Msrl gene and its application in regulation of necroptosis in sepsis dc

CN119799707BActive Publication Date: 2026-08-11THE FIRST MEDICAL CENT CHINESE PLA GENERAL HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510043002.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-10
Publication Date
2026-08-11
Estimated Expiration
2045-01-10

AI Technical Summary

Technical Problem

[0005]MSR1又称清道夫受体A(scavenger receptor A, SR-A)或分化簇204(cluster ofdifferentiation, CD204),由Brownnand Goldstein于1979年首次描述,他们证明MSR1介导了乙酰化低密度脂蛋白的摄取和降解,导致细胞内胆固醇沉积增加

Benefits of technology

本发明的有益效果:本发明提供的方法——敲除MSR1基因能够有效降低脓毒症时DC坏死性凋亡相关蛋白磷酸化水平;降低DC发生坏死性凋亡比例、坏死性凋亡相关DAMPs及细胞因子水平;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119799707B_ABST
    Figure CN119799707B_ABST
Patent Text Reader

Abstract

This invention relates to the field of biomedical technology, specifically to the application of the MSR1 gene in the regulation of necrosis and apoptosis of dendritic cells (DCs) in sepsis. This application reduces DC necrosis and apoptosis during sepsis by knocking out the MSR1 gene, providing a novel therapeutic target for sepsis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of the MSR1 gene and its encoding in the regulation of necrotizing apoptosis in sepsis-induced dendritic cells (DCs). Background Technology

[0002] Sepsis is typically caused by a microbial infection that triggers a systemic inflammatory response, leading to the activation of various cells and molecules and the release of inflammatory mediators. These mediators, normally used to fight infection, can become uncontrolled in sepsis, potentially triggering fatal organ dysfunction. In my country, approximately one million patients die from sepsis each year, with a mortality rate as high as 35.5% among sepsis patients in intensive care units. With the increasing aging population, the incidence and mortality rates of sepsis are rising annually, creating a significant medical burden and social pressure.

[0003] Existing technologies, such as the invention patent with patent application number 2016102794739, provide exosomes, a method for preparing exosomes, and their application in the preparation of drugs or preparations for treating sepsis. Specifically, it involves optimizing the treatment of human umbilical cord mesenchymal stem cells with recombinant human IL-1β to enhance their immunosuppressive function, and extracting the resulting exosomes for the treatment of sepsis. These exosomes, through their inhibitory effects on T cells and macrophages, can effectively alleviate sepsis symptoms and increase the survival rate of septic mice.

[0004] However, research has found that dendritic cells (DCs) play a crucial role in both immune activation and immune tolerance, and a single DC can activate 100 to 3000 T cells, which is 100 to 1000 times greater than the T cell activation capacity of macrophages and B cells. Dendritic cells (DCs) play a central role in activating and regulating immune responses. The role of dendritic cells in immune system diseases and neurological disorders also makes them a potential therapeutic target for these diseases.

[0005] MSR1, also known as scavenger receptor A (SR-A) or cluster of differentiation (CD204), was first described by Brownnand Goldstein in 1979. They demonstrated that MSR1 mediates the uptake and degradation of acetylated low-density lipoprotein, leading to increased intracellular cholesterol deposition. MSR1 is mainly expressed on macrophages and dendritic cells (DCs). Recent studies have found that MSR1 is also present on the surface of lymphocytes, potentially participating in the pathogenesis of asthma and chronic obstructive pulmonary disease (COPD). Since macrophages primarily clear pathogens through phagocytosis and cytokine production, MSR1 plays a crucial role in clearing foreign pathogens. By studying the regulation of dendritic cells by MSR1, we can more precisely and effectively regulate immune activation and suppression, improving the efficiency of immune responses and providing new ideas and methods for the treatment of immune-related diseases. Summary of the Invention

[0006] In order to solve the problems in the background art, the object of the present invention is to provide the application of an agent that knocks out the expression of the MSR1 gene in the preparation of a product for treating sepsis.

[0007] Preferably, the formulation is gRNA-B1 and gRNA-B2; the sequence of gRNA-B1 is: GGCCTTTGCACGTGAAGAGGAGG, as shown in SEQ ID NO.1; the sequence of gRNA-B2 is: ACTTTGGGGAAATAAGGTACAGG, as shown in SEQ ID NO.2, and the formulation inhibits necrotizing apoptosis of dendritic cells in sepsis.

[0008] Preferably, the formulation that knocks out MSR1 gene expression can inhibit the decrease in phosphorylation levels of RIPK1, RIPK3 and MLKL, the proteins involved in necrosis and apoptosis of septic dendritic cells in mice.

[0009] Preferably, the formulation that knocks out MSR1 gene expression can inhibit the decrease in the level of necrotic apoptotic cytokines in mouse sepsis DCs, wherein the markers of the cytokines are HMGB1, IL-1α, IL-33, LDH and TNF-α.

[0010] In summary, the beneficial effects of the present invention are as follows: The beneficial effects of this invention are as follows: The method provided by this invention—knocking out the MSR1 gene—can effectively reduce the phosphorylation level of dendritic necrosis and apoptosis-related proteins in sepsis; and reduce the proportion of dendritic necrosis and apoptosis, as well as the levels of necrosis and apoptosis-related DAMPs and cytokines. This application demonstrates that knocking out the MSR1 gene has a significant protective effect against dendritic necrosis and apoptosis under sepsis conditions, and alleviates the systemic inflammatory response triggered by sepsis. This application reduces necrotizing apoptosis of dendritic cells (DCs) during sepsis by knocking out the MSR1 gene, providing a new therapeutic target for sepsis.

[0011] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings. Attached Figure Description

[0012] Figure 1 Western blot analysis was used to detect the relationship between WT mice and Msr1. - / - Changes in necrosis-apoptosis-related proteins in mouse splenic dendritic cells (DCs) after in vitro stimulation and MSC-Exo treatment; Figure 2 (A) Flow cytometry was used to detect the relationship between WT mice and Msr1. - / - (A) The proportion of necrotic and apoptotic DCs in the spleen of mice after in vitro stimulation and MSC-Exo treatment; (B) The proportion of necrotic and apoptotic DCs in the spleen of WT mice and Msr1- / - mice after in vitro stimulation and MSC-Exo treatment was detected by SYTOX-Green staining. Figure 3 : Laser confocal microscopy was used to observe the effect of MSR1 gene knockout on the fluorescence intensity of p-MLKL and the proportion of positive cells in dendritic cells under sepsis conditions; Figure 4 : The effect of MSR1 gene knockout on p-RIPK3 fluorescence intensity and the proportion of positive cells in dendritic cells under sepsis conditions was observed by laser confocal microscopy; Figure 5 Effects of MSR1 gene knockout on the levels of necrosis- and apoptosis-related cytokines in DC culture supernatant under sepsis conditions; Figure 6 Effects of conditional knockout of the MSR1 gene on the expression levels of dendritic apoptosis-related proteins in septic mice; Figure 7 Effect of conditional knockout of the MSR1 gene on the proportion of necrotizing apoptosis in dendritic cells (DCs) of septic mice; Figure 8 : The effect of conditional knockout of the MSR1 gene on the fluorescence intensity of p-MLKL and the proportion of positive cells in DCs of septic mice was observed by laser confocal microscopy; Figure 9: The effect of conditional knockout of the MSR1 gene on the fluorescence intensity of p-RIPK3 and the proportion of positive cells in DCs of septic mice was observed by laser confocal microscopy; Figure 10 Effects of conditional knockout of the MSR1 gene on necrotizing apoptosis-related DAMPs and cytokines in septic mice. Detailed Implementation

[0013] To make the content of this invention easier to understand, the invention will be further described below with reference to specific embodiments and accompanying drawings.

[0014] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; and the materials and reagents used are commercially available unless otherwise specified.

[0015] I. Experimental Preparation The following experiments used SPF-grade wild-type (WT) C57BL / 6J mice, male, provided by Beijing Huafukang Biotechnology Co., Ltd. Among them, Msr1 mice with the Msr1 gene knocked out... - / - Mice and conditionally knocked-out Msr1 gene expression mice (Cd11c cre Msr1 fl / fl Mice were constructed by Guangzhou Cyagen Biosciences Co., Ltd. and raised to 7±1 weeks of age. The Msr1 gene knockout mice were defined as mice in which the siRNA and sgRNA expressing the Msr1 gene were knocked out. Each mouse weighed approximately 22.5±2.5g. The primer pair used to identify the Msr1 gene was Forward GGGAGTGTAGGCGGATCA, as shown in SEQ ID NO.3; Reverse GGAGATGATAGTAGGGTGCTCTG, as shown in SEQ ID NO.4. The sgRNA sequences were: gRNA-B1: GGCCTTTGCACGTGAAGAGGAGG; gRNA-B2: ACTTTGGGGAAATAAGGTACAGG. Mice were housed in an SPF-grade animal facility at 22℃ and 65% humidity for one week of acclimatization feeding, with good ventilation and access to water at all times.

[0016] Animal grouping: The experiment involved 24 normal Msr1 mice. fl / flMice and 24 conditionally knocked-out MSR1 mice were randomly divided into three groups of eight mice each using a random number table. One group underwent laparotomy with cecal inversion followed by closure (sham surgery group); another group underwent CLP modeling (model group); and the third group received an immediate tail vein injection of MSC-exo (100 μg / mouse) after CLP modeling (treatment group). Twenty-four hours after modeling, samples were collected from the sham surgery group, model group, and treatment group. After anesthesia, the eyeballs were enucleated for blood collection, and the mice were euthanized by cervical dislocation for further sampling.

[0017] The following methods were used to process splenic DCs: WWT mice and Msr1 mice were isolated. - / - Mouse spleen DCs were divided into different groups, which were stimulated with PBS, LPS+z-VAD, and LPS+z-VAD+mesenchymal stem cells (MSC-Exo). Cells and cell culture supernatant were collected from each group after 24 hours and stored at -20°C for subsequent processing.

[0018] The following experimental methods for LPS+z-VAD combined stimulation were as follows: Two hours after seeding cells in cell culture flasks, an in vitro sepsis model was established using LPS stimulation at a concentration of 1 μg / mL. Cells were pre-stimulated with the broad-spectrum caspase kinase inhibitor z-VAD-FMK (z-VAD) at a working concentration of 20 μM. After 30 minutes of pre-stimulation with z-VAD, LPS stimulation was combined to induce necrosis and apoptosis.

[0019] The method for establishing a mouse sepsis model using the CLP method was as follows: Mice were fasted for 12 hours before surgery, but water was allowed. Mice were anesthetized by intraperitoneal injection of chloral hydrate (5%), and the anesthetic dose was determined according to the mouse's weight (10 mL / kg). After anesthesia, the mice were fixed to the operating board in a supine position. The abdominal skin of the mice was disinfected with povidone-iodine, and the incision was made layer by layer along the midline of the abdomen, with an incision length of 1 cm. After opening the abdomen, the cecum was quickly located and ligated with sterile No. 4 suture 1.0 cm from the end of the cecum. A 22G needle was used to penetrate the cecum once distal to the ligation site. The ligated intestinal tube was squeezed to cause some intestinal contents to spill out. The cecum was returned to its original position in the abdominal cavity, sutured layer by layer, and the abdomen was closed. 1 mL of 0.9% physiological saline was injected subcutaneously into the back of the neck of the mice, and they were transferred to a feeding cage. Warming measures were taken, and the mice were allowed to eat and drink freely after waking up.

[0020] The mouse mononuclear cells used in the experiment were isolated using the following steps: S1. Mice were euthanized by cervical dislocation. After disinfection with alcohol, the abdominal skin was cut open, the spleen was bluntly separated and placed in a sterile centrifuge tube containing pre-cooled sterile phosphate-buffered saline (PBS). S2. In the clean bench, spleen tissue was processed. The spleen capsule and other connective tissues were removed with forceps. The spleen was carefully torn into pieces and then carefully transferred to a cell filter (75μm) to allow the spleen tissue to be thoroughly ground. During the grinding process, the filter was rinsed with PBS intermittently. After grinding, the filtrate was mixed and transferred to a centrifuge tube to obtain a spleen cell suspension. S3, use PBS to dilute the spleen cell suspension, then put the spleen cell suspension into a centrifuge for centrifugation at 1500 rpm for 5 min, then discard the supernatant, precipitate, and then resuspend in PBS; S4. Add 4 mL of mononuclear cell separation medium to a new 15 mL centrifuge tube. Slowly add an equal volume of spleen cell suspension treated in step S3 to the upper layer of the mononuclear cell separation medium. Carefully transfer the suspension to a centrifuge and centrifuge at 3000 rpm for 15 min. S5. After centrifugation, carefully aspirate the cells from the cloud layer in the middle of the centrifuge tube into a new 15mL centrifuge tube, wash with PBS 3 times, and then count the cells.

[0021] (4) The mouse peripheral blood mononuclear cells used in the following experiments were isolated by the following steps: S1, after anesthetizing the mice, the eyeballs were removed and blood was collected and placed in EDTA anticoagulant tubes; S2, the blood in the EDTA anticoagulant tube was transferred to a 15mL centrifuge tube in a sterile laminar flow hood. The centrifuge tube was then placed in a centrifuge and centrifuged at room temperature at 3000rpm for 10min. The plasma layer on top of the centrifuge tube was then carefully aspirated and placed in a 1.5mL EP tube. The EP tube was then placed in a freezer at -80℃ for freezing and storage for subsequent testing. S3, mix the lower layer blood cells in the centrifuge tube with PBS containing 0.5 uM ethylenediaminetetraacetic acid (EDTA) at a ratio of 1:2 to obtain a diluted lower layer blood cell suspension, and add an equal volume of mouse peripheral blood lymphocyte separation solution to another centrifuge tube. S4. The diluted lower layer of blood cell suspension was slowly added dropwise to the upper layer of mouse peripheral blood lymphocyte separation medium, and then placed in a centrifuge and centrifuged at room temperature. The centrifugal force was 550±50g and the centrifugation time was 30min. The centrifuge acceleration was 9 and the centrifuge deceleration was 1. S5. After step S4, carefully aspirate the cells in the cloud layer in the middle of the centrifuge tube, add PBS and mix well, then place it in a centrifuge and centrifuge at room temperature at a speed of 1500 rpm for 5 min. Repeat the cell washing twice. S6. After cell washing, the cells are resuspended to obtain a suspension of mouse peripheral blood mononuclear cells, which are then counted for use in subsequent experiments.

[0022] II. Experimental Analysis Experiment 1: Western Blot analysis of WT mice and Msr1 mice - / - Levels of necrosis-apoptosis-related proteins in mouse splenic dendritic cells (DCs) after in vitro stimulation and MSC-Exo treatment Western blot method for detection Step 1: PAGE gel preparation and electrophoresis Clean the glass plate with deionized water. Align the bottom of the cleaned glass plate and place it into the gel casting apparatus. Secure the glass plate with a bevel clamp, checking for gaps at the bottom. Add water and let stand for 20 minutes, checking for leaks. Prepare the electrophoresis buffer and electrotransfer buffer. Discard the liquid inside the glass plate. Mix equal volumes of separating gel A and separating gel B to obtain mixture one. Add 1% (1% by volume) of 10% ammonium persulfate to mixture one, then vortex to obtain the separating gel. Place the separating gel in the middle layer of the glass plate and seal with pure water for 20 minutes. After the separating gel solidifies, observe whether the interface between the separating gel and water is flush. Discard the liquid inside the plate. Add stacking gel A and stacking gel... Mix equal volumes of solution B to obtain mixture two. Add 1% (1% by volume) of 10% ammonium persulfate to mixture two, then vortex to obtain a stacking gel. Add the stacking gel to the middle layer of a glass plate, remove air bubbles, and slowly insert the comb vertically. After the upper gel solidifies, add electrophoresis buffer to the gel casting apparatus, and slowly pull out the comb vertically. Add equal amounts of protein sample to the sample wells, with 20 μg of protein added to each well. Add 5 μL and 2.5 μL of pre-stained protein marker to the wells at both ends of the sample, respectively. Transfer the gel casting apparatus and glass plate to the electrophoresis tank, add an appropriate amount of electrophoresis buffer, connect the power supply and set the parameters, adjusting the voltage to 180V and the electrophoresis time to 50 min.

[0023] Step 2, Transfer membrane Prepare six 7×9 cm filter papers and one 7×9 cm PVDF membrane. The PVDF membrane has a pore size of 0.45 μm and needs to be activated with methanol for 2 min before use. Remove the glass plates from the electrophoresis tank, carefully separate the two glass plates and remove the gel, and cut the gel. Immerse the filter paper, sponge pad, and gel in the electrophoresis buffer. Open the transfer clamp and place the white plates on the left and the black plates on the right. Place one sponge pad and three layers of filter paper on each side. Place the gel on the filter paper in the black clamp, and carefully cover the gel with the methanol-activated PVDF membrane, ensuring there are no air bubbles. Finally, clamp the clamp and place it in the electrophoresis tank. Fill the electrophoresis tank with electrotransfer buffer, connect the power supply and set the power parameters. Adjust the current to 200 mA and the electrophoresis time to 110 min. Keep the electrophoresis tank in ice to cool it during the entire transfer process.

[0024] Step 3, Immune Response After transfer, carefully remove the PVDF membrane and place it in TBST buffer. Wash on a shaker for 5 min, then place it in rapid blocking buffer and block on a horizontal shaker at room temperature for 10 min. After blocking, wash the PVDF membrane with TBST buffer for 5 min each time, repeating 3 times. Dilute the primary antibody: phosphorylated antibody is diluted with 5% BSA at a ratio of 1:500, and non-phosphorylated antibody is diluted with TBST buffer at a ratio of 1:1000. Place the PVDF membrane in the diluted primary antibody and incubate overnight at 4°C on a shaker. Recover the primary antibody and wash the PVDF membrane with TBST buffer, repeating 3 times for 5 min each time. Determine the species origin of the primary antibody and dilute the corresponding secondary antibody with TBST buffer at a ratio of 1:5000. Place the PVDF membrane in the corresponding secondary antibody solution and incubate on a shaker at room temperature for 1 h. After incubation, recover the secondary antibody and wash the PVDF membrane with TBST buffer, repeating 3 times for 5 min each time.

[0025] Step 4, Chemiluminescence Prepare the chemiluminescent solution by mixing solutions A and B in a 1:1 volume ratio, taking care to avoid light. Clean the background plate of the exposure unit, place the PVDF film on the background plate, and evenly drop the chemiluminescent solution onto the film. Adjust the exposure parameters and save the exposure image.

[0026] Step 5: Gel Image Analysis The exposed images were semi-quantitatively analyzed using ImageJ software to calculate and record the gray values ​​of different samples.

[0027] Experimental results: Compared with the control group, WT mice and Msr1 - / - The proportions of p-RIPK1 / RIPK1 (P < 0.01), p-RIPK3 / RIPK3 (P < 0.01), and p-MLKL / MLKL (P < 0.01) in mouse splenic dendritic cells (DCs) significantly increased after in vitro stimulation. MSC-Exo treatment significantly reduced the phosphorylation levels of RIPK1 (P < 0.01), RIPK3 (P < 0.01), and MLKL (P < 0.01). Furthermore, in the in vitro stimulation group, Msr1... - / - The levels of p-RIPK1 (P<0.01), p-RIPK3 (P<0.05), and p-MLKL (P<0.01) in the spleen DCs of mice were significantly lower than those in the WT mouse stimulation group.

[0028] The results showed that MSR1 gene knockout significantly reduced the phosphorylation level of necrosis-apoptosis-related proteins in dendritic cells (DCs) during sepsis. See the attached instructions for further details. Figure 1 .

[0029] Experiment 2: Flow cytometry was used to detect the relationship between WT mice and Msr1. - / - The proportion of dendritic cells (DCs) in mouse spleen after in vitro stimulation and MSC-Exo treatment. Experimental methods: Flow cytometry and SYTOX-Green staining were used to detect the relationship between WT mice and Msr1. The proportion of mouse splenic dendritic cells (DCs) undergoing necrosis and apoptosis after in vitro stimulation and MSC-Exo treatment (Annexin+7-AAD+ cells) (1) Flow cytometry analysis of the proportion of necrotic and apoptotic cells S1, after collecting cells from each group, count them at a rate of 2.5 × 10⁻⁶. 5 Cells / tubes were placed in flow cytometry tubes, and 1 ml of PBS was added to each tube to ensure that the cells were evenly distributed in the flow cytometry tube. Then, the cells were centrifuged at 1500 rpm for 5 min. S2, after discarding the supernatant, resuspend the cell pellet in 1 mL Binding Buffer and centrifuge again at 1500 rpm for 5 min. After discarding the supernatant, resuspend the cell pellet in 100 μL Binding Buffer. S3, add 5 μL Annexin V and 2.5 μL 7-AAD dye to each flow cytometry tube. After adding the reagents, gently tap the tube wall to disperse the cells evenly. Incubate at room temperature in the dark for 15 min. S4, set up double negative tubes (without Annexin V and 7-AAD), single-stained tubes (with only Annexin V) and single-stained tubes (with only 7-AAD) as controls; S5, after incubation, add 200 μL of Binding Buffer to each tube, gently tap the tube wall to mix, and then analyze the necrotic and apoptotic cells (Annexin V) on the instrument. + 7-AAD + The proportions were determined; the data for each group were further analyzed using FlowJo V 10.0 software.

[0030] (2) Flow cytometry analysis of the proportion of peripheral blood immune cells S1, mouse peripheral blood mononuclear cells were isolated and counted, at a ratio of 3 × 10⁻⁶. 5 Cells / tubes were placed in flow cytometry tubes, and 1 ml of PBS was added to each tube to ensure that the cells were evenly distributed in the flow cytometry tube. Then, the cells were centrifuged at 1500 rpm for 5 min and the supernatant was discarded. S2, after discarding the supernatant, resuspend the cell pellet in 1 mL PBS, and centrifuge again at 1500 rpm for 5 min. Repeat twice, and then resuspend the cell pellet in 200 μL PBS. S3, add 1 μL LCD3 flow cytometry antibody and 1 μL LCD4 flow cytometry antibody to each flow cytometry tube. After adding the reagents, gently tap the tube wall to disperse the cells evenly. Incubate at room temperature in the dark for 30 min. S4, set up double negative tubes (without CD3 flow cytometry antibody and CD4 flow cytometry antibody), single staining tubes (with only CD3 flow cytometry antibody) and single staining tubes (with only CD4 flow cytometry antibody) as controls; S5. After incubation, add 1 mL of PBS to each tube for resuspending, and then centrifuge at 1500 rpm for 5 min. S6. Prepare FOXP3 fixation / permeation buffer (1X) and FOXP3 permeation buffer (1X). Mix FOXP3 fixation / permeation buffer (4X) with fixation / permeation diluent at a ratio of 1:3 to obtain FOXP3 fixation / permeation buffer (1X); mix FOXP3 permeation buffer (10X) with deionized water at a ratio of 1:9 to obtain FOXP3 permeation buffer (1X). S7. Discard the supernatant in the flow cytometry tubes treated in step S5, and then add 500 μL of FOXP3 fixation / permeabilization buffer (1X) to each flow cytometry tube and incubate at 4°C for 14 ± 2 h. S8. After the cell permeabilization incubation is complete, wash the cells twice with FOXP3 permeabilization buffer (1X), then resuspend the cell pellet with 200 μL FOXP3 permeabilization buffer (1X), blow well, add 1.5 μL of Foxp3 flow cytometry antibody per tube, and incubate at room temperature in the dark for 1 h. S9, after incubation, cells were resuspended in 1 mL of FOXP3 permeabilization buffer (1X), followed by centrifugation at 1500 rpm for 5 min. The supernatant was discarded, and the cells were resuspended in 300 μL of PBS and analyzed. The proportions of CD3+ T cells, CD3+CD4+ T cells, and Treg cells in peripheral blood of mice in different groups were analyzed using FlowJo V 10.0 software.

[0031] (3) SYTOX-Green staining analysis of the proportion of necrotic and apoptotic cells S1, Prepare SYTOX-Green dead cell nucleic acid dye: Dilute the SYTOX-Green dead cell nucleic acid dye stock solution with DMSO at a dilution ratio of 1:10000 to achieve a final concentration of 50 nM; S2, In vitro experimental part: 100 nM SYTOX-Green dye was added during cell culture to complete the cell culture process; S3, collect cells from each group, count the cells, and then divide them into groups of 2.0 × 10⁻⁶. 6 Cells / tubes were collected in flow cytometry tubes and then centrifuged at 1500 rpm for 5 min at room temperature. The cell pellet was then resuspended in 1 mL of PBS and centrifuged again under the same conditions. This process was repeated three times. S4. After washing the cells in the flow cytometry tube, discard the supernatant completely, resuspend the cell pellet in 60-70 μL of PBS, and pipette repeatedly to mix the cells to obtain a cell suspension. S5, take 35μL of cell suspension and drop it onto a glass slide, cover it with a coverslip, lay it flat in a humidified chamber, and send it for examination and imaging; S6. Observe and photograph SYTOX-Green stained positive cells using a fluorescence microscope, and use ImageJ software to count and analyze the proportion of stained positive cells to the total number of cells in the field of view.

[0032] Experimental results: Compared with the control group, WT mice and Msr1 - / - The proportion of necrotic apoptosis in mouse splenic dendritic cells (DCs) significantly increased after in vitro stimulation (flow cytometry / SYTOX-Green staining: WT, P < 0.0001; Msr1- / -, P < 0.0001). MSC-Exo treatment significantly reduced the proportion of necrotic apoptosis in WT mouse splenic DCs (flow cytometry / SYTOX-Green staining: P < 0.0001), while Msr1- / -... - / - Only the SYTOX-Green staining results in the splenic dendritic cells (DCs) of mice showed statistical difference (P < 0.05). Furthermore, in the in vitro stimulation group, Msr1... - / - The proportion of necrotic apoptosis of dendritic cells in the spleen of mice was significantly lower than that in the WT mouse stimulation group (flow cytometry: P < 0.0001; SYTOX-Green staining: P < 0.01).

[0033] The results showed that MSR1 gene knockout significantly reduced the proportion of dendritic cells (DCs) undergoing necrotizing apoptosis during sepsis. See the attached instructions for further details. Figure 2 .

[0034] Experiment 3: Effects of MSR1 gene knockout on p-MLKL fluorescence intensity, p-RIPK3 fluorescence intensity, and the proportion of positive cells in dendritic cells under sepsis conditions, observed by laser confocal microscopy. Laser confocal microscopy imaging technology S1, after collecting cells from each group, count them at a rate of 2.0 × 10⁻⁶. 6 Cells / tubes were collected in flow cytometry tubes; S2, place the flow cytometry tube into a centrifuge and centrifuge at 1500 rpm, room temperature, and 5 min. Discard the supernatant completely, add 1 mL of PBS to resuspend the cell pellet, and centrifuge again. Repeat 3 times to wash the cells. S3, a 0.3% Trixon solution was prepared using 30 μL Trixon and 9970 μL deionized water for cell permeabilization, and the mixture was vortexed to mix. S4, Weigh 0.1g of BSA and dissolve it in 10mL of deionized water to obtain a 1% BSA solution; S5. Add 500 μL of 0.3% Trixon solution to each of the flow cytometry tubes treated in step S2. Gently tap the tube wall to mix the cells, and then let it stand at room temperature in the dark for 10 min. S6. After cell membrane rupture, the flow cytometry tubes were placed in a centrifuge at 1500 rpm and room temperature for 5 min. The cell pellet was then resuspended in 1 mL of PBS and centrifuged again. This process was repeated three times to wash the cells. S7, add 200 μL of primary antibody solution to 1% BSA solution to obtain mixed primary antibody solution; S8. Add 200 μL of mixed primary antibody solution to the flow cytometry tube treated in step S6, gently tap the tube wall to mix the cells, seal the tube with sealing film, and incubate overnight at 4°C. S9, after the primary antibody incubation is completed, remove the sealing film and place the flow cytometer tube into a centrifuge for centrifugation at 1500 rpm, room temperature, and 5 min. Resuspend the cell pellet in 1 mL PBS and centrifuge again. Repeat 3 times to wash the cells. S10, add 200 μL of secondary antibody solution to 1% BSA solution to obtain diluted mixed secondary antibody solution; S11: Add 200 μL of mixed secondary antibody solution to the flow cytometer treated in step S9, gently tap the tube wall to mix the cells, seal the tube with sealing film, and let it stand at room temperature in the dark for 1 hour. After the secondary antibody incubation is complete, remove the sealing film and place the flow cytometer tube into a centrifuge. The centrifuge speed is 1500 rpm, the centrifugation temperature is room temperature, and the centrifugation time is 5 min. Resuspend the cell pellet with 1 mL PBS and centrifuge again. Repeat 3 times to wash the cells. During this process, be careful to avoid light. At the same time, prepare glass slides and coverslips. S13: After washing the cells in the flow cytometry tube, completely discard the supernatant. Resuspend the cell pellet in 60-70 μL of PBS, pipette repeatedly to mix well, then take 35 μL of cell suspension and drop it onto a glass slide. Add 5 μL of DIL-1 solution to the cell drop, carefully cover with a coverslip, place it flat in a humidified chamber, and send it for examination and imaging.

[0035] Experimental results are as follows Figure 3 and Figure 4 As shown: Compared with the control group, the fluorescence intensity of p-MLKL and p-RIPK3 and the proportion of positive cells in the spleen DCs of WT mice were significantly increased after in vitro stimulation, and this phenomenon was significantly improved after MSC-Exo treatment. Msr1 - / - After in vitro stimulation, the fluorescence intensity of p-MLKL and p-RIPK3 in mouse spleen DCs did not show a significant upregulation, and the proportion of positive cells did not increase significantly, which was significantly lower than that in the WT mouse stimulation group.

[0036] The results showed that MSR1 gene knockout could significantly reduce the fluorescence intensity of p-MLKL and p-RIPK3 and the proportion of positive cells in dendritic cells (DCs) during sepsis.

[0037] Experiment 4: Effect of MSR1 gene knockout on the levels of necrosis- and apoptosis-related cytokines in DC culture supernatant under sepsis conditions Experimental methods: The relationship between WT mice and Msr1 was detected by ELISA. - / - The levels of necrotic apoptosis-related cytokines in the cell culture supernatant of different groups of mouse splenic DCs after in vitro stimulation and MSC-Exo treatment.

[0038] ELISA testing steps S1, Sample processing method: In the in vitro experimental part, after LPS+z-VAD combined stimulation, the culture medium was collected, and then the culture medium was placed in a centrifuge and centrifuged at room temperature at a speed of 1500 rpm for 5 min. The supernatant was then collected. S2, the level of cytokines in the cell culture supernatant was detected by ELISA kit; S3, take out the pre-coated and sealed 96-well plate, equilibrate to room temperature, add standard and specimen universal diluent to the blank wells, add 100 μL of each group of diluted cell culture supernatant to the remaining wells, seal the reaction wells with sealing tape, and incubate in a 37°C incubator for 90 min in the dark. S4. After incubation, aspirate the reaction solution in the ELISA plate and prepare the biotinylated antibody working solution 20 minutes in advance. Add 100 μL of biotinylated antibody diluted at 1:100 to the reaction wells, seal the reaction wells with sealing tape, and place them in a 37°C incubator for 60 minutes in the dark. S5, wash the plate with washing buffer, soaking for 1 minute each time, repeat 5 times; S6. After washing the plate, add 100 μL of diluted avidin labeled with peroxidase to the reaction wells. The dilution ratio is 1:100. Then seal the reaction wells with sealing tape and place them in a 37°C incubator for 30 min in the dark. S7. Wash the plate with washing buffer for 90 seconds each time, repeat 5 times. S8, add 90 μL of chromogenic substrate to the reaction well, place in a 37°C incubator, and incubate in the dark for 20 min; S9. After incubation, add 100 μL of reaction stop solution to the reaction wells, mix gently, and according to the microplate reader operation method, within 3 minutes after adding the reaction stop solution, measure the OD value of each well at a wavelength of 450 nm and calculate the concentration of the measured cytokines.

[0039] Experimental results are as follows Figure 5 As shown, compared with the control group, the levels of HMGB1, IL-1α, IL-33, LDH, and TNF-α released from the spleen DCs of WT mice were significantly upregulated after in vitro stimulation (HMGB1: P < 0.001; IL-1α: P < 0.0001; IL-33: P < 0.001; TNF-α: P < 0.0001; LDH: P < 0.0001). These cytokine levels were significantly reduced after MSC-Exo treatment (HMGB1: P < 0.0001; IL-1α: P < 0.05; IL-33: P < 0.05; TNF-α: P < 0.0001; LDH: P < 0.05). Msr1 - / - In vitro stimulation of mouse spleen DCs significantly upregulated the levels of IL-1α (P < 0.01) and TNF-α (P < 0.0001), but the levels of cytokines in the stimulation group were significantly lower than those in the WT mouse stimulation group (HMGB1: P < 0.001; IL-1α: P < 0.01; IL-33: P < 0.01; TNF-α: P < 0.001; LDH: P < 0.001).

[0040] The results showed that MSR1 gene knockout could effectively reduce the levels of DAMPs and cytokines released during necrotizing apoptosis of dendritic cells (DCs) in sepsis.

[0041] Experiment 5: Conditional knockout of the MSR1 gene significantly reduced the phosphorylation level of necrosis-associated proteins in dendritic cells (DCs) during sepsis. Experimental method: Cd11c was detected by Western blotting. cre Msr1 fl / fl Mice and Msr1 fl / fl Mouse (Cd11c) cre Msr1fl / fl Phosphorylation levels of DC necrosis and apoptosis-related proteins in mice (control mice) after CLP modeling and MSC-Exo treatment.

[0042] The Western blotting detection procedure is the same as that in Experiment 1. Experimental results are as follows Figure 6 As shown: Compared with the sham surgery group, Msr1 fl / fl The proportions of p-RIPK1 / RIPK1 (P<0.05), p-RIPK3 / RIPK3 (P<0.01), and p-MLKL / MLKL (P<0.01) in mouse splenic dendritic cells (DCs) significantly increased after CLP modeling, while MSC-Exo treatment significantly reduced the phosphorylation levels of RIPK1 (P<0.05), RIPK3 (P<0.05), and MLKL (P<0.01) in Cd11c. cre Msr1 fl / fl There were no statistically significant differences in the phosphorylation levels of related proteins among the sham-operated group, sepsis group, and treatment group in mice. Furthermore, the Cd11c levels in the sepsis group... cre Msr1 fl / fl The levels of p-RIPK1 (P < 0.05), p-RIPK3 (P < 0.05), and p-MLKL (P < 0.01) in the splenic dendritic cells of mice were significantly lower than those in sepsis-induced Msr1. fl / fl Mice.

[0043] The results showed that conditional knockout of the MSR1 gene significantly reduced the phosphorylation level of necrotizing apoptosis-related proteins in dendritic cells (DCs) during sepsis.

[0044] Experiment 6: Conditional knockout of the MSR1 gene significantly reduced the proportion of necrotizing apoptosis in dendritic cells (DCs) of septic mice. Experimental methods: Msr1 was detected by flow cytometry. fl / fl Mice and Cd11c cre Msr1 fl / fl The proportion of necrotic apoptosis of splenic dendritic cells (Annexin+7-AAD+ cells) in mice after CLP modeling and MSC-Exo treatment.

[0045] The flow cytometry procedure in this experiment is the same as that in Experiment 2, where the proportion of necrotic and apoptotic cells was analyzed by flow cytometry.

[0046] Experimental results are as follows Figure 7 As shown: Compared with the sham surgery group, Msr1 fl / fl Mice and Cd11c cre Msr1 fl / fl In mice, the proportion of necrotic apoptosis of splenic dendritic cells (DCs) was significantly increased after CLP modeling (Msr1).fl / fl P < 0.0001; Cd11c cre Msr1 fl / fl (P < 0.001) MSC-Exo treatment significantly reduced Msr1 fl / fl The proportion of necrotic apoptosis of dendritic cells (DCs) in the spleen of mice was significantly lower than that in Cd11c (P < 0.0001). cre Msr1 fl / fl There was no statistically significant difference between the treatment group and the sepsis group in mice. Furthermore, the sepsis group showed Cd11c... cre Msr1 fl / fl The proportion of necrotic apoptotic dendritic cells (DCs) in the spleen of mice was significantly lower than that in the sepsis group (Msr1). fl / fl In mice, the difference was statistically significant (P < 0.0001).

[0047] The results showed that conditional knockout of the MSR1 gene significantly reduced the proportion of necrotizing apoptosis in dendritic cells (DCs) of septic mice.

[0048] Experiment 7: Conditional knockout of the MSR1 gene significantly reduced the fluorescence intensity of p-MLKL and p-RIPK3 and the proportion of positive cells in splenic dendritic cells during sepsis. Experimental method: Msr1 was observed using a laser confocal microscope. fl / fl Mice and Cd11c cre Msr1 fl / fl The fluorescence intensity of p-MLKL and p-RIPK3 and the proportion of positive cells in the spleen DCs of mice after CLP modeling and MSC-Exo treatment.

[0049] The observation procedure for this laser confocal microscope is the same as the procedure for the laser confocal microscope imaging technique in Experiment 3. Experimental results are as follows Figure 7 and Figure 8 As shown: Compared with the sham surgery group, Msr1 fl / fl The fluorescence intensity of p-MLKL and p-RIPK3 and the proportion of positive cells in the splenic dendritic cells (DCs) of mice were significantly increased after CLP modeling, and this phenomenon was significantly improved after MSC-Exo treatment. cre Msr1 fl / fl In mice with CLP modeling, the fluorescence intensity of p-MLKL and p-RIPK3 in splenic DCs was slightly upregulated, and the proportion of positive cells was slightly increased, but still significantly lower than that of Msr1 in the sepsis group. fl / fl Mouse level. Furthermore, Cd11c cre Msr1 fl / fl No significant differences were observed in the fluorescence intensity of p-MLKL and p-RIPK3 and the proportion of positive cells in the splenic DCs between the treatment group and the sepsis group in mice.

[0050] The results showed that conditional knockout of the MSR1 gene could significantly reduce the fluorescence intensity of p-MLKL and p-RIPK3 and the proportion of positive cells in splenic DCs during sepsis.

[0051] Experiment 8: Conditional knockout of the MSR1 gene effectively reduced the levels of necrotizing apoptosis-related DAMPs and cytokines in the serum of septic mice. Experimental method: Msr1 was detected by ELISA. fl / fl Mice and Cd11c cre Msr1 fl / fl The levels of necrosis-apoptosis-related cytokines in the serum of different groups of mouse splenic DCs after CLP modeling and MSC-Exo treatment were measured by ELISA using the same procedure as in Experiment 4.

[0052] Experimental results are as follows Figure 10 As shown: Compared with the sham surgery group, Msr1 fl / fl In mice with CLP modeling, serum levels of HMGB1, IL-1α, IL-33, LDH, and TNF-α were significantly upregulated (HMGB1: P < 0.0001; IL-1α: P < 0.0001; IL-33: P < 0.01; TNF-α: P < 0.0001; LDH: P < 0.0001). In Msr1fl / fl mice treated with MSC-Exo, serum levels of all cytokines were significantly decreased (HMGB1: P < 0.05; IL-1α: P < 0.01; IL-33: P < 0.05; TNF-α: P < 0.001; LDH: P < 0.01). Cd11c cre Msr1 fl / fl After mouse modeling, IL-1α (P < 0.01) and LDH (P < 0.05) levels were statistically significantly different from the sham-operated group, while there was no statistically significant difference between the treatment group and the sepsis group. Furthermore, although Cd11c levels were significantly lower after CLP modeling... cre Msr1 fl / fl The levels of IL-1α and LDH in mice were elevated, but still significantly lower than those in the sepsis group (Msr1). fl / fl Mouse levels (HMGB1: P < 0.05; IL-1α: P < 0.01; IL-33: P < 0.05; TNF-α: P < 0.01; LDH: P < 0.05).

[0053] The results showed that conditional knockout of the MSR1 gene could effectively reduce the levels of necroptosis-associated DAMPs and cytokines in the serum of septic mice.

[0054] The above experiments were performed using Graphpad Prism 9.0 software for statistical graphing and data analysis. Quantitative data are expressed as mean ± standard deviation (x ± s). Data from all groups were normally distributed with homogeneous variances. ANOVA was used for analysis among multiple groups, with Tukey's post-hoc test used for pairwise comparisons. P < 0.05 was considered statistically significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. All experimental results were repeated at least three times.

[0055] The embodiments described above are merely preferred embodiments of the present invention and should not be construed as limiting the scope of protection of the present invention. Any non-substantial changes and modifications made by those skilled in the art based on the invention shall fall within the scope of protection of the present invention.

Claims

1. The application of an agent that knocks out MSR1 gene expression in the preparation of a product for treating sepsis, wherein the agent is gRNA-B1 and gRNA-B2; the sequence of gRNA-B1 is: GGCCTTTGCACGTGAAGAGGAGG; the sequence of gRNA-B2 is: ACTTTGGGGAAATAAGGTACAGG, and the agent inhibits necrotizing apoptosis of dendritic cells in sepsis.

Citation Information

Patent Citations

  • Application of inhibitor of SAP130 in preparation of medicine for treating and / or preventing sepsis acute kidney injury

    CN117838862A