Compositions, kits, uses thereof, and methods

Abstract

A composition, kit, use and method thereof. The primer, the probe and the corresponding detection reagent system are designed on a BK virus specific sequence, compared with an existing ELISA detection method, the detection sensitivity and the window period are greatly improved, meanwhile, the primer and probe design effectively avoids the conditions of missing detection and false positive detection, and extremely high detection sensitivity and specificity are achieved. Meanwhile, the operation is simple, the detection is quick, the detection timeliness is good, and a good quick detection scheme is particularly provided for clinical conditions such as sudden hyperpyrexia of transplanted (organ transplantation or cell transplantation) patients.

Description

Technical Field

[0001] The present application generally relates to the field of biotechnology, and more particularly to a composition, a kit, uses thereof, and a method for detecting BK virus using qPCR. Background Art

[0002] BK virus (BKV, also known as BKPyV) is a member of the Polyomavirus genus of the Polyomaviridae family, and its genome is a double-stranded DNA molecule. The virus can cause kidney, lung, eye and brain diseases. It is also associated with hemorrhagic cystitis and nephritis in solid organ or bone marrow transplant recipients. BK virus is common in solid organ transplant patients, especially in heart and kidney transplant patients, and it may induce more severe end-stage renal failure than expected. In the liver, heart or kidney transplant patient population, 6% of solid organ transplant recipients have BK viremia and 9% have BK viruria. Kidney or heart transplant recipients are more susceptible to viremia and viruria than liver transplant recipients. Creatine liver levels are highest in patients with BK viremia (3.5 mg / dL), intermediate in patients with BK viruria (1.9 mg / dL), and lowest in patients who do not carry BK virus (1.3 mg / dL). The initial infection of BK virus occurs in infancy. BKV antibodies can be detected in 50% of children at the age of 3, and almost all children are infected before the age of 10. The virus was first isolated from a urine specimen of a kidney transplant recipient in 1971 and named BK virus after the initials of the patient's name. Its serum antibody positivity peaks in early childhood (60%-100%). Epidemiological surveys in various countries have shown that the peak positivity rate of BK virus serum antibodies in British infants is 83%, 60% in Finland, 71% in Germany, 83% in Italy, and 69% in the United States. The reason for the different serum antibody positivity rates in various countries is related to the age of the subjects and the positive antibody titer threshold.

[0003] Virus-related diseases caused by primary infection and virus reactivation involve the kidneys, lungs, eyes, liver, and brain. The kidney is the most common site of BKPyV latent infection, which can be confirmed by immunohistochemistry (IHC) and in situ hybridization (ISH) methods; the brain is the second most common site of BKPyV latent infection, and peripheral blood leukocytes may also be the site of viral latency. Primary BK virus infection can cause various renal diseases, including hemorrhagic and non-hemorrhagic cystitis in immunocompetent and immunocompromised patients. The most common site of BKPyV reactivation is the kidney, and bone marrow transplant and allogeneic kidney transplant recipients may present with hematuria and hemorrhagic cystitis. It should be noted that acute, delayed, and chronic hemorrhagic cystitis are most closely related to BK virus, while transient cystitis that occurs in the early stage is often secondary to cyclophosphamide treatment. In patients with allogeneic kidney transplants, BK virus can cause ureteral stenosis and tubulointerstitial nephritis. The diagnosis of BK virus kidney disease mainly relies on renal biopsy and urine confirmation of BK virus. Due to the lack of effective antiviral treatment for BK virus, it is particularly important to continuously and effectively monitor BK virus infection. At present, the detection of BK virus infection mainly uses enzyme-linked immunosorbent assay (ELISA) to detect the antibody titer of BK virus, but this method has a slow detection speed and poor specificity. Therefore, the development of PCR-based BKV detection reagents can effectively increase the detection window period and sensitivity, while improving the timeliness of detection. Summary of the invention

[0004] Based on this, the present application provides a composition for BK virus detection, comprising:

[0005] An upstream bait oligonucleotide and a downstream bait oligonucleotide, wherein the upstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO: 1, and the downstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO: 2.

[0006] In another aspect, the present application also provides a kit comprising the composition described herein.

[0007] In another aspect, the present application also provides use of the composition described herein or the kit described herein in detecting BK virus.

[0008] In another aspect, the present application also provides use of the composition described herein or the kit described herein in detecting BK virus using a qPCR method.

[0009] On the other hand, the present application also provides a method for detecting BK virus using qPCR, comprising:

[0010] The composition described herein or the kit described herein is used to perform qPCR on the sample to be tested on a qPCR instrument, and the presence or absence of BK virus in the sample is determined based on the result of qPCR.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] (1) This application provides a new set of primers and probe combinations that can be used for high-sensitivity detection of BK virus, up to 100 copies / mL;

[0013] (2) Compared with traditional technologies, this application has greatly improved the sensitivity and window period of detection. At the same time, the primer probe design effectively avoids missed detection and false positive detection, and has extremely high detection sensitivity and specificity;

[0014] (3) It is simple to operate, has rapid detection, and has good detection timeliness, especially providing a good rapid detection solution for clinical situations such as sudden high fever in transplant patients (organ transplant or cell transplant).

[0015] Other features and advantages of the present application will be described in the following description, and partly become apparent from the description, or be understood by implementing the present application. Other advantages of the present application can be realized and obtained by the schemes described in the description and the drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The accompanying drawings are used to provide an understanding of the technical solution of the present application and constitute a part of the specification. Together with the embodiments of the present application, they are used to explain the technical solution of the present application and do not constitute a limitation on the technical solution of the present application.

[0017] Figure 1 This is a diagram of the amplification results in Example 1 of the present application. From left to right, it shows the amplification of the primer probe provided by the present application and the amplification of the randomly selected designed primer probe.

[0018] Figure 2 1×10 3 The samples contained 100 copies / mL, 500 copies / mL, 200 copies / mL, and 100 copies / mL.

[0019] Figure 3 This is a diagram of the amplification results of the blood sample in Example 3 of the present application, wherein from left to right are the positive control product and the blood sample.

[0020] Figure 4This is a diagram of the amplification results of the urine sample in Example 3 of the present application, wherein from left to right are the positive control product and the urine sample. DETAILED DESCRIPTION

[0021] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the application belongs. When a certain amount, concentration or other value or parameter is expressed in the form of a range, a preferred range, or a preferred upper numerical limit and a preferred lower numerical limit, it should be understood that it is equivalent to specifically revealing any range by combining any pair of upper range limits or preferred numerical values ​​with any lower range limit or preferred numerical value, regardless of whether the range is specifically disclosed. Unless otherwise stated, the numerical ranges listed herein are intended to include the endpoints of the range and all integers and fractions (decimals) within the range.

[0022] The terms "about" and "approximately" when used with a numerical variable generally refer to the value of that variable and all values ​​of that variable are within experimental error (e.g., within a 95% confidence interval of the mean) or within ±10% of the specified value, or a wider range.

[0023] The expression "comprising" or its synonymous similar expressions "including", "containing" and "having" etc. are open-ended and do not exclude additional unrecited elements, steps or ingredients. The expression "consisting of excludes any element, step or ingredient not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps or ingredients, plus the optional elements, steps or ingredients that do not materially affect the basic and novel characteristics of the claimed subject matter. It should be understood that the expression "comprising" encompasses the expressions "consisting essentially of" and "consisting of".

[0024] The expression "at least one" or "one or more" means 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

[0025] Unless otherwise specified, “nM” in this article refers to “n mol / L”, “μM” refers to “μmol / L”, and “mM” refers to “mmol / L”.

[0026] In one aspect, the present application provides a composition for BK virus detection, comprising:

[0027] An upstream bait oligonucleotide and a downstream bait oligonucleotide, the upstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0028] In some embodiments, the upstream decoy oligonucleotide is derived from at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0029] In some embodiments, the upstream decoy oligonucleotide is derived from at least 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0030] In some embodiments, the upstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0031] In some embodiments, the upstream decoy oligonucleotide is derived from at least 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0032] In some embodiments, the upstream bait oligonucleotide is the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is the sequence shown in SEQ ID NO:2.

[0033] In various aspects disclosed elsewhere herein, the decoy oligonucleotide may be referred to as a "primer," "oligonucleotide primer," or "nucleic acid primer." The primer may be a deoxyribonucleic acid or a ribonucleic acid. The primer may comprise one or more non-natural nucleotides. The non-natural nucleotide may be, for example, deoxyinosine. The primer may be a forward primer. The primer may be a reverse primer. The primer may be about 5 to about 50 nucleotides in length. The primer may be at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 or more base pairs in length. The primer may be at most 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, or 5 nucleotides in length. The primer can be about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 base pairs in length.

[0034] A pair of primers may include a forward primer (upstream primer) and a reverse primer (downstream primer). The forward primer may be configured to hybridize with a first region (e.g., 3' end) of a nucleic acid sequence, and the reverse primer may be configured to hybridize with a second region (e.g., 5' end) of the nucleic acid sequence, thereby being configured to amplify the nucleic acid sequence under conditions sufficient for nucleic acid amplification. Different pairs of primers may be configured to amplify different target nucleic acid sequences.

[0035] In some embodiments, the composition further comprises a probe sequence that is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3.

[0036] In some embodiments, the probe sequence is derived from at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. In some embodiments, the probe sequence is derived from at least 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. In some embodiments, the probe sequence is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. In some embodiments, the probe sequence is derived from at least 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. Preferably, the probe sequence is the sequence shown in SEQ ID NO:3.

[0037] In some embodiments, the present application provides primer and probe combinations as shown in the following table:

[0038] type Primer or probe name sequence Upstream primer BKPyV-F GACTGCATACCATACATAGGCT(SEQ ID NO:1) Probe BKPyV-P CTGCTCTGGAACACAACAGTC(SEQ ID NO:3) Downstream primer BKPyV-R CATCGACTCTCTGGGTTCTCCTG(SEQ ID NO:2)

[0039] In some embodiments, the probe sequence is 15-30 bp in length, and its 5' end is not G; the Tm value of the probe sequence is higher than that of the upstream primer and the downstream primer. Preferably, the Tm value of the probe sequence is 68-72° C. In some embodiments, the probe can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30 or more nucleotides in length.

[0040] In this article, "detection probe", "probe" and "oligonucleotide probe" are used interchangeably. The probe can be a nucleic acid (e.g., DNA, RNA, etc.). The probe can include a region complementary to a region of the target nucleic acid. The concentration of the probe can make it excessive relative to other components in the detection mixture. The probe can be a signal generating nucleic acid probe. The signal generating nucleic acid probe can include the characteristics of the probe as described herein, as well as the characteristics of generating a signal after applying a stimulus, modifying the probe or hydrolyzing the probe. For example, the probe can be hydrolyzed by the exonuclease activity of a polymerase, thereby generating a signal. The signal generating nucleic acid probe can generate any signal as described elsewhere in this article. For example, the signal generating probe can generate a fluorescent signal. The signal generating probe can include a signal tag. The signal tag can generate a signal. The signal tag can generate a signal in response to a reaction or stimulus. For example, the signal tag can generate a signal after being degraded by exonuclease activity.

[0041] In some embodiments, a signal can be generated while the probe is hybridized with the nucleic acid region. For example, a probe (e.g., a molecular beacon) can generate a signal (e.g., a fluorescent signal) after hybridizing with a nucleic acid. In some cases, a signal can be generated after the probe is hybridized with the nucleic acid region, after the probe is degraded by a nuclease. In the case where the probe comprises a signal tag, the probe can be degraded when combined with the region of the primer, thereby generating a signal. For example, a probe (e.g., a probe) can generate a signal after the probe is hybridized with a nucleic acid and subsequently degraded by a polymerase (e.g., in an amplification such as a PCR amplification process). The probe can be degraded by the exonuclease activity of a nuclease.

[0042] In some embodiments, both ends of the probe sequence are modified with a fluorescent reporter group and a fluorescent quencher group corresponding to the fluorescent reporter group. The probe modified with a fluorescent reporter group and a fluorescent quencher group at both ends is used to display the relative amount of the synthesized DNA product in qPCR. In the absence of amplification, the fluorescent reporter group and the fluorescent quencher group at both ends of the probe sequence are together, and the fluorescence of the fluorescent reporter group is quenched by the fluorescent quencher group and does not emit fluorescence. When the PCR synthesis begins, the probe sequence is complementary to the target fragment in the genomic DNA and can anneal together. If the target microorganism exists in the sample (i.e., the target fragment exists), the probe sequence can bind to the target fragment. When the PCR reaction starts, if the PCR reaction can occur, the taq enzyme can dissociate the probe sequence bound to the target fragment, thereby separating the fluorescent reporter group from the fluorescent quencher group, and at this time, the fluorescence emitted by the fluorescent reporter group can be detected. As the PCR reaction proceeds, the more DNA amplification products are synthesized, the more fluorescent reporter groups are dissociated. By detecting the fluorescence intensity, the amount of DNA amplification products can be accurately quantified.

[0043] In some embodiments, the fluorescent reporter group and the fluorescent quencher group can be selected from various fluorescent reporter groups and corresponding fluorescent quenchers commonly used by those skilled in the art in qPCR. In some embodiments, the fluorescent reporter group can be selected from FAM, VIC, HEX, ROX or CY5, and correspondingly, the fluorescent quencher group can be selected from BHQ1, BHQ2, BHQ3 or MGB.

[0044] If solid support is used in detection (for example, using probe to capture the amplicon of target nucleic acid), then probe can be connected to solid support in different ways. For example, by connecting the 3' or 5' end nucleotide of probe to solid support, probe can be connected to solid support. More preferably, probe is connected to solid support by playing the joint that separates probe from solid support. Joint is generally the length of at least 15-30 atoms, more preferably, the length of at least 15-50 atoms. The expected length of joint will depend on the specific solid support applied. For example, when using highly cross-linked polystyrene as solid support, 6 atomic joints are usually enough.

[0045] Numerous joints are known in the art, and they can be used to connect oligonucleotide probes to solid supports. Joints can be formed by any compound that does not significantly interfere with the hybridization of the target sequence and the probe connected to the solid support. Joints can be formed by homopolymeric oligonucleotides that can be easily added to the joint by automatic synthesis. Alternatively, polymers such as functionalized polyethylene glycol can be used as joints. Such polymers are preferred than homopolymeric oligonucleotides because they do not significantly interfere with the hybridization of probes and target oligonucleotides. Polyethylene glycol is particularly preferred. Examples of solid supports of preferred types for fixing oligonucleotide probes include controlled pore glass, glass plates, polystyrene, avidin-coated polystyrene beads, cellulose, nylon, acrylamide gel and activated dextran.

[0046] In certain embodiments, an internal control (IC) or internal standard is added as a control to illustrate that any negative result is not caused by a detection failure. The use of IC enables control of the separation process, amplification process, and detection system, and enables monitoring of detection behavior and quantification of the sample (one or more). The IC can be included at any suitable point, for example, in a lysis buffer. In one embodiment, the IC includes a phage nucleic acid. When a solid support is used in the detection, the solid support can additionally include a probe specific for the internal standard (IC probe) to assist in capture when the IC probe is used. The IC probe can optionally be coupled to a detectable label different from the detectable label of the target sequence. In an embodiment where the detectable label is a fluorophore, the IC can be quantified by spectrophotometry and by limit of detection studies.

[0047] In another aspect, the present application also provides a kit comprising the composition described herein.

[0048] In some embodiments, the kit may include primers (or "bait oligonucleotides") as described herein. Primers may include paired primers. Paired primers may include forward primers and reverse primers. Primers can be configured to amplify a nucleic acid sequence corresponding to a specific target. For example, a forward primer can be configured to hybridize with a first region (e.g., 3' end) of a nucleic acid sequence, and a reverse primer can be configured to hybridize with a second region (e.g., 5' end) of the nucleic acid sequence, thereby being configured to amplify the nucleic acid sequence. Primers configured to amplify nucleic acid molecules can be used in performing the disclosed methods. In some cases, all primers in the kit are lyophilized.

[0049] The kit may include one or more nucleases. The nuclease may be a nucleic acid polymerase. The nucleic acid polymerase may be a deoxyribonucleic acid polymerase (DNA enzyme). The DNA enzyme may be Taq polymerase or a variant thereof. The nuclease may be a ribonucleic acid polymerase (RNA enzyme). The RNA enzyme may be RNA enzyme III. The nuclease may be an endonuclease. The endonuclease may be an endonuclease I. The endonuclease I may be a T7 endonuclease I. The nuclease may be capable of degrading nucleic acids comprising non-natural nucleotides. The nuclease may be an endonuclease V, such as an E. coli endonuclease V. The nuclease may be a polymerase (e.g., a DNA polymerase). The polymerase may be a Taq polymerase or a variant thereof. The non-limiting examples of DNA polymerases include Taq polymerase, Tth polymerase, Tli polymerase, Pfu polymerase, VENT polymerase, DEEPVENT polymerase, EX-Taq polymerase, LA-Taq polymerase, Expand polymerase, Sso polymerase, Poc polymerase, Pab polymerase, Mth polymerase, Pho polymerase, ES4 polymerase, Tru polymerase, Tac polymerase, Tne polymerase, Tma polymerase, Tih polymerase, Tfi polymerase, PlatinumTaq polymerase, Hi-Fi polymerase, Tbr polymerase, Tfl polymerase, Pfutubo polymerase, Pyrobest polymerase, Pwo polymerase, KOD polymerase, Bst polymerase, Sac polymerase, Klenow fragment, and their variants, modified products and derivatives. For a certain hot start polymerase, a denaturation step of 2 minutes to 10 minutes at 94°C-95°C may be required, which may change the thermal curve according to different polymerases. Nucleases can degrade probes under appropriate conditions. For example, the nuclease may be a polymerase and have exolytic activity and degrade the probe, thereby generating a detectable signal. The nuclease may be able to release the quencher from the probe under appropriate conditions.

[0050] In some embodiments, the kit further comprises quantitative standards as shown in the following table:

[0051] Quantitative Standard I <![CDATA[1×10 4 copies / mL BKV recombinant plasmid]]> Quantitative Standard II <![CDATA[1×10 5 copies / mL BKV recombinant plasmid]]> Quantitative Standard III <![CDATA[1×10 6 copies / mL BKV recombinant plasmid]]> Quantitative Standard IV <![CDATA[1×10 7 copies / mL BKV recombinant plasmid]]>

[0052] In some embodiments, the kit may also include instructions for using any of the foregoing substances in the methods described herein. Detection reagents, including primers, probes, solid supports with bound probes, and other detection reagents, and appropriate instructions and other required reagents may be provided in the kit to perform the detection as described herein. Typically, the kit contains in separate containers: a combination of primers and probes (either already bound to a solid support; or separately, with reagents to bind them to a matrix), control formulations (positive and / or negative), labeling reagents—when the detection format requires, and signal generating reagents (e.g., enzyme substrates)—if the label does not directly generate a signal. Instructions for performing the detection (e.g., written, tape, VCR, CD-ROM, etc.) are typically included in the kit. Depending on the specific detection applied, the kit may also include other packaging reagents and materials (i.e., elution buffer, etc.). Standard detection, such as the detection described herein, can be performed with these kits. The instructions are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate such as paper or plastic. Similarly, the instructions can be present in the kit as a package insert, on a label of a container of the kit or its components (e.g., associated with a package or subpackage), etc. In other embodiments, the instructions are present as an electronically stored data file on a suitable computer-readable storage medium, such as a CD-ROM, disk, etc., including the same medium on which the program is present. The kit can also contain instructions for using the kit to detect BKV in a sample using a method, including a PCR method. Buffers, dNTPs, and controls (e.g., positive and negative control nucleic acids) can also be included in the kit for practicing the method. The primers in the reagent can be detectably labeled or unlabeled.

[0053] In some embodiments, the kit comprises one or more of a DNA polymerase, dNTPs, metal cations, a protein protectant, and a buffer.

[0054] In some embodiments, the DNA polymerase in the kit is a hot-start Taq enzyme, and the concentration of the hot-start Taq enzyme is 1-5U / reaction, preferably 3-5U / reaction; dNTPs include dATP, dCTP, dGTP and dTTP; metal cations include magnesium ions and potassium ions, preferably the metal cations are magnesium ions with a concentration of 2.5-5mM; the protein protectant comprises mannitol with a concentration of 0.2%-1.5% W / V (g / ml) and / or sucrose with a concentration of 10.5%-13.5% W / V (g / ml); the buffer is a buffer with a pH of 7.8-8.6, and preferably the buffer is a 20-30mM Tris-HCl buffer.

[0055] In another aspect, the present application also provides use of the composition described herein or the kit described herein in detecting BK virus.

[0056] In another aspect, the present application also provides use of the composition described herein or the kit described herein in detecting BK virus using a qPCR method.

[0057] On the other hand, the present application also provides a method for detecting BK virus using qPCR, comprising:

[0058] The composition described herein or the kit described herein is used to perform qPCR on the sample to be tested on a qPCR instrument, and the presence or absence of BK virus in the sample is determined based on the result of qPCR.

[0059] In some embodiments, the sample to be tested can be a biological sample. The sample can be derived from a biological sample. The biological sample can be, for example, blood, plasma, serum, urine, saliva, mucosal secretions, sputum, feces or tears. The biological sample can be a fluid sample. The fluid sample can be blood or plasma.

[0060] In some embodiments, the extraction of the sample to be tested can be performed by magnetic bead extraction, column extraction, boiling lysis, etc. In some embodiments, the sample can be processed simultaneously with, before, or after the method of the present disclosure. The sample can be processed to purify or enrich nucleic acids (e.g., purify nucleic acids from a plasma sample). The sample containing nucleic acids can be processed to purify or enrich the target nucleic acid.

[0061] The primers, probes and corresponding detection reagent systems of the present application are designed on the BK virus specific sequence, which greatly improves the sensitivity and window period of detection compared with the current ELISA detection method. At the same time, the primer probe design effectively avoids missed detection and false positive detection, and has extremely high detection sensitivity and specificity. At the same time, it is simple to operate, fast to detect, and has good detection timeliness, especially providing a good rapid detection solution for clinical situations such as sudden high fever in transplant patients.

[0062] The present application describes multiple embodiments, but the description is exemplary rather than restrictive, and it is obvious to those skilled in the art that there may be more embodiments and implementations within the scope of the embodiments described in the present application. Although many possible feature combinations are shown in the drawings and discussed in the specific embodiments, many other combinations of the disclosed features are also possible. Unless specifically limited, any feature or element of any embodiment may be used in combination with any other feature or element in any other embodiment, or may replace any other feature or element in any other embodiment.

[0063] The present application includes and contemplates combinations of features and elements known to those of ordinary skill in the art. The embodiments, features and elements disclosed in the present application may also be combined with any conventional features or elements to form a unique invention scheme. Any features or elements of any embodiment may also be combined with features or elements from other invention schemes to form another unique invention scheme. Therefore, it should be understood that any feature shown and / or discussed in the present application may be implemented individually or in any appropriate combination. Therefore, except for the limitations made according to the attached claims and their equivalents, the embodiments are not subject to other restrictions. In addition, various modifications and changes may be made within the scope of protection of the attached claims.

[0064] In addition, when describing representative embodiments, the specification may have presented the method and / or process as a specific sequence of steps. However, to the extent that the method or process does not rely on the specific order of the steps described herein, the method or process should not be limited to the steps of the specific order described. As will be understood by those of ordinary skill in the art, other sequences of steps are also possible. Therefore, the specific sequence of the steps set forth in the specification should not be interpreted as a limitation to the claims. In addition, the claims for the method and / or process should not be limited to the steps of performing them in the order written, and those skilled in the art can easily understand that these sequences can be changed and still remain within the spirit and scope of the embodiments of the present application.

[0065] The experimental methods in the following examples without specifying specific conditions are usually measured according to national standards. The experimental materials in the following examples without specifying the source are all commercially available raw materials. The equipment used in each step in the following examples is conventional equipment. If there is no corresponding national standard, it is carried out according to the general international standards, conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise defined or specified, all professional and scientific terms used in this application have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar or equal to the recorded content can be applied to the method of this application.

[0066] Example

[0067] Example 1. Design of primer-probe combination

[0068] The BK virus gene sequence was downloaded from NCBI, and the wild-type and mutant genome sequences were analyzed using the MegAlign software in the DNAStar software package. The specific and conserved segments within the wild-type and mutant types were found in the corresponding intervals, and the primers and probes were designed with the assistance of Primer Express 3.0 software.

[0069] The optimal primer and probe combination was screened

[0070]

[0071] The qPCR amplification was performed using this set of primers and probes. Figure 1 As shown, the two lines in the figure are the amplification of the optimal primer-probe combination screened in the present application (left line) and the amplification of other randomly selected designed primers (F: GAACGTACGGTATACCCGGGCT (SEQ ID NO: 4) and R: CCGAGAGCCTCTGGGACGTCCTG (SEQ ID NO: 5)) and probe (P: CTGTCGCTGGAACACATTGGTC (SEQ ID NO: 6)) (right line).

[0072] Example 2. Detection reagent system

[0073] The BK virus detection reagent includes the following components:

[0074]

[0075] Wherein, the DNA polymerase is preferably a hot start Taq enzyme (concentration is 1-5U / reaction, preferably 3-5U / reaction), dNTPs include dATP, dCTP, dGTP and dTTP, metal cations include magnesium ions and potassium ions (preferably magnesium ions, concentration is 2.5-5mM), protein protectants include mannitol and / or sucrose (mannitol concentration is 0.2%-1.5% W / V (g / ml), sucrose concentration is 10.5%-13.5% W / V (g / ml)), and the buffer system includes a buffer system with a pH of 7.8-8.6, preferably including a Tris-HCl buffer system (20-30mM). The optimal combination of the reaction reagent system configuration is as follows:

[0076] Components concentration 10×PCR Buffer 2.5 μL / reaction <![CDATA[25mM MgCl2 / AlCl3]]> 3mM / reaction (50mM / reaction) dNTPs (2.5 mM each) 0.2mM / reaction Upstream primer 0.2 μM / reaction Upstream primer 0.2 μM / reaction Probe 0.1 μM / reaction Taq enzyme 5U / reaction <![CDATA[dH2O]]> Make up to 30 μL

[0077] The BKV standard was diluted with ultrapure water to a concentration of 1×10 3 Samples with 100 copies / mL, 500 copies / mL, 200 copies / mL, and 100 copies / mL were added to the amplification system, capped (check whether it is tight), and centrifuged instantly. The tube was placed in a real-time fluorescence quantitative PCR instrument and amplified according to the following parameters:

[0078]

[0079] Verification results such as Figure 2 As shown, from left to right are positive control, 1×10 3For samples with 100 copies / mL, 500 copies / mL, 200 copies / mL, and 100 copies / mL, the negative control product has no peak in amplification and cannot be seen on the curve. The combination of the positive and negative control products illustrates the specificity of the primer-probe combination of the present application, and the different peak times of amplification at different concentrations further illustrate the specificity.

[0080] visible Figure 2 The results confirmed the sensitivity of the test. At the same time, the introduction of positive and negative quality control products confirmed the specificity of the system for detecting BKV.

[0081] Example 3. Detection of blood and urine samples

[0082] The samples to be tested can be extracted by magnetic bead extraction, column extraction, boiling lysis, etc. The samples to be tested are blood samples and urine samples from hospitals, which have been clinically proven to contain BKV. The following takes the boiling lysis method as an example:

[0083] Blood sample: Take 1mL of whole blood sample and centrifuge it to obtain serum or plasma sample. Centrifuge at 13000rpm / min for 10min, remove the supernatant, add 100μl lysis buffer to mix and precipitate, boil at 100℃ for 10min, centrifuge for 10min, and the supernatant is the extracted viral nucleic acid.

[0084] Urine sample: Take 1 mL of urine sample, centrifuge at 13000 rpm / min for 10 min, remove the supernatant, add 100 μl of lysis buffer to mix and precipitate, boil at 100°C for 10 min, centrifuge for 10 min, and the supernatant is the extracted viral nucleic acid.

[0085] The obtained viral nucleic acid was added to the reagent system in Example 2 and amplified according to the amplification scheme. The detection results are as follows: Figure 3 and Figure 4 As shown, it can be seen that the primer-probe combination of the present application can well detect BKV in blood samples and urine samples.

[0086] Although the embodiments of the present application have been shown and described above, it can be understood that the above embodiments are exemplary and cannot be understood as limitations on the present application. Ordinary technicians in this field can change, modify, replace and modify the above embodiments within the scope of the present application.

Claims

1. A composition comprising: An upstream bait oligonucleotide and a downstream bait oligonucleotide, wherein the upstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:

2.

2. The composition according to claim 1, characterized in that The upstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:

2.

3. The composition according to claim 2, characterized in that The upstream bait oligonucleotide is the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is the sequence shown in SEQ ID NO:

2.

4. The composition according to any one of claims 1 to 3, characterized in that The composition also comprises a probe sequence that is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:

3.

5. The composition according to claim 4, characterized in that The probe sequence is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3; preferably, the probe sequence is the sequence shown in SEQ ID NO:

3.

6. The composition according to claim 4 or 5, characterized in that Both ends of the probe sequence are modified with a fluorescent reporter group and a fluorescent quencher group corresponding to the fluorescent reporter group; the fluorescent reporter group is FAM, VIC, HEX, ROX or CY5, and the fluorescent quencher group is BHQ1, BHQ2, BHQ3 or MGB.

7. A kit comprising the composition according to any one of claims 1 to 6.

8. The kit according to claim 7, characterized in that The kit comprises one or more of a DNA polymerase, dNTPs, metal cations, a protein protectant and a buffer.

9. The kit according to claim 8, characterized in that The DNA polymerase is a hot-start Taq enzyme, and the concentration of the hot-start Taq enzyme is 1-5U / reaction, preferably 3-5U / reaction; the dNTP includes dATP, dCTP, dGTP and dTTP; the metal cation includes magnesium ion and potassium ion, preferably the metal cation is magnesium ion with a concentration of 2.5-5mM; the protein protectant includes mannitol with a concentration of 0.2%-1.5% W / V (g / ml) and / or sucrose with a concentration of 10.5%-13.5% W / V (g / ml); the buffer is a buffer with a pH of 7.8-8.6, and preferably the buffer is a 20-30mM Tris-HCl buffer.

10. Use of the composition according to any one of claims 1 to 6 or the kit according to any one of claims 7 to 9 in detecting BK virus.

11. Use of the composition according to any one of claims 1 to 6 or the kit according to any one of claims 7 to 9 in detecting BK virus using a qPCR method.

12. A method for detecting BK virus using qPCR, comprising: qPCR is performed on the sample to be tested using the composition of any one of claims 1 to 6 or the kit of any one of claims 7 to 9 on a qPCR instrument, and the presence or absence of BK virus in the sample is determined by the result of qPCR.

Images