characterized in that: The steps include: (1) cloning the citrus CsAHL15 coding sequence, wherein the CsAHL15 coding sequence is shown in SEQ ID No. 1; (2) Construction of CsAHL15 overexpression vector; (3) The CsAHL15 overexpression vector was used to transform citrus, and transgenic plants with improved resistance to ulcer disease were obtained through identification.

4. The method for improving resistance to citrus canker by using CsAHL15 according to claim 3, characterized in that: In step (1), the cloning method of the citrus CsAHL15 coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsAHL15-F and OE-CsAHL15-R to perform PCR amplification and recover the CsAHL15 coding sequence DNA fragment, wherein the primers OE-CsAHL15-F and OE-CsAHL15-R are the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

5. The method for improving resistance to citrus canker using CsAHL15 according to claim 3, characterized in that: In step (2), the method for constructing the CsAHL15 overexpression vector is as follows: the CsAHL15 coding sequence DNA fragment recovered by KpnI and EcoRI digestion is ligated to the pLGNe vector recovered by KpnI and EcoRI digestion to construct the overexpression vector pLGNe-CsAHL15.

6. The method for improving resistance to citrus canker by using CsAHL15 according to claim 3, characterized in that: In step (3), the method for transforming citrus with the CsAHL15 overexpression vector is as follows: the overexpression vector pLGNe-CsAHL15 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

7. The method for improving resistance to citrus canker using CsAHL15 according to claim 6, characterized in that: The transformed citrus explant cells are further subjected to GUS staining identification, PCR identification, qRT-PCR analysis and CsAHL15 expression analysis to obtain transgenic plants.

8. The method for improving resistance to citrus canker using CsAHL15 according to claim 7, characterized in that: The primers for PCR identification of transgenic plants are: ID-CsAHL15-F and ID-CsAHL15-R, wherein the ID-CsAHL15-F is designed based on the first end sequence of the CsAHL15 gene, and the ID-CsAHL15-R is a sequence taken from the CaMV 35S on the pLGNe vector, and the ID-CsAHL15-F and ID-CsAHL15-R are the nucleotide sequences shown in SEQ ID No.4 and SEQ ID No.5, respectively.

9. The method for improving resistance to citrus canker using CsAHL15 according to claim 7, characterized in that: The primers for qRT-PCR analysis of the expression level of CsAHL15 are: RT-CsAHL15-F and RT-CsAHL15-R, and the RT-CsAHL15-F and RT-CsAHL15-R are the nucleotide sequences shown in SEQ ID No.6 and SEQ ID No.7, respectively.

10. The method for improving resistance to citrus canker by using CsAHL15 according to claim 3, characterized in that: After the transgenic plants are obtained in step (3), the resistance of the transgenic plants is evaluated to determine that overexpression of CsAHL15 improves resistance to citrus canker.

Images