Single-tube nested PCR (Polymerase Chain Reaction) specific primer probe for detecting southern corn rust and detection method

Abstract

The invention discloses a single-tube nested PCR (Polymerase Chain Reaction) specific primer probe for detecting southern corn rust disease and a detection method of the single-tube nested PCR specific primer probe. The single-tube nested PCR specific detection primer probe is used as an inner primer pair of puccinia multiflora, the nucleotide sequence of an upstream primer of the inner primer pair is as shown in SEQ ID NO.3, and the nucleotide sequence of a downstream primer of the inner primer pair is as shown in SEQ ID NO.4. The method comprises the following steps: carrying out single-tube nested PCR (Polymerase Chain Reaction) amplification by taking puccinia multiflora genome DNA or positive plasmid DNA as a template, then carrying out immunochromatography nucleic acid test strip detection on an amplification product, and carrying out result visual judgment through a test strip. The method has high sensitivity, meanwhile, the identification time of puccinia multiflora can be shortened through the detection system, and the problems that a traditional identification method is tedious in step, long in identification period and the like are solved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a single-tube nested PCR specific primer probe for detecting southern corn rust and a detection method. Background Art

[0002] Southern cornrust, caused by Puccinia polysora, is a worldwide fungal disease of plants, characterized by long-distance airborne transmission and strong re-infection ability. Conventional PCR, fluorescent quantitative PCR and conventional nested PCR are the commonly used methods for the detection and identification of southern cornrust. Conventional PCR has a low sensitivity, and the minimum detection limit for the genome of Puccinia polysora is generally 10-100pg / uL; the minimum detection limit of fluorescent quantitative PCR is 1pg / μL; the minimum detection limit of conventional nested PCR established in our laboratory is 10fg / μL, which is 100 times that of fluorescent quantitative detection. Southern cornrust is explosive, which requires monitoring and detection of pathogens in leaves in the early stage of southern cornrust in the field. However, the lower the proportion of pathogens in the leaves in the early stage, the higher the detection sensitivity required. At present, conventional nested PCR technology has the highest detection sensitivity, but this method requires two rounds of amplification, involving two sample addition operations, which increases the risk of cross-contamination. Single-tube nested PCR is based on conventional nested PCR, with special designs for inner and outer primers. The outer primers and inner primers are placed in the same tube PCR system at the same time, and the outer primers are amplified first by controlling the higher annealing temperature. After several cycles (the first PCR), the annealing temperature is lowered to allow the inner primers to perform nested amplification using the first PCR product as a template. Since the single-tube nested PCR amplification is performed in the same tube, the risk of contamination is reduced. Therefore, the single-tube nested PCR detection technology has the specificity and sensitivity of conventional nested PCR detection technology, and can also shorten time, save costs, and reduce the risk of contamination. At present, the single-tube nested PCR detection technology has been applied in the detection of pathogens. However, this technology has not been reported on polypile rust. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art in order to detect Puccinia multipilosa more quickly, accurately and practically. The present invention provides a primer probe specific for Puccinia multipilosa, which uses Puccinia multipilosa genomic DNA or positive plasmid DNA as a template for single-tube nested PCR amplification, and then performs immunochromatographic nucleic acid test strip detection on the amplified product, and the test strip is used to judge the result. The method is fast and simple, highly sensitive, highly specific, low cost and visual.

[0004] The present invention first provides a single-tube nested PCR specific primer probe for southern corn rust, characterized in that the nucleic acid sequence of the upstream primer of the inner specific primer probe is shown as SEQ ID NO.3; the nucleic acid sequence of the downstream primer of the inner specific primer probe is shown as SEQ ID NO.4.

[0005] Specifically, the sequence of the inner specific primer probe is as follows:

[0006] NX-F: Biotin-GTCATGAAACCCTTCTCA (SEQ ID NO.3)

[0007] NX-R: 6-FAM-GTCAATCCACTCCATCTG (SEQ ID NO.4)

[0008] In one embodiment of the present invention, during the detection process of single-tube nested PCR, the nucleic acid sequence of the upstream primer of the outer primer is as shown in SEQ ID NO.1; the nucleic acid sequence of the downstream primer of the outer primer is as shown in SEQ ID NO.2.

[0009] Specifically, the sequence of the outer primer is as follows:

[0010] NX255-F:GAACGCACCTTGCACCTTT(SEQ ID NO.1)

[0011] NX255-R:AAGCTCCAAGAACTTCCTCCTC(SEQ ID NO.2)

[0012] Another object of the present invention is to provide a single-tube nested PCR detection method for southern corn rust with good specificity, high sensitivity, simple operation and visualization.

[0013] The single-tube nested PCR detection method for southern corn rust provided by the present invention uses the DNA of a sample to be tested as a template, applies the outer primers and the inner specific primer probes, performs PCR amplification in the same PCR tube, and detects the PCR product with an immunochromatographic nucleic acid test strip. If the quality control line and the detection line appear at the same time, the sample to be tested contains multiple piles of handle rust fungi; if only the quality control line appears, the sample to be tested does not contain multiple piles of handle rust fungi; if only the detection line appears, the result is invalid, and the test strip needs to be replaced for re-testing.

[0014] Preferably, when using the inner specific primer probe for amplification, the reaction procedure is pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 7 min.

[0015] Preferably, when amplification is performed using outer primers and inner specific primer probes, the reaction procedure is pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 25 s, extension at 72°C for 25 s, 20 cycles; extension at 72°C for 7 min; pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 15 s, 35 cycles; extension at 72°C for 7 min.

[0016] Preferably, when the outer primer and the inner specific primer probe are used for amplification, the reaction system is 20 μL, including 10 μL of 2*EasyTaq superMix, 0.4 μM of the nucleotide shown in SEQ ID NO.1 in the sequence list and 0.3 μL of the nucleotide primer shown in SEQ ID NO.2 in the sequence list, 10 μM of the nucleotide shown in SEQ ID NO.3 in the sequence list and 0.3 μL of the nucleotide primer shown in SEQ ID NO.4 in the sequence list, 1 μL of the sample DNA to be tested, and ddH 2 0 to 20 μL. Compared with the existing invention technology, the advantages of the present invention are:

[0017] (1) The primer probe specific to Puccinia multipilosa and the single-tube nested PCR detection method provided by the present invention can specifically detect Puccinia multipilosa, while no bands can be detected in the DNA of other test strains. The experiment proved that the sensitivity of the method for detecting the positive plasmid DNA of Puccinia multipilosa is 0.1 fg / μL, and 4.61×10 -1 The DNA of individual summer spores has high sensitivity and specificity; it is easy to operate, has short detection time, low detection cost, and visualized results, and is suitable for batch detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] (1) Figure 1 The electrophoresis diagram and nucleic acid test strip results of the specific verification of polysora polysora of the present invention are shown in the figure; wherein: M: DL500 marker; 1: positive plasmid DNA; 2: polysora polysora; 3: sorghi polysora; 4: poplar leaf rust pathogen M. laricipopulina; 5: maize flat navel worm spore B. maydis; 6: large spot convex navel worm spore E. turcicum; 7: tenuissima A. tenuissima; NC: ddH 2 O.

[0019] (2) Figure 2 The electrophoresis diagram and nucleic acid test strip results of the sensitivity detection of multiple piles of Puccinia gracilis positive plasmid DNA as templates in the present invention; wherein M: DL500 marker; 1-13: 10 6 , 10 5 , 104 , 10 3 , 10 2 , 10, 1, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 fg / μL positive plasmid DNA; NC: ddH 2 O.

[0020] (3) Figure 3 The electrophoresis diagram and nucleic acid test strip results of the sensitivity detection of the present invention using different numbers of multiple piles of Puccinia uredus spore DNA as templates; M: DL500 marker; 1-7: 7.2×10 3 , 1.44×10 3 , 2.88×10 2 , 5.76×10, 11.52, 2.30, 4.61×10 -1 Summer spores, NC: ddH 2 O. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited to the following embodiments. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention.

[0022] Example 1 Design and synthesis of multiple nested PCR primer sets for Puccinia repens

[0023] The ITS region sequence of Puccinia polysora was downloaded from NCBI, and the rust fungi with high homology ratio with Puccinia polysora were retrieved and downloaded from the Genbank database. The selected strain sequences were compared and analyzed by Blastn. According to the principle of single-tube nested PCR primer design: the annealing temperature of the outer primer is generally about 10°C higher than that of the inner primer, the southern rust-specific primers NX255-F / NX255-R designed by Ma Hongxia et al. were selected as outer primers; two specific primers NX-F and NX-R were designed as inner primer probes in the sequence variation region using the primer design software Primer Premier 6. The primer set sequence is shown below:

[0024] NX255-F:GAACGCACCTTGCACCTTT(SEQ ID NO.1)

[0025] NX255-R:AAGCTCCAAGAACTTCCTCCTC(SEQ ID NO.2)

[0026] NX-F: Biotin-GTCATGAAACCCTTCTCA (SEQ ID NO.3)

[0027] NX-R: 6-FAM-GTCAATCCACTCCATCTG (SEQ ID NO.4)

[0028] Example 2 Establishment of a single-tube nested PCR detection method for multiple piles of Puccinia

[0029] (1) The freeze-thaw method was used to extract DNA from multiple piles of Puccinia pygione summer spores; a genome extraction kit was used to extract genomic DNA from multiple piles of Puccinia pygione, corn leaf samples to be tested in the field, and corn leaves that were not inoculated in the greenhouse, and the concentration was determined for later use.

[0030] (2) Using the above extracted DNA as a template, the primer set designed in Example 1 was used to configure the reaction system and set the PCR reaction program. The specific operation steps are as follows:

[0031] a Take out each component in the kit, melt it on ice, and centrifuge it for standby use;

[0032] b According to the number of samples to be tested and controls, take the corresponding reagents and the primer set designed in Example 1 according to the ratio shown in Table 1, mix them thoroughly to form a PCR premix, centrifuge them instantaneously and set aside.

[0033] Table 1 Configuration of PCR premix

[0034]

[0035] c Prepare 0.2 mL PCR tubes according to the number of samples and controls to be tested, and add 19 μL of PCR premix to each PCR tube.

[0036] d. Pipette 1 μL of the sample to be tested and the control into the corresponding PCR tube, cover the tube, centrifuge briefly, and transfer to the PCR amplifier.

[0037] eSet the reaction system to 20 μL;

[0038] f The reaction program was set as 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 65℃ annealing for 25 s, 72℃ extension for 25 s, 20 cycles; 72℃ extension for 7 min; 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 7 min. .

[0039] 3) Analysis of immunochromatographic test strips and electrophoresis results

[0040] a Take 5-10 μL of the amplified product and add ddH 2 O dilute 10-20 times, take 80 μL of the diluted reaction product and drop it into the sample well, and record the test results in the reading area within 15 minutes;

[0041] b Take 5 μL of the amplified product and analyze it by 2.0% agarose gel electrophoresis, using DL500bp Marker as a reference.

[0042] 4) Result determination

[0043] ① Determination of immunochromatographic test strip results

[0044] aIf the control line and the test line appear at the same time, the sample to be tested contains multiple piles of Puccinia;

[0045] b. If only the quality control line appears, the sample to be tested does not contain multiple piles of Puccinia or the content of multiple piles of Puccinia is below the detection limit;

[0046] cIf only the test line appears, the result is invalid and the test strip needs to be replaced and retested.

[0047] ② Electrophoresis result determination

[0048] a A 155 bp specific band appeared in the positive control, but no specific band appeared in the negative control and blank control;

[0049] b The presence of a 155 bp specific band in the sample to be tested indicates that the sample to be tested contains multiple piles of Puccinia gracilis;

[0050] c No specific bands appeared in the sample to be tested, indicating that the sample to be tested did not contain multiple piles of Puccinia gracilis.

[0051] Example 3 Specific detection of multiple piles of Puccinia by single-tube nested PCR

[0052] The single-tube nested PCR detection method established in Example 2 was used to perform single-tube nested PCR amplification on DNA templates such as the positive plasmid of Puccinia polysora; Puccinia polysora; Puccinia sorghi; M. laricipopulina; B. maydis; E. turcicum; A. tenuissima. The amplification results were interpreted by electrophoresis and immunochromatography nucleic acid test strips, respectively. The results are as follows: Figure 1 As shown. Figure 1 It can be seen that the method of the present invention can only detect the positive plasmid of Puccinia multistoles and Puccinia multistoles, while other fungi and blank controls were not amplified.

[0053] Example 4 Sensitivity of single-tube nested PCR for detecting multiple piles of Puccinia gracilis positive plasmids

[0054] Multiple piles of Puccinia positive plasmid DNA were diluted into 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 1, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 fg / μL, as a template, the single-tube nested PCR detection method established in Example 2 was used for amplification, and ddH 2 O is the blank control, and the amplification results are read by electrophoresis and immunochromatography nucleic acid test strips. Figure 2 As shown. Figure 2 It can be seen that the minimum detection limit of the established single-tube nested PCR-electrophoresis test is 1 fg / μL, and the minimum detection limit of the single-tube nested PCR-test strip is 0.1 fg / μL.

[0055] Example 5 Sensitivity of single-tube nested PCR for detecting different numbers of piles of Puccinia uredia spores

[0056] 7.2×10 3 The DNA of uredus was diluted 5 times in a gradient, so that the number of uredus was 1.44×10 3 , 2.88×10 2 , 5.76×10, 11.52, 2.30, 4.61×10 -1 , with ddH 2 O is a blank control, and the single-tube nested PCR detection method established in Example 2 is used for amplification. The amplification results are interpreted by electrophoresis and immunochromatography nucleic acid test strips, respectively. The results are as follows Figure 3 As shown. Figure 3 It can be seen that the minimum detection limit of the established single-tube nested PCR-electrophoresis test is 11.52 summer spore DNAs, and the minimum detection limit of the single-tube nested PCR-test strip is 4.61×10 -1 Summer spore DNA.

Claims

1. A single-tube nested PCR specific primer probe for southern corn rust, characterized in that: The nucleic acid sequence of the upstream primer of the inner specific primer probe is shown in SEQ ID NO.3; the nucleic acid sequence of the downstream primer of the inner specific primer probe is shown in SEQ ID NO.

4.

2. The single-tube nested PCR specific primer probe for southern corn rust as claimed in claim 1, characterized in that: During the detection process of single-tube nested PCR, the nucleic acid sequence of the upstream primer of the outer primer is shown as SEQ ID NO.1; the nucleic acid sequence of the downstream primer of the outer primer is shown as SEQ ID NO.

2.

3. A single-tube nested PCR detection method for southern corn rust, characterized in that: Extract the DNA of the sample to be tested; use the DNA of the sample to be tested as a template and perform PCR amplification using the specific primer probe described in claim 1 or a combination of the outer primers and the specific primer probe described in claim 2 and claim 1; detect the amplification product using a nucleic acid test strip to determine whether the sample contains multiple piles of Puccinia.

4. The method according to claim 3, characterized in that: When using the inner specific primer probe for amplification, the reaction procedure is pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for another 7 min.

5. The method according to claim 3, characterized in that: When amplification is performed using outer primers and inner specific primer probes, the reaction procedure is pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 25 s, extension at 72°C for 25 s, 20 cycles; further extension at 72°C for 7 min; pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 15 s, 35 cycles; further extension at 72°C for 7 min.

6. The method according to claim 3, characterized in that: When using outer primers and inner specific primer probes for amplification, the reaction system is 20μL, including 2*EasyTaq superMix 10μL, 0.4μM of the nucleotide shown in SEQ ID NO.1 in the sequence list and 0.3μL of the nucleotide primer shown in SEQ ID NO.2 in the sequence list, 10μM of the nucleotide shown in SEQ ID NO.3 in the sequence list and 0.3μL of the nucleotide primer shown in SEQ ID NO.4 in the sequence list, 1μL of the sample DNA to be tested, and 7.8μL of ddH2O.

7. The method according to claim 3, characterized in that: By subjecting the single-tube nested PCR amplification reaction product of the tested sample to nucleic acid test strip detection, if the quality control line and the detection line appear at the same time, the tested sample contains multiple piles of Puccinia; if only the quality control line appears, the tested sample does not contain multiple piles of Puccinia or the content of multiple piles of Puccinia is below the detection limit; if only the detection line appears, the result is invalid and the test strip needs to be replaced for re-testing.

Images