Monoclonal antibody library targeting tnfr2 and applications thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a monoclonal antibody library targeting TNFR2 and application thereof. The application adopts single B cell screening technology, and through high-throughput sequencing of each immunized B cell, 30 antibody sequences are obtained, all of which have high affinity to TNFR2. In further mouse and human in-vitro screening tests, part of the antibodies can effectively block the proliferation of Treg cells induced by TNF, and show significant biological activity. Among them, the M0101 antibody can bind to human and mouse TNFR2 at the same time, solving the research bottleneck caused by the adaptation problem. Further, in the in-vivo tumor treatment experiment, the antibody M0101 not only shows significant anti-tumor effect in vivo, but also can promote the anti-tumor immune response by regulating the immune microenvironment. The humanized M0101 still maintains good species adaptability and drugability, and has good clinical application potential.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a monoclonal antibody library targeting TNFR2 and its applications. Background Technology

[0002] The antibody drug market has grown at an astonishing rate in recent years, and its size is projected to exceed $200 billion by 2027, making it one of the most dynamic and promising sectors in biopharmaceuticals. This growth is primarily driven by the widespread use of monoclonal antibodies, particularly in the treatment of cancer, immune diseases, and infectious diseases. Immune checkpoint inhibitors such as PD-1 / PD-L1 and CTLA-4 antibodies have revolutionized cancer treatment, propelling the widespread clinical application of immunotherapy. These drugs, by modulating the immune system to fight tumors, have dramatically changed traditional cancer treatment paradigms, bringing significant survival benefits to patients. Simultaneously, advancements in biotechnology, such as the development of bispecific antibodies, antibody-drug conjugates (ADCs), and chimeric antigen receptor T-cell therapy (CAR-T), have further broadened the application scope of antibody drugs. These technologies allow for more precise targeting of tumor cells or diseased tissues, reducing side effects on healthy tissues, thereby improving the safety and efficacy of treatment. However, despite the availability of several successful antibody drugs, significant unmet clinical needs remain. Some patients respond poorly to existing therapies or develop drug resistance during treatment, especially in the treatment of certain types of tumors where effective treatments remain lacking. Therefore, the development of new antibody drugs, particularly those targeting novel immune regulatory targets, has become an urgent market need.

[0003] CD4 + FoxP3 + Regulatory T cells (Tregs) play a crucial role in maintaining immune homeostasis and are beneficial for treating autoimmune diseases. However, their role is particularly important in tumors. Tregs can suppress anti-tumor immune responses by promoting tumor growth and immune escape; therefore, in the tumor microenvironment, Tregs often become key factors in tumor immune escape. Regulating Treg function is essential for inhibiting tumor growth during tumor treatment. Therefore, a deeper understanding of the functional regulation of Tregs in tumors is fundamental to effectively inhibiting Treg activity to block tumor immune escape and achieve anti-tumor therapy.

[0004] The applicant's previous research identified and reported (Xin Chen, J Immunol 1 July 2007; 179 (1):154–161) that tumor necrosis factor receptor II (TNFR2) is one of the TNF receptors preferentially expressed on Tregs. Tumor necrosis factor (TNF) activates Tregs through TNFR2, and the TNF-TNFR2 interaction plays a crucial role in maintaining the function of Tregs. The applicant's previous research found that Tregs lacking TNFR2 expression almost no longer possess inhibitory activity. In addition, high expression of TNFR2 in tumor cells is usually associated with the malignant behavior of tumors. TNFR2 promotes cell proliferation and the activation of anti-apoptotic mechanisms by activating downstream signaling pathways, such as NF-κB and PI3K / Akt, thereby enhancing the survival ability of tumors. Therefore, inhibiting TNFR2 can simultaneously inhibit the proliferation and survival of tumor cells and weaken the immunosuppressive function of Tregs. Targeting TNFR2 can not only directly inhibit tumor growth but also enhance the anti-tumor immune response. Therefore, TNFR2 has become a promising dual target for more effective cancer treatment.

[0005] Currently, TNFR2 antibody library development technology has the following drawbacks:

[0006] 1. Traditional antibody development typically involves multiple stages, including antibody screening, cloning, expression, and purification. These steps are not only time-consuming, but each stage may also encounter technical challenges, resulting in a long overall development cycle. This delay not only increases R&D costs but may also affect market competitiveness. Traditional hybridoma technology is widely used in antibody development, but its fusion process has a high failure rate. This technology involves fusing immune cells with tumor cells to form hybridoma cell lines to produce antibodies. However, due to unstable fusion efficiency, complex screening processes, and stability issues after cell fusion, it is impossible to reliably obtain the desired antibody clone. This high failure rate prolongs the development cycle and increases the uncertainty of R&D. Even if an antibody clone is successfully obtained, traditional methods often struggle to ensure high affinity and long-term stability. Antibody affinity and stability are crucial for their clinical efficacy, but traditional technologies may face limitations in optimizing these properties, leading to unsatisfactory final product quality.

[0007] 2. Insufficient Selectivity and Specificity: Current antibody technologies suffer from limitations in selectivity and specificity, restricting their clinical application. Screening for highly specific antibodies has always been a challenge in antibody development. Hybridoma and phage display technologies sometimes struggle to distinguish target antigens from structurally similar non-target antigens. This lack of specificity can lead to unintended effects of antibodies in vivo, such as toxicity in normal cells or tissues, resulting in side effects.

[0008] 3. Challenges of Cross-Species Recognition: Existing TNFR2 antibodies may not be designed to simultaneously and effectively recognize and bind to both mouse (rat) and human TNFR2 antigens. This is due to structural differences between human and mouse TNFR2, such as differences in amino acid sequences or glycosylation modifications, which result in lower affinity and specificity for antibodies in cross-species applications. Because antibodies cannot simultaneously recognize mouse and human TNFR2, development and validation become more complex. Researchers may need to develop separate antibodies for mice and humans, requiring additional validation and adjustments during translational studies. This not only increases development time and costs but can also lead to inefficiencies and technical challenges. In the early stages of drug development, extensive experiments in mouse models are typically required to evaluate antibody efficacy and safety. If an antibody cannot recognize mouse TNFR2, this limits the effectiveness of preliminary studies using animal models, potentially leading to unreliable data and impacting the success rate of clinical trials. Therefore, further research is needed to develop TNFR2-related antibodies. Summary of the Invention

[0009] The first aspect of the present invention is to provide a monoclonal antibody against TNFR2 or an antigen-binding fragment thereof.

[0010] A second aspect of the present invention aims to provide a humanized anti-TNFR2 monoclonal antibody or an antigen-binding fragment thereof.

[0011] A third aspect of the present invention is to provide a recombinant protein.

[0012] The fourth aspect of this invention aims to provide biological materials related to the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of this invention, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof described in the second aspect, or the recombinant protein described in the third aspect.

[0013] The fifth aspect of this invention is to provide a coupling material.

[0014] The sixth aspect of this invention aims to provide the use of the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of this invention, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof described in the second aspect, the recombinant protein-related biomaterials described in the third aspect, or the conjugates described in the fourth aspect of this invention in the preparation of products.

[0015] The seventh aspect of this invention aims to provide a product.

[0016] The object of the eighth aspect of the present invention is to provide an antibody library.

[0017] The ninth aspect of this invention aims to provide a method for screening TNFR2 monoclonal antibodies or antigen-binding fragments thereof.

[0018] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows:

[0019] In a first aspect, the present invention provides a monoclonal antibody against TNFR2 or an antigen-binding fragment thereof;

[0020] The monoclonal antibody or its antigen-binding fragment comprises a heavy chain and a light chain;

[0021] The light chain comprises:

[0022] Light chain variable region, which includes CDR-L1, CDR-L2 and CDR-L3 of the light chain variable region;

[0023] The sequences of CDR-L1, CDR-L2 and CDR-L3 are selected from three of SEQ ID NO: 1 to 54;

[0024] The heavy chain includes:

[0025] Heavy chain variable region, which includes CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region;

[0026] The CDR-H1, CDR-H2 and CDR-H3 are selected from three of SEQ ID NO: 55~122.

[0027] In some embodiments of the present invention, the CDR sequence of the light chain variable region is shown in any one of 1) to 3):

[0028] 1) CDR-L1, CDR-L2 and CDR-L3 as shown in Table 1;

[0029] 2) The amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 shown in Table 1 that have the same function as the proteins shown in Table 1 by substitution and / or deletion and / or addition of one or more amino acids.

[0030] 3) Amino acid sequences that share 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, or 80% homology with CDR-L1, CDR-L2, and CDR-L3 shown in Table 1 and have the same function as the protein shown in SEQ ID NO: 36.

[0031] In some embodiments of the present invention, the CDR sequence of the heavy chain variable region is shown in any one of 1) to 3):

[0032] 1) CDR-H1, CDR-H2 and CDR-H3 as shown in Table 2;

[0033] 2) The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 shown in Table 2 that have the same function as the proteins shown in Table 2 by substitution and / or deletion and / or addition of one or more amino acids;

[0034] 3) Amino acid sequences that share 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, or 80% homology with CDR-H1, CDR-H2, and CDR-H3 shown in Table 2 and have the same function as the proteins shown in Table 2.

[0035] In some embodiments of the present invention, the CDR is defined using the Kabat scheme.

[0036] In some embodiments of the present invention, the antibodies include 30 types: M0001, M0006, M0010, M0026, M0038, M0048, M0078, M0084, M0087, M0101, M0102, M0119, M0121, M0134, M0165, M0315, M0321, M0333, M0338, M0340, M0357, M0367, M0386, M0399, M0400, M0419, M0434, M0455, M0457, and M0465.

[0037] Specifically, the sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0001 antibody are shown in SEQ ID NO: 1, 2, and 3; and the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 55, 56, and 57.

[0038] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0006 antibody are shown in SEQ ID NO: 4, 5, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 55, 56, and 57.

[0039] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0010 antibody are shown in SEQ ID NO: 4, 5, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 58, 59, and 60.

[0040] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0026 antibody are shown in SEQ ID NO: 7, 8, and 9; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 61, 62, and 63.

[0041] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0038 antibody are shown in SEQ ID NO: 10, 11, and 12; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 64, 65, and 66.

[0042] The sequences of CDR-L1, CDR-L2, and CDR-L33 of the light chain variable region of the M0048 antibody are shown in SEQ ID NO: 13, 14, and 15; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 67, 68, and 69.

[0043] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0078 antibody are shown in SEQ ID NO: 16, 17, and 18; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 70, 71, and 72.

[0044] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0084 antibody are shown in SEQ ID NO: 19, 20, and 21; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 73, 74, and 75.

[0045] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0087 antibody are shown in SEQ ID NO: 22, 20, and 23; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 70, 76, and 77.

[0046] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0101 antibody are shown in SEQ ID NO: 24, 11, and 25; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 78, 79, and 66.

[0047] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0102 antibody are shown in SEQ ID NO: 26, 27, and 28; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 80, 81, and 82.

[0048] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0119 antibody are shown in SEQ ID NO: 29, 27, and 30; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 83, 84, and 82.

[0049] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0121 antibody are shown in SEQ ID NO: 24, 31, and 12; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 78, 85, and 86.

[0050] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0134 antibody are shown in SEQ ID NO: 32, 20, and 33; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 87, 88, and 75.

[0051] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0165 antibody are shown in SEQ ID NO: 34, 28, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 89, 90, and 91.

[0052] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0315 antibody are shown in SEQ ID NO: 35, 36, and 37; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 92, 93, and 94.

[0053] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0321 antibody are shown in SEQ ID NO: 38, 39, and 40; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 95, 96, and 97.

[0054] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0333 antibody are shown in SEQ ID NO: 41, 17, and 42; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 98, 99, and 100.

[0055] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0338 antibody are shown in SEQ ID NO: 43, 44, and 45; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 101, 102, and 103.

[0056] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0340 antibody are shown in SEQ ID NO: 26, 27, and 46; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 104, 105, and 106.

[0057] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0357 antibody are shown in SEQ ID NO: 47, 38, and 78; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 107, 108, and 109.

[0058] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0367 antibody are shown in SEQ ID NO: 26, 49, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 89, 110, and 111.

[0059] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0386 antibody are shown in SEQ ID NO: 50, 27, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 78, 112, and 113.

[0060] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0399 antibody are shown in SEQ ID NO: 49, 27, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 78, 112, and 111.

[0061] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0400 antibody are shown in SEQ ID NO: 51, 52, and 15; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 67, 68, and 114.

[0062] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0419 antibody are shown in SEQ ID NO: 33, 27, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 115, 116, and 111.

[0063] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0434 antibody are shown in SEQ ID NO: 26, 27, and 53; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 117, 118, and 111.

[0064] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0455 antibody are shown in SEQ ID NO: 33, 27, and 54; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 119, 120, and 111.

[0065] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0457 antibody are shown in SEQ ID NO: 33, 27, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 78, 121, and 122.

[0066] The sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region of the M0465 antibody are shown in SEQ ID NO: 26, 27, and 6; the sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region are shown in SEQ ID NO: 78, 118, and 111.

[0067] In some embodiments of the present invention, the light chain further includes a light chain constant region; the heavy chain further includes a heavy chain constant region.

[0068] In some embodiments of the present invention, the light chain further comprises a light chain signal peptide; the heavy chain further comprises a heavy chain signal peptide.

[0069] Preferably, the amino acid sequence of the light chain constant region is as shown in any one of 1) to 3):

[0070] 1) FR-L1, FR-L2, FR-L3 and FR-L4 as shown in Table 3;

[0071] 2) The amino acid sequences of FR-L1, FR-L2, FR-L3 and FR-L4 shown in Table 3, which have the same function as the proteins shown in Table 3, are obtained by substitution and / or deletion and / or addition of one or more amino acids.

[0072] 3) Amino acid sequences that share 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, or 80% homology with FR-L1, FR-L2, FR-L3, and FR-L4 shown in Table 3 and have the same function as the proteins shown in Table 3.

[0073] Preferably, the amino acid sequence of the heavy chain constant region is as shown in any one of 1) to 3):

[0074] 1) FR-H1, FR-H2, FR-H3 and FR-H4 as shown in Table 3;

[0075] 2) The amino acid sequences of FR-H1, FR-H2, FR-H3 and FR-H4 shown in Table 3, which have the same function as the proteins shown in Table 3, are obtained by substitution and / or deletion and / or addition of one or more amino acids;

[0076] 3) Amino acid sequences that share 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, or 80% homology with FR-H1, FR-H2, FR-H3, and FR-H4 shown in Table 3 and have the same function as the proteins shown in Table 3.

[0077] In some embodiments of the present invention, the monoclonal antibody or its antigen-binding fragment comprises at least one of a full-length antibody, Fab, Fab', F(ab')2, Fv, scFv, bispecific antibody, and multispecific antibody.

[0078] A second aspect of the present invention provides a humanized anti-TNFR2 monoclonal antibody or an antigen-binding fragment thereof.

[0079] The sequences of CDR-L1, CDR-L2 and CDR-L3 of the light chain variable region of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are shown in SEQ ID NO: 24, 11 and 25.

[0080] The sequences of the CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are as shown in SEQ ID NO: 78, 79, 66;

[0081] In some embodiments of the present invention

[0082] The VL and CL sequences of the light chain of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are shown in SEQ ID NO: 272 and 273, respectively.

[0083] The VH and CH sequences of the heavy chain of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are shown in SEQ ID NO: 270 and 271, respectively.

[0084] A third aspect of the present invention provides a recombinant protein comprising: a monoclonal antibody of the first aspect of the present invention or an antigen-binding fragment thereof, or a humanized anti-TNFR2 monoclonal antibody of the second aspect of the present invention or an antigen-binding fragment thereof; and optionally a tag sequence for assisting expression and / or purification.

[0085] Preferably, the tag sequence is selected from at least one of the following groups: His tag, GGGS sequence, FLAG tag; further, His tag; and even further, 6×His tag.

[0086] A fourth aspect of the present invention provides biological materials relating to a monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention, or a humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof of the second aspect of the present invention, or a recombinant protein of the third aspect of the present invention, said biological material comprising at least one of a1) to a16):

[0087] a1) A nucleic acid molecule encoding a monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention, or a humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof of the second aspect of the present invention, or a recombinant protein of the third aspect of the present invention;

[0088] a2) An expression cassette containing the nucleic acid molecule described in a1);

[0089] a3) A carrier containing the nucleic acid molecules described in a1);

[0090] a4) A carrier containing the expression box described in a2);

[0091] a5) Transgenic cell lines containing the nucleic acid molecules described in a1);

[0092] a6) Transgenic cell lines containing the expression cassette described in a2);

[0093] a7) A transgenic cell line containing the vector described in a3);

[0094] a8) A transgenic cell line containing the vector described in a4);

[0095] a9) Microorganisms containing the nucleic acid molecules described in a1);

[0096] a10) Microorganisms containing the expression cassette described in a2);

[0097] a11) contains microorganisms that contain the carrier described in a3);

[0098] a12) contains microorganisms that carry the carrier described in a4);

[0099] a13) Viruses containing the nucleic acid molecules described in a1);

[0100] a14) A virus containing the expression cassette described in a2);

[0101] a15) contains a virus containing the vector described in a3);

[0102] a16) contains a virus with the vector described in a4).

[0103] Preferably, the transgenic cell line does not contain propagation material.

[0104] Preferably, the nucleic acid molecule encoding the monoclonal antibody or its antigen-binding fragment as described in the first aspect of the present invention comprises a nucleic acid molecule with a heavy chain encoding the monoclonal antibody or its antigen-binding fragment as described in the first aspect of the present invention and a nucleic acid molecule with a light chain encoding the monoclonal antibody or its antigen-binding fragment as described in the first aspect of the present invention.

[0105] A fifth aspect of the present invention provides a conjugate comprising at least one of the following: a monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention; a humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof of the second aspect of the present invention; or a recombinant protein of the third aspect of the present invention.

[0106] And a coupling portion, the coupling portion comprising at least one of a detectable marker, a drug, a toxin, a cytokine, a radionuclide, and an enzyme.

[0107] Preferably, the detectable marker is selected from radioactive isotopes, fluorescent substances, chemiluminescent substances, colored substances, or any combination thereof.

[0108] Preferably, the conjugate is selected from: fluorescent substances, chemiluminescent markers, colored substances, radioactive isotopes, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes, radionuclides, biotoxins, cytokines (such as IL-2), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorobars, viral particles, liposomes, magnetic nanoparticles, prodrug-activating enzymes, chemotherapeutic agents (e.g., cisplatin), or any form of nanoparticles.

[0109] A sixth aspect of the present invention provides the use of the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of the present invention, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof described in the second aspect of the present invention, the recombinant protein-related biomaterial described in the third aspect of the present invention, or the conjugate described in the fourth aspect of the present invention in the preparation of products.

[0110] Preferably, the product comprises at least one of a drug, a reagent, a test plate, a test kit, and a test chip.

[0111] Preferably, the drug has the function of treating tumors.

[0112] Preferably, the tumor comprises at least one of a solid tumor and a hematoma; more preferably, it comprises a solid tumor.

[0113] Preferably, the solid tumors include liver cancer, colorectal cancer, bladder cancer, breast cancer, cervical cancer, prostate cancer, glioma, melanoma, pancreatic cancer, nasopharyngeal carcinoma, lung cancer, gastric cancer, adrenocortical carcinoma, adrenocortical carcinoma, anal cancer, appendix cancer, astrocytoma, atypical teratoma, rhabdomyosarcoma, basal cell carcinoma, bile duct carcinoma, bladder cancer, bone cancer, brain tumor, bronchial tumor, Burkitt lymphoma, carcinoid tumor, cardiac tumor, bile duct epithelial carcinoma, chordoma, colorectal cancer, craniopharyngioma, ductal carcinoma in situ, germinal tumor, and intrauterine tumor. Membrane carcinoma, ependymoma, esophageal cancer, olfactory neuroblastoma, intracranial germ cell tumors, gonadal germ cell tumors, eye cancer, fallopian tube cancer, gallbladder cancer, head and neck cancer, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, oral cancer, Merkel cell carcinoma, malignant mesothelioma, multiple endocrine syndrome, mycosis fungoides, nasal and sinus carcinoma, neuroblastoma, non-small cell lung cancer, ovarian cancer, pancreatic neuroendocrine tumors, islet cell tumors, papilloma, paraganglioma. At least one of the following: sinus and nasal cavity carcinoma, parathyroid carcinoma, penile cancer, pharyngeal cancer, pituitary adenoma, pleural blastoma, primary peritoneal carcinoma, retinoblastoma, salivary gland tumor, sarcoma, Cézare syndrome, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, testicular cancer, thymoma and thymic carcinoma, thyroid cancer, urethral cancer, uterine cancer, endometrial and uterine sarcoma, vaginal cancer, vascular tumor, vulvar cancer, and single myeloma.

[0114] Preferably, the hematologic malignancy is selected from at least one of B-cell acute lymphoblastic leukemia (BALL), T-cell acute lymphoblastic leukemia (TALL), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphoblastic leukemia, blastic plasmacytoid dendritic cell tumor, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell-follicular lymphoma, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenstrom macroglobulinemia, and preleukemia.

[0115] In some embodiments of the present invention, the tumor is colon cancer.

[0116] Preferably, the reagents, detection plates, kits, and detection chips have the function of detecting the presence or level of TNFR2 protein in a sample.

[0117] In some embodiments of the present invention, MO10, MO87, MO48, MO102, MO119, MO321, MO400, and MO338 cannot block the binding of TNF to Jurkat-R2 cells, but still maintain extremely high affinity. Such antibodies do not affect downstream signaling pathways, but can specifically bind to TNFR2. Therefore, such antibodies can be used to develop diagnostic drugs or detection reagents based on targeting TNFR2.

[0118] A seventh aspect of the present invention provides a product comprising any one of (1) to (5);

[0119] (1) The monoclonal antibody or its antigen-binding fragment as described in the first aspect of the present invention;

[0120] (2) The humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment as described in the second aspect of the present invention;

[0121] (3) The recombinant protein described in the third aspect of this invention;

[0122] (4) The biomaterials described in the fourth aspect of this invention;

[0123] (5) The coupling compound described in the fifth aspect of the present invention.

[0124] Preferably, the product comprises at least one of a drug, a reagent, a test plate, a test kit, and a test chip;

[0125] Preferably, the drug comprises pharmaceutically acceptable excipients.

[0126] Preferably, the pharmaceutically acceptable excipients include at least one of the following: solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, binding agents, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculation agents, filter aids, release inhibitors, and carriers.

[0127] The pharmaceutically acceptable excipients mentioned above are generally recognized for use in this purpose and as inactive ingredients in the pharmaceutical preparation. Compilations of pharmaceutically acceptable excipients can be found in reference books such as the *Handbook of Pharmaceutical Excipients* (2nd edition, edited by A. Wade and PJ Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical 6Gess, London, 1994) and the *Pharmacopoeia of the People's Republic of China - List of Pharmaceutical Excipients*.

[0128] An eighth aspect of the present invention provides an antibody library comprising any two or more of the following: M0001, M0006, M0010, M0026, M0038, M0048, M0078, M0084, M0087, M0101, M0102, M0119, M0121, M0134, M0165, M0315, M0321, M0333, M0338, M0340, M0357, M0367, M0386, M0399, M0400, M0419, M0434, M0455, M0457, and M0465.

[0129] A ninth aspect of the present invention provides a method for screening TNFR2 monoclonal antibodies or antigen-binding fragments thereof, comprising the following steps:

[0130] After immunizing animals with antigens, individual immune cells were isolated and subjected to high-throughput sequencing.

[0131] In some embodiments of the present invention, the antigen is a TNFR2 antibody.

[0132] In some embodiments of the present invention, the animal includes one of mice, rats, rabbits, goats, and monkeys.

[0133] In some embodiments of the present invention, the immune cells are B cells.

[0134] The beneficial effects of this invention are:

[0135] This invention employs single B-cell screening technology, performing high-throughput sequencing on each immunized B cell to obtain a total of 30 antibody sequences, offering the following advantages:

[0136] 1. Optimizing antibody specificity and affinity: Screening based on a large-scale antibody sequence can systematically identify antibodies with optimal specificity and affinity. This method avoids the randomness and blindness of traditional screening techniques, ensuring that the selected antibodies achieve optimal target binding efficacy, thereby improving antibody quality and clinical application potential.

[0137] 2. Accelerate the R&D process: The combination of single B-cell screening technology and high-throughput sequencing enables antibody discovery and optimization in a shorter time. This method significantly shortens the development cycle and, compared to traditional technologies, allows novel antibodies to be brought to clinical trials more quickly, improving R&D efficiency.

[0138] 3. Facilitates the acquisition of antibodies simultaneously targeting human and mouse TNFR2: By performing high-throughput sequencing on individual B cells, this invention can obtain antibody sequences targeting both human and mouse TNFR2. This method can screen for antibodies that can simultaneously recognize and bind to TNFR2 in both species, thus simplifying the species compatibility issue during development. Because it simultaneously meets the needs of both humans and mice, the success rate of antibody development is increased, and the product commercialization process is accelerated. This method reduces R&D bottlenecks caused by species compatibility issues, helping to rapidly advance the clinical trials and commercialization of antibodies. Attached Figure Description

[0139] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0140] Figure 1 The affinity results of the antibodies screened in this invention include eight antibodies: M0006, M0001, M0048, M0078, M0038, M0087, M0121, and M0026.

[0141] Figure 2 The affinity results of the antibodies screened in this invention include eight results: M0084, M0400, M0165, M0419, M0134, M0101, M0119, and M0102.

[0142] Figure 3 The affinity results of the antibodies screened in this invention include eight antibodies: M0315, M0321, M0338, M0357, M0010, M0386, M0455, and M0457.

[0143] Figure 4 The affinity results of the antibodies screened in this invention include six antibodies: M0434, M0465, M0399, M0340, M0333, and M0367.

[0144] Figure 5 For antibody sequence polymorphism analysis.

[0145] Figure 6 This is the result of in vitro antibody screening based on cell lines.

[0146] Figure 7 In vitro functional validation results based on mouse primary lymphocytes

[0147] Figure 8 Results of in vitro functional validation of human primary lymphocytes.

[0148] Figure 9 The in vivo antitumor results of murine TNFR2 antibody.

[0149] Figure 10 Analysis of lymph node immune cells drained for murine TNFR2 antibody.

[0150] Figure 11 The results show the affinity of the humanized mouse TNFR2 antibody. Detailed Implementation

[0151] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0152] Example 1: Construction of a monoclonal antibody library specifically targeting TNFR2 based on single B cell screening technology

[0153] 1. Mouse immunization

[0154] BALB / c mice were immunized with human TNFR2 protein (purchased from Sino Biological).

[0155] Human TNFR2 protein was emulsified using adjuvants (purchased from Beyotime Biotechnology Co., Ltd.; complete Freund's adjuvant, catalog number: P2036-50ml; incomplete Freund's adjuvant, catalog number: P2031-50ml) and injected into four sites on the back of mice. The specific procedure was as follows: For the first subcutaneous injection (s.c.), 50µg of diluted protein antigen was emulsified with an equal volume of incomplete Freund's adjuvant (IFA). In subsequent subcutaneous injections, 25µg of antigen protein was emulsified with an equal volume of complete Freund's adjuvant (CFA). At least four injections were performed, with an interval of at least 14 days between each injection. Seven days after the third injection or booster immunization, serum was collected, and the antibody titer was tested by ELISA (TNFR2 protein was coated onto an ELISA plate, and the secondary antibody was HRP-labeled rabbit anti-mouse IgG). The established standard for acceptable serum titer is: when coated with an immunogen at a concentration of 5 μg / mL, the serum should be diluted 1:16000 with an OD-Blank value > 1.0. If the serum titer is not acceptable, booster immunization should be performed until the serum titer is acceptable.

[0156] 2. Beacon-based single B cell sorting

[0157] Human TNFR2 protein (10-50 μg biotin, purchased from Sino Biological) was labeled with biotin. The protein was incubated with Streptavidin Magnetic Beads (Thermo Fisher, product code: 88817) to prepare antigen microspheres. The antigen microspheres were then quality-controlled using a positive antibody specifically targeting TNFR2 (purchased from Sino Biological). Next, single-cell suspensions were extracted from the spleens of mice with acceptable titers, and plasma cells were enriched using magnetic beads. Subsequently, plasma cells were introduced into a 14K chip containing 14,000 chambers using a Beacon system (using BD instruments). Then, antigen microspheres and fluorescently labeled secondary antibodies were introduced into the chip, and fluorescence formation was observed to determine whether plasma cells secreted specific antibodies. Finally, target cells were selected and exported to well plates containing cell lysis buffer.

[0158] 3. Amplification of variable regions of single plasma cells and construction of vectors exported from Beacon.

[0159] RNA from cell lysates was reverse transcribed to obtain cDNA from each B cell. Then, using the cDNA as a template, the variable regions of the antibody heavy and light chains were amplified by nested PCR (specific primer information: FAGGGAGACCCAAGCTGGCTAGCGCCGCCACCATGGCTCCAGTGGCT, SEQ ID NO: 274; RAAACGGGCCCTCTAGACTCGAGTCAGTGGTGGTGGTGATGGTGGTCTCC, SEQ ID NO: 275). Next, the amplified variable regions of the antibody heavy and light chains were inserted into the expression vector PCDNA3.1, which contains a signal peptide and a constant region. Clones were selected for identification, and correctly identified clones were sent for sequencing. Finally, the correctly sequenced clones were subjected to overnight culture to extract plasmids, and the plasmids were sequenced again before expression to confirm their correctness. A TNFR2 antibody library was constructed.

[0160] 4. Affinity screening

[0161] The antibody light and heavy chain expression vectors were transiently transfected into HEK293 cells for recombinant expression, and relevant functional verification was performed, including ELISA and BLI. After screening, the thirty murine antibodies with the highest affinity were selected, and the specific sequence information is as follows.

[0162] Table 1. Antibody light chain CDR sequence information

[0163]

[0164] Table 2 Antibody heavy chain CDR sequence information

[0165]

[0166] Table 3 Antibody backbone sequence information

[0167]

[0168] Figures 1-4 The affinity analysis results of these screened antibodies are presented, confirming that all selected antibodies exhibit nanomolar-level affinity. This demonstrates that these antibodies demonstrate excellent binding ability to target TNFR2.

[0169] Figure 5 Further antibody sequence analysis was presented, and the results showed that these thirty antibody sequences have good diversity, ensuring broad coverage of the antibody library and its potential application value.

[0170] Example 2: Cell line-based in vitro antibody screening

[0171] The applicant's research group established a stable Jurkat cell line (Jurkat-R2) by transducing Jurkat cells with a lentiviral vector overexpressing TNFR2 (the viral vector was purchased from Jikai Gene Technology Co., Ltd.). Thirty antibodies were administered at a concentration of 6 nM and 2.5 × 10⁻⁶. 5 Jurkat-R2 cells (cell concentration 2.5 × 10⁶) 6 The cells were co-incubated with 0.1 mL of a solution (0.1 mL / mL) to allow the antibody to bind to TNFR2. Subsequently, 10 ng / mL of biotin-labeled TNF protein (purchased from ACROBiosystems) was added, and the binding degree of TNF to TNFR2 on the cell surface was analyzed by flow cytometry using a Streptividin-APC flow cytometry antibody (purchased from BD). The blocking efficiency of each antibody against TNF and TNFR2 was evaluated by comparing the binding of biotin-TNF under antibody presence and absence conditions.

[0172] Figure 6 This demonstrates the results of our screening of thirty candidate antibodies for this invention using a Jurkat cell line overexpressing TNFR2 and a biotin-labeled TNF binding detection system. The screening results showed that among the thirty candidate antibodies, 8 antibodies (M010, M087, M048, M0102, M0119, M0321, M0400, M0338) failed to block the binding of TNF to Jurkat-R2 cells, 12 antibodies (M001, M006, M026, M078, M084, M0134, M0165, M0315, M0333, M0340, M0357, M0386) partially blocked the binding of TNF to Jurkat-R2 cells, and 10 antibodies (M038, M0101, M0121, M0367, M0386, M0434, M0455, M0457, M0419, M0465) significantly reduced the binding of Biotin-TNF, with an inhibition rate of 100%. This indicates that these antibodies are highly efficient in blocking the binding of TNF to TNFR2 and may serve as strong candidates for further research and development.

[0173] Example 3: In vitro screening based on mouse and human primary lymphocytes

[0174] Lymphocytes from C57BL / 6 mice were collected from the spleen, axillary lymph nodes, inguinal lymph nodes, and mesenteric lymph nodes. CD4+ cells were sorted from the lymphocytes using CD4(L3T4) microbeads (Miltenyi Biotec, 130–097–145) and MS columns (Miltenyi Biotec). + T cells. MACS-purified CD4 + T cells were labeled with Cell Trace Violet dye (purchased from Thermo Fisher Scientific; Introvigen), and cells (1×10⁶) were counted. 5 Treg cells (10 cells / well) were cultured in 96-well plates and then stimulated for 3 days with IL-2 (10 ng / mL) and TNF (10 ng / mL), with or without ten antibodies (5 nM) selected for significant blocking activity. Treg cell proliferation was assessed using the CTV dilution method, and Foxp3 cells were analyzed by fluorescence activated cell sorting (FACS). + Cells in CD4 + The proportion of cells in the subsets and the expression of TNFR2 on Tregs were analyzed. During the screening process, the functionality of the antibody was assessed by detecting its inhibitory effect on TNF-induced cell proliferation. Results are as follows: Figure 7 As shown, the results indicate that three antibodies (M038, M0101, and M0121) can effectively block TNF-induced proliferation of mouse Treg cells, demonstrating significant biological activity. This suggests that these three antibodies bind to TNFR2 in mice.

[0175] Building upon this, this embodiment further utilizes ten antibodies (M038, M0101, M0121, M0367, M0386, M0434, M0455, M0457, M0419, and M0465) that have been screened from human peripheral blood mononuclear cells to detect significant blocking effects. Human peripheral blood mononuclear cells were collected from the cells. CD4 microbeads (purchased from Miltenyi Biotec) and MS columns (purchased from Miltenyi Biotec) were used to isolate CD4 from the lymphocytes. + T cells. MACS-purified CD4 + T cells were labeled with Celltrace violet dye (purchased from Thermo Fisher Scientific; Introvigen), cells (1×10⁶) 5Cells (10 cells / well) were cultured in 96-well plates and then stimulated for 3 days with IL-2 (10 ng / mL) and TNF (50 ng / mL) in the presence or absence of antibody (5 nM). Treg cell proliferation was assessed using the CTV dilution method, and the proportion of Foxp3+ cells in the CD4+ subset and TNFR2 expression on Tregs were determined by flow cytometry (FACS).

[0176] All ten antibodies screened could inhibit the increase in the proportion of human TNF-induced Treg cells to varying degrees, as shown in the results. Figure 8 As shown, antibodies M0101 and M0419 are the antibodies with the most significant inhibitory effect.

[0177] Example 4: Validation of the in vivo antitumor function of the antibody

[0178] Antibody M0101, which showed significant effects in both human and mouse in vitro experiments, was randomly selected for in vivo validation.

[0179] The antitumor effect of antibody M0101, obtained through in vitro screening, was evaluated in a Balb / c mouse model in which CT26 mouse colon cancer cells (purchased from ATCC) were subcutaneously transplanted.

[0180] The mouse model was constructed as follows: Female Balb / c mice aged 6-8 weeks were selected, ensuring they were healthy and disease-free before the experiment. The CT26 mouse colon cancer cell line (or other suitable tumor cell lines) was used for the experiment. Before the experiment, CT26 cells were cultured in RPMI-1640 medium containing 10% FBS until the logarithmic growth phase. The CT26 cells were resuspended in PBS and adjusted to an appropriate concentration (5 × 10⁻⁶). 5100 μL of CT26 cell suspension was subcutaneously injected into the right back of mice using a sterile syringe to establish a subcutaneous tumor model. The health of the mice was monitored after injection, and the tumors were allowed to grow to a measurable size (typically 50-100 mm³). Mice were randomly divided into three groups of five mice each. Two groups served as control groups, receiving 100 µL of PBS or an equal volume of IgG antibody as a control; the other group served as the experimental group, receiving M0101 antibody (5 mg / kg). The antibody was administered intraperitoneally every 2-3 days. The treatment period was typically 3 weeks, during which tumor volume was measured periodically. Every 2-3 days, the major axis (L) and minor axis (W) of the subcutaneous tumor were measured using calipers, and the tumor volume was calculated. The tumor volume calculation formula is: Volume = (L × W²) / 2. Changes in tumor volume were recorded for each group, and tumor growth curves were plotted to compare the tumor growth inhibition effects between different groups. Mice were euthanized and drained lymph nodes and tumor tissue were collected at the end of the treatment cycle or when the tumor reached the specified endpoint volume (2000 mm³).

[0181] The results are as follows Figure 9 The results showed that in mice treated with TNFR2 antibody, tumors completely regressed in 80% of the mice, demonstrating potent antitumor activity. In contrast, tumors in the control group continued to grow. To explore the mechanism of action of the antibody, flow cytometry analysis was further performed on immune cell subsets in the draining lymph nodes of mice. Figure 10 The results showed that CD8+ was present in the draining lymph nodes of mice treated with TNFR2 antibody. + The significantly increased proportion of T cells suggests that antibody therapy may suppress tumor growth by enhancing cytotoxic T cell responses in the tumor microenvironment. Furthermore, a decrease in the proportion of regulatory T cells (Tregs) was observed, further supporting the potential role of antibodies in immune regulation.

[0182] Example 5 Humanization of Antibodies

[0183] The light and heavy chain amino acid sequences of the mouse-derived M0101 antibody were used. The complementarity-determining regions (CDRs) of the antibody were structurally analyzed using antibody structure databases and computer simulation techniques, and compared with human antibody frameworks to determine the most suitable human antibody framework sequence. The antibody's CDRs were preserved and transplanted onto the selected framework sequence that best approximates the human antibody. If necessary, a small number of amino acids in the framework region were adjusted to maintain the antibody's affinity and specificity. The specific humanized antibody sequences are shown in Table 4. The humanized antibody gene sequence was synthesized and cloned into an expression vector (pcDNA3.1). The expression vector was transfected into mammalian cells (HEK293) for antibody expression. The expressed antibody was purified using protein A / G affinity chromatography, followed by further purification by ion exchange chromatography to ensure high-purity humanized antibody. The affinity of the humanized antibody for the human TNFR2 antigen was analyzed based on BLI experiments. The results are shown below. Figure 11 As shown, the humanized M0101 antibody still maintains a high affinity for the antigen.

[0184] Table 4 Humanized M0101 antibody sequence

[0185]

[0186] Example 6: Drugability Analysis Based on SEC, HIC, CIC, and DSF

[0187] First, gel filtration chromatography (SEC) was used to analyze the molecular weight distribution and polymerization state of the antibodies. The purified antibody sample was diluted and injected into an SEC column (Superdex 200) in an HPLC system, using PBS or a suitable buffer as the mobile phase at a flow rate of 0.5 mL / min. The UV detection signal at 280 nm was recorded to evaluate the main peak of the antibody and the peaks of its polymers or degradation products. Next, hydrophobicity of the antibodies was analyzed using hydrophobic interaction chromatography (HIC).

[0188] After filtering, the antibody sample was injected into a HIC column (Butyl column) in an HPLC system, and gradient elution was performed using buffers with different salt concentrations at a flow rate of 1 mL / min. UV detection signals were recorded at 280 nm to evaluate the antibody's hydrophobicity and purification efficiency.

[0189] Then, the charge isomers of the antibody were evaluated using ion exchange chromatography (CIC). The purified antibody sample was injected into a CIC column (such as an SP or HP column) and eluted using gradient buffers of different pH values ​​at a flow rate of 1 mL / min. The UV detection signal was recorded at 280 nm to analyze the charge state and isoelectric point of the antibody.

[0190] Finally, differential scanning calorimetry (DSF) was used to assess the thermal stability of the antibody. The purified antibody sample was mixed with SYPRO Orange fluorescent dye and subjected to thermal scanning (20-90℃, heating rate 1℃ / min). Changes in fluorescence intensity were monitored in real time to determine the melting temperature (Tm value) of the antibody and assess its thermal stability. These data were combined to comprehensively evaluate the druggability of the antibody.

[0191] The results are shown in Table 5. The humanized M0101 antibody, while maintaining its high efficiency in recognizing and blocking the binding of TNF to TNFR2, also exhibits favorable drug-like characteristics, such as low immunogenicity, stable expression levels, and optimized pharmacokinetic properties. These characteristics suggest that this humanized antibody holds promise for further development into a clinical therapeutic drug.

[0192] Table 5. Drugability Assessment of M0101 Antibody

[0193]

[0194] In summary, this invention employs single B-cell screening technology, performing high-throughput sequencing on each immunized B cell to obtain 30 antibody sequences, all of which exhibit high affinity for TNFR2. Further in vitro screening experiments in mice and humans showed that some antibodies effectively blocked TNF-induced Treg cell proliferation, demonstrating significant biological activity. The M0101 antibody, in particular, can bind to both human and mouse TNFR2, overcoming the development bottleneck caused by compatibility issues. Furthermore, in in vivo tumor therapy experiments, antibody M0101 not only demonstrated significant anti-tumor effects in vivo but may also promote anti-tumor immune responses by regulating the immune microenvironment. The humanized M0101 maintains good species adaptability and drug-likeness, possessing excellent potential for clinical application.

Claims

1. A monoclonal antibody against TNFR2 or its antigen-binding fragment, characterized in that: The monoclonal antibody or its antigen-binding fragment is any one of 1) to 3): 1) The monoclonal antibody or its antigen-binding fragment comprises CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3; The sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 24, 11 and 25, respectively; The sequences of CDR-H1, CDR-H2 and CDR-H3 are shown in SEQ ID NO: 78, 79 and 66, respectively; 2) The monoclonal antibody or its antigen-binding fragment comprises CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3; The sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 26, 49 and 6, respectively; The sequences of CDR-H1, CDR-H2 and CDR-H3 are shown in SEQ ID NO: 89, 110 and 111, respectively; 3) The monoclonal antibody or its antigen-binding fragment comprises CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3; The sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 43, 44 and 45, respectively; The sequences of CDR-H1, CDR-H2 and CDR-H3 are shown in SEQ ID NO: 101, 102 and 103, respectively.

2. The monoclonal antibody or its antigen-binding fragment according to claim 1, characterized in that: The monoclonal antibody or its antigen-binding fragment is at least one of the following: full-length antibody, Fab, Fab', F(ab')2, and Fv.

3. A humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment, characterized in that: The sequences of CDR-L1, CDR-L2 and CDR-L3 of the light chain variable region of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are shown in SEQ ID NO: 24, 11 and 25, respectively. The sequences of the CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are shown in SEQ ID NO: 78, 79 and 66, respectively. The VL and CL sequences of the light chain of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are shown in SEQ ID NO: 272 and 273, respectively. The VH and CH sequences of the heavy chain of the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment are shown in SEQ ID NO: 270 and 271, respectively.

4. A recombinant protein comprising: a monoclonal antibody or its antigen-binding fragment as described in any one of claims 1 to 2, or a humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment as described in claim 3; and a tag sequence to assist in expression and / or purification.

5. Biological materials relating to the monoclonal antibody or antigen-binding fragment thereof as described in any one of claims 1 to 2, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof as described in claim 3, or the recombinant protein as described in claim 4, wherein the biological material is at least one of a1) to a12): a1) A nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof as described in any one of claims 1 to 2, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof as described in claim 3, or the recombinant protein as described in claim 4; a2) An expression cassette containing the nucleic acid molecule described in a1); a3) A carrier containing the nucleic acid molecules described in a1); a4) A carrier containing the expression box described in a2); a5) Transgenic cell lines containing the nucleic acid molecules described in a1); a6) Transgenic cell lines containing the expression cassette described in a2); a7) A transgenic cell line containing the vector described in a3); a8) A transgenic cell line containing the vector described in a4); a9) Microorganisms containing the nucleic acid molecules described in a1); a10) contains microorganisms containing the expression cassette described in a2); a11) contains microorganisms that contain the carrier described in a3); a12) contains microorganisms that contain the carrier described in a4).

6. A conjugate comprising at least one of the monoclonal antibody or antigen-binding fragment thereof as described in any one of claims 1 to 2, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof as described in claim 3, or the recombinant protein as described in claim 4; And a coupling portion, wherein the coupling portion is a detectable marker; The detectable markers include radionuclides and enzymes.

7. The application of at least one of (1) to (5) in the preparation of the product; (1) The monoclonal antibody or its antigen-binding fragment as described in any one of claims 1 to 2; (2) The humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment as described in claim 3; (3) The recombinant protein according to claim 4; (4) The biomaterial as described in claim 5; (5) The coupling compound according to claim 6; The product is at least one of reagents, detection plates, reagent kits, and detection chips; The reagents, detection plates, kits, and detection chips described herein have the function of detecting the presence or level of TNFR2 protein in a sample.

8. A product comprising any one of (1) to (5); (1) The monoclonal antibody or its antigen-binding fragment as described in any one of claims 1 to 2; (2) The humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment as described in claim 3; (3) The recombinant protein according to claim 4; (4) The biomaterial as described in claim 5; (5) The coupling compound according to claim 6; The product is at least one of reagents, test plates, reagent kits, and test chips.

Images