Oligonucleotides conjugated with oleic acid and uses thereof

Abstract

The present invention provides oligonucleotide and / or oligonucleotide analogue molecules which are antagonists of microRNAs, preferably of human microRNAs hsa-miR-23b-3p and hsa-miR-218-5p, which comprise a mixture of thiophosphate linkages and phosphodieester linkages, and which are conjugated to at least one oleic acid molecule. Inhibition of these microRNAs can increase the endogenous levels of the corresponding proteins MBNL1 and / or MBNL2. The invention also provides compositions comprising said oligonucleotides and / or oligonucleotide analogue molecules and their use for the treatment and prevention of diabetes in a subject in need thereof.

Description

Technical Field

[0001] The present invention relates to the field of medicine. More specifically, the present invention relates to oligonucleotide antagonists of endogenous microRNA (especially hsa-miR-218-5p and hsa-miR-23b-3p) conjugated with oleic acid, and uses thereof. Background Art

[0002] Myotonic dystrophy type 1 (DM1) is a rare genetic disease with no effective treatment. DM1 is associated with a significant disease burden, resulting in impairment of many different systems and tissues in patients. Muscle weakness and fatigue are the two most common disease manifestations, reported in 93% and 90% of patients, respectively, followed by muscle stiffness (73%). Other phenotypes include cardiac dysfunction, cataracts, insulin resistance, and cognitive impairment. DM1 disease is based on CTG repeat expansions in the DM1 protein kinase (DMPK) gene, which are transcribed into pathogenic mRNA. It is now clear that CUG expansions bind with high affinity to the myoblind-like protein family (MBNL1, 2, and 3), thereby inhibiting their normal function, but other alterations may lead to depletion of MBNL1 and MBNL2. MBNL1 and MBNL2 are preferentially expressed in skeletal muscle and brain, respectively, while MBNL3 is mainly expressed during embryonic development and adult tissue regeneration.

[0003] MBNL1 and MBNL2 proteins control alternative splicing and polyadenylation of several transcripts in a manner that results in a switch from a fetal pattern to an adult pattern, and they play an antagonistic role in splicing regulation to the CUGBP Elav-like family member 1 (CELF) protein, which was found to be upregulated and mislocalized in DM1. In addition, it has been demonstrated that there is genetic redundancy between the MBNL1 and MBNL2 genes, as deletion of only one gene results in upregulation of the other gene and occupies its binding site in the target RNA (see Lee 2013. Compound loss of muscleblind-like function inmyotonic dystrophy. EMBO Mol Med 5: 1887-900). Depletion of MBNL1 protein function has been shown to be a key factor in the disease process. In fact, loss of MBNL1 function can result in more than 80% of mis-splicing events and nearly 70% of expression defects. In DM1 mice and patient-derived fibroblasts, upregulation of the MBNL gene and / or MBNL protein was well tolerated, alleviated multiple symptoms such as myotonia and mis-splicing events, and reduced lesion formation, opening the way for the development of therapeutic approaches aimed at increasing the expression of these genes. MBNL1 and MBNL2 depletion also affected several other gene expression processes, such as impairing the trafficking of membrane-associated mRNAs or miRNA biogenesis.

[0004] MicroRNA (also referred to herein as "miRNA" or "miR") is a class of small non-coding RNAs that play an important role in regulating gene expression, particularly gene silencing. In human cells, luciferase reporter assays showed that the expression of hsa-miR-23b-3p and hsa-miR-218-5p can directly regulate MBNL1 and MBNL2 transcripts (Cerro-Herreros et al., 2018Nat. Commun. 9, 2482). In mammalian models, the silencing of hsa-miR-23b-3p and hsa-miR-218-5p increases muscle blind protein expression and alleviates myotonic dystrophy phenotypes. On the other hand, anti-miR is a class of oligonucleotides that prevents other molecules (such as microRNAs) from binding to target sites on RNA molecules, especially messenger RNA (mRNA). The use of conventional anti-miRs as therapeutic molecules has limitations in their development as drug candidates, including short lifespan due to degradation in the cellular environment, poor cellular uptake from the extracellular medium, and a limited therapeutic window represented by the ratio of the concentration of the compound that achieves median toxicity to median efficacy (TC50 / EC50), with the higher the ratio, the better the effect. Therefore, further development of methods aimed at improving the pharmacological parameters of anti-miRs, such as stability, potency, tissue-specific uptake, and therapeutic window, is needed to fully realize the potential of anti-miRs in inhibiting their targets, hsa-miR-218-5p and hsa-miR-23b-3p.

[0005] On the one hand, albumin is one of the most abundant proteins in plasma and is responsible for the transport of fatty acids, drugs, ions, and other metabolites. Conjugation of oligonucleotides to fatty acids can increase the binding affinity of oligonucleotides to albumin, enhance their ability to cross the endothelial barrier, and improve their functional uptake in muscle, thereby increasing the efficacy of oligonucleotides in vivo. However, there are a wide variety of saturated and unsaturated fatty acids with different structures, which in turn affect protein binding or the activity of fatty acid conjugates, so it is unclear which fatty acid is most suitable for enhancing the efficacy of oligonucleotides.

[0006] On the other hand, other chemical modifications can be added to oligonucleotides to increase their pharmacological parameters. Among these modifications, phosphorothioate (PS) bonds continue to show good results as first-generation antisense oligonucleotides, although they have some important limitations that still hinder the development of fully modified (all-PS) therapeutic oligonucleotides. These limitations include the toxicity of PS-oligonucleotides to mice, rats, monkeys, and humans reported in some studies. In mice and rats, these side effects include thrombocytopenia, elevated liver transaminases, reticuloendothelial cell proliferation in various organs, and renal tubular changes (UM Sarmiento et al. In vivo toxicological effects of rel A antisense phosphorothioates in CD-1 mice. Antisense Res Dev. 1994 Summer; 4(2): 99-107. doi: 10.1089 / ard.1994.4.99. PMID: 7950306; S Agrawal et al. Mixed-backbone oligonucleotides as second generation antisense oligonucleotides: In vitro and in vivo studies. Proceedings of the National Academy of Sciences Mar 1997, 94(6) 2620-2625; DOI: 10.1073 / pnas.94.6.2620). The side effects observed in monkeys are complement activation (Agrawal, Sudhir et al. "Novel enzymatic and immunological responses tooligonucleotides." Toxicology letters 82 (1995): 431-434) and prolonged activated partial thromboplastin time (aPTT). Since similar side effects were observed after administration of dextran sulfate, it is inferred that these side effects are caused by the polyanionic nature of PS-oligonucleotides and are not nucleotide sequence specific. Therefore, it is necessary to develop oligonucleotides with reduced toxicity but improved stability.

[0007] The present invention overcomes these limitations by providing improved oleic acid-conjugated anti-miRs. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1. Evaluation of toxicity and efficacy on DM1 cells. Representation of toxicity (percent cell growth inhibition, black) and efficacy (percent increase in MBNL1 expression compared to mock-transfected cells, grey) on DM1 myotubes after lipid transfection with (A) MD23b-2, (B) 5'-23b-oleic acid, (C) unconjugated-23b or (D) 218-D / LNA2 at 5 different concentrations (for MD23b-2, 5'-23b-oleic acid and unconjugated-23b: 10 nM, 50 nM, 200 nM, 1 μM and 5 μM; for 218-D / LNA2: 0.08 nM, 0.4 nM, 2 nM, 10 nM and 50 nM). Dashed lines indicate TC50 and EC50 levels. Each concentration was tested in triplicate. Error bars = standard error of the mean (SEM). The Graphpad equation "bell-shaped dose response" has been used to fit the dose response curves.

[0009] Figure 2 .5 days after injection of designated treatments, HSA LR Mice were subjected to functional efficacy assays. Five days after a single injection (AI) of 3 mg / Kg of different anti-miRs, (A) force / body weight and (B) myotonia grade were analyzed. Data in A were analyzed by unpaired Student's t-test and compared with HSA treated with PBS (PBS). LR Mice were compared. p values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0010] Figure 3 miRNA levels in muscle tissue. (A) miR-23b-3p and (B) miR-218-5p expression levels were quantified in the gastrocnemius (gt) and quadriceps femoris (qd) relative to U1 and U6 snRNA endogenous controls by qRT-PCR. HSA LR Mice received intravenous injection of PBS or different anti-miRs in the tail vein at the same concentration (3 mg / Kg). Mice were killed 5 days after injection, and muscles were dissected and processed for RNA extraction. Student's t-test was used based on HSA treated with PBS LR All statistical comparisons were performed using the same values. p values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0011] Figure 4 .Processed HSA LRExpression of Mbnl1 and Mbnl2 in skeletal muscle of mice. (A) Mbnl1 transcript levels and (B) Mbnl2 transcript levels in gastrocnemius (gt) and quadriceps femoris (qd) were quantified by qRT-PCR relative to the endogenous control of Gapdh; (C) Mbnl1 protein levels were measured relative to the endogenous tubulin control using quantitative dot blot. HSA LR Mice received intravenous injection of PBS or different anti-miRs in the tail vein at the same concentration (3 mg / Kg). Gastrocnemius and quadriceps muscles were dissected 5 days after injection, and tissues were processed for analysis of RNA and protein. Student's t-test was used based on HSA treated with PBS LR All statistical comparisons were performed using the same values. p values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0012] Figure 5 . Anti-miR improves Mbnl-dependent transcript mis-splicing. HSA LR Mice received intravenous injection of PBS or different anti-miRs in the tail vein at the same concentration (3 mg / Kg). Gastrocnemius and quadriceps muscles were dissected 5 days after injection, and the tissues were processed for RNA extraction. (A) RT-PCR semi-quantitative analysis of splicing of (A) Atp2a1 exon 22, (B) Nfix exon 7, (C) Mbnl1 exon 5, and (D) Clcn1 exon 7a in gastrocnemius (gt) and quadriceps (qd). Exon inclusion levels of healthy control mice (FVB) were also included for comparison. Student's t-test based on HSA treated with PBS LR All statistical comparisons were performed using the same values. p values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0013] Figure 6 . Figure 5 Representative agarose gels for quantification of Atp2a1, Clcn1, Nfix, and Mbnl1 transcripts in gastrocnemius and quadriceps femoris summarized in. The effects of treatment with oligonucleotides against miR-23b-3p (A, B) and miR-218-5p (C, D) are shown. Also shown are HSA from wild-type mice (FVB) and PBS treated LR The splicing pattern in mouse is shown for comparison.

[0014] Figure 7 Spider diagram showing the effect of the indicated treatments on HSA LREffects of several DM1-related molecular or functional phenotypes in mice. Values ​​presented are recovery indices (RI), which measure the effect of HSA treated with LR The closeness of different values ​​for mice to the FVB control parameter, which is represented as 1 (solid black line). Panel (A) summarizes the RI of anti-miRs against miR-23b-3p, while (B) focuses on the RI of anti-miRs against miR-218-5p. For more representation details, see "Radar Charts" in the Materials and Methods section.

[0015] Figure 8 Chemical structures of different linkers used to connect MD23b-2V2 oligonucleotide and oleic acid. A drawing of the entire resulting molecule, except for the oligonucleotide components, was generated using ChemDraw software.

[0016] Fig. 9 .After use Figure 8 Oligonucleotide MD23b-2V2 conjugated with oleic acid at the 3' end with different linkers as shown in the figure was treated at the indicated concentrations, and MBNL1 protein in DM1 cells was quantified.

[0017] Protein levels were quantified by quantitative dot blot analysis (QDB) and normalized based on endogenous GAPDH. Protein levels produced by DM1 cells (DM1) treated with transfection reagent alone were assigned a value of 1, and the remaining data were normalized to this. The statistical comparisons shown were all performed using Student's t-test based on DM1 cells treated with transfection reagent. p values: ns = not significant, *p<0.05, **p<0.01, and ***p<0.001. Error bars = standard error of the mean (SEM).

[0018] Fig.10 .A) Chemical structure of MD23b-2V2 3'01 oligonucleotide. Drawing of the complete molecule was generated by ChemDraw software. B) Chemical structure of MD23b-2-PS / PO 3'01 oligonucleotide. Drawing of the complete molecule was generated by ChemDraw software. C) Chemical structure of 218MOE oleic acid 3' oligonucleotide. Drawing of the complete molecule was generated by ChemDraw software.

[0019] Fig.11 . MD23b-2V2 3'01 and MD23b-2V2 (ng / g) in brain, gastrocnemius, quadriceps, kidney and liver were measured by ELISA. Statistical comparisons of MD23b-2V2 3'01 and MD23b-2V2 in specific tissues were performed using Student's t-test. Statistical significance was set at p<0.05 (**p<0.01, ***p<0.001). Error bars = SEM.

[0020] Fig.12 : Relative levels of MBNL1. Phase I and Phase II. MBNL1 levels in protein extracts of NHP brains were quantified by Western blotting. MBNL1 protein levels in NHP brains were compared in Phase I (two weeks after the last dose) and Phase II (three weeks after the last dose). In Western blotting, GAPDH levels were used as an internal standard and data were normalized based on MBNL1 protein levels in PBS-treated NHPs (Group 2), whose levels were assigned a value of 1. Data are mean ± SEM. Summary of the invention

[0021] In one aspect, the present invention relates to an oligonucleotide molecule, or a mixture of two or more of said oligonucleotide molecules, wherein the oligonucleotide molecule has a length of 10 to 30 nucleotides, wherein the oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphorothioate bond, and wherein the oligonucleotide molecule is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end. Preferably, wherein the molecule is an antagonist of a microRNA, more preferably wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0022] In one embodiment, the oligonucleotide molecule according to the first aspect has a length of 15 to 30 nucleotides, comprising at least two nucleotides linked by a phosphodiester bond, wherein the number of nucleotides chemically linked by a phosphorothioate bond is greater than the number of nucleotides chemically linked by a phosphodiester bond.

[0023] In one embodiment, the length of the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides, and wherein the oligonucleotide molecule also comprises a fragment consisting of a string of at least 15 consecutive nitrogen bases of nucleotides that have at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

[0024] In one embodiment, the length of the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides, and wherein the oligonucleotide molecule also comprises a fragment consisting of a series of at least 15 consecutive nitrogen bases of nucleotides that are exactly the same as the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p).

[0025] In one embodiment, the oligonucleotide molecule according to the first aspect comprises at least one chemical modification, wherein the chemical modification is selected from the group consisting of:

[0026] i) 2'-O-methyl (2'OMe),

[0027] ii) 2'-O-methoxyethyl (2'MOE), and / or

[0028] iii) An additional bridge (LNA) connecting the 2' oxygen and the 4' carbon.

[0029] In one embodiment, the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides in length, and wherein the oligonucleotide molecule further comprises a fragment consisting of a string of at least 15 consecutive nitrogen bases of nucleotides that are at least 80% identical to the sequence of the region present in SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0030] In one embodiment, the length of the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides, wherein the nucleotide sequence of the oligonucleotide consists of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0031] In another aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising at least one oligonucleotide molecule as defined in the first aspect or any embodiment thereof, or a mixture of two or more such oligonucleotide molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0032] In another aspect, the present invention relates to a composition as defined in the second aspect or any embodiment thereof for use in therapy.

[0033] In another aspect, the present invention relates to a composition as defined in the second aspect or any embodiment thereof, for use in targeting muscle cells in a subject in need thereof.

[0034] In another aspect, the present invention relates to a composition as defined in the second aspect or any embodiment thereof, for use in preventing or treating a muscle disease or preventing or treating an RNA disease.

[0035] Preferably, the disease is myotonic dystrophy, more preferably the myotonic dystrophy is type 1 myotonic dystrophy. DETAILED DESCRIPTION

[0036] General Definition

[0037] It must be noted that, unless the context clearly indicates otherwise, the singular forms "a", "an", and "the" used herein include plural references. Furthermore, unless otherwise indicated, the term "at least" preceding a series of elements should be understood to refer to each element in the series. Those skilled in the art will recognize or be able to ascertain, using only routine experimentation, many equivalents to the specific embodiments of the invention described herein. The present invention is intended to encompass such equivalents.

[0038] When referring to a given amount or number, the term "about" means that the numerical value can vary within the range of ±20% of its specified value. Preferably, "about" means about ±10% of its value, more preferably "about" means about ±10%, ±8%, ±6%, ±5%, ±4%, ±3%, ±2% of its value, or even "about" means about ±1% of its value, in this order of preference.

[0039] As used herein, the conjunction "and / or" between multiple listed elements should be understood to cover single options and combined options. For example, when two elements are connected by "and / or", the first option refers to the applicability of the first element without the second element, the second option refers to the applicability of the second element without the first element, and the third option refers to the applicability of the first element and the second element together. Any of these options should be understood to fall within the scope of the meaning, and therefore meet the requirements of the term "and / or" used herein. The simultaneous applicability of multiple options should also be understood to fall within the scope of the meaning, and therefore meet the requirements of the term "and / or".

[0040] Throughout the specification and in the claims that follow, unless the context requires otherwise, the words "comprise" and variations thereof (e.g., "includes" and "containing") are understood to imply the inclusion of the specified integers or steps or groups of integers or steps, but not the exclusion of any other integers or steps or groups of integers or steps. When used herein, the term "comprises" may be replaced with the terms "contains" or "includes", and sometimes with the term "having" when used herein. When used in the context of aspects or embodiments of the invention, any of the above terms (comprising, containing, including, having) may be replaced with the term "consisting of", although less preferred.

[0041] As used herein, "consisting of" excludes any element, step or ingredient not specified in the claim element. As used herein, "consisting essentially of" does not exclude materials or steps that do not significantly affect the basic and novel features of the claim.

[0042] As used herein, names referring to mouse genes are entered in italics, with capital letters followed by lowercase letters. Mouse protein names follow the same rules as mouse gene symbols, but are not italicized. When referring to human genes or proteins, capital letters are always used and genes are italicized. However, the skilled person will be able to infer the exact nature of the biomolecule (protein, gene, transcript) and species from the technical background of the specification.

[0043] "Oligonucleotides" mentioned herein refer to any short fragment of DNA, RNA or DNA / RNA, including natural and synthetic nucleotides. As used in the present invention, the term "oligonucleotide molecule" includes both oligonucleotides themselves and "oligonucleotide analogs". "Oligonucleotide analogs" are molecules derived from oligonucleotides, and some chemical modifications are introduced into at least one of the nucleotide units forming the oligonucleotides, whether in a phosphate group, a pentose or a nitrogenous base; modifications of non-nucleotide groups added to the 5' end and / or the 3' end, as well as phosphorodiamidate morpholino oligomers, peptide nucleic acids (PNA; a DNA mimic in which the deoxyribose phosphate backbone is replaced by a pseudo-peptide polymer connected to a nucleobase), etc. Further, for the purposes of the present invention and as used herein, the terms "oligonucleotide molecule" and "oligonucleotide analogs" or "oligonucleotide analog molecules" also include microRNA sponges or microRNA sponges, because it can be considered that its main component is a tandem repeat unit of an oligonucleotide, characterized in that each of these oligonucleotides itself is or contains a binding site for a microRNA of interest. For the sake of clarity, it is mentioned that the oligonucleotide sequences disclosed herein and numbered as "SEQ ID NO" include nucleobase sequences with chemical modifications and / or fatty acid conjugation (if any). For example, SEQ ID NO: 3 refers to the nucleobase sequence "ATCCCTGGCAATGTGA" with LNA, phosphorothioate bonds and 5-methyl-2'-O-methylcytidine modifications, etc. Therefore, the sequence is represented herein as SEQ ID NO: 3: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCms-AbAmTbGbTmsGbsAb(NHC6)(oleic acid).

[0044] "Antagonist oligonucleotides" as referred to herein refer to oligonucleotides that are capable of blocking or inhibiting the natural function of a molecule (microRNA in this context). Therefore, the antagonist oligonucleotides of the present invention are inhibitor molecules that inhibit the activation, stability or function of the anti-miR to which they bind. In the context of the present invention, "antagonist" is synonymous with "inhibitor" and can therefore be used interchangeably. For example, an "antagonist oligonucleotide of hsa-miR-23b-3p" refers to an oligonucleotide molecule that inhibits the function of hsa-miR-23b-3p.

[0045] " sequence identity percentage " of polynucleotide and polypeptide is determined by comparing two optimally aligned sequences in a comparison window, wherein compared with a reference sequence (not comprising addition or deletion), the part of the polynucleotide or polypeptide sequence in the comparison window can comprise addition or deletion (that is, room) to achieve the optimal alignment of two sequences. The percentage is calculated as follows: determine the number of positions where identical core bases or amino acid residues occur in two sequences to obtain the matching position number, the matching position number is divided by the total number of positions in the comparison window, and then the result is multiplied by 100 to obtain the sequence identity percentage. The optimal alignment for the sequence compared can be performed by the computerized implementation of known algorithms (BLAST in the resources of the National Center for Biotechnology Information, CLUSTAL in the resources of the European Bioinformatics Institute, GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.) or by inspection. It should be noted that the "percent identity" used herein is determined in the context of local comparison, i.e., it is based on the comparison of local similar regions between the nucleobase sequences, which is in contrast to the global comparison that aims to compare two sequences over the entire span of the sequence. Therefore, in the context of the present invention, the percent identity is preferably calculated based only on the local comparison comparison algorithm.

[0046] Often, especially in the case of anti-miRs, chemical modifications are incorporated into the corresponding nucleotide units, which mainly affect the ribose moiety and / or the phosphate, and these modifications are difficult to describe in the usual nucleotide sequence representation, in which the nucleotide present at a given position is identified by the abbreviation of the nitrogenous base of which it is a part. Therefore, in the present invention, the molecules of the microRNA antagonists are compared, which refers to the percentage of identity between the nitrogenous base or nucleobase sequences of the nucleotide or nucleotide analog units present in these units, because this indicates whether two molecules or sequence fragments have been designed from the same original basic nucleotide sequence, independently of the different chemical modifications that may be contained in the nucleotides in each case.

[0047] As used in the specification, it is understood that when one of the nucleotide or nucleotide analog sequences (read in the 5'-3' direction) is a nucleotide or nucleotide analog sequence that presents a nitrogenous base pairing with the nitrogenous base of another nucleotide or nucleotide analog sequence (read in the 3'-5' direction), the two nucleotide molecular chains are 100% complementary. That is, the sequence 5'-UAGC-3' is complementary to the sequence 3'-AUCG-5' or 3'-ATCG-5', which are the sequences 5'-GCUA-3' and 5'-GCTA-3', respectively, read in the 5'-3' direction. In one embodiment, it is preferred that the antagonist molecule contains in its sequence a fragment that is identical to the complementary sequence of the seed region of the microRNA to be antagonized, at least in terms of nitrogenous base complementarity.

[0048] As used herein, "anti-miR" refers to an oligonucleotide, preferably an oligoribonucleotide, complementary to a microRNA (preferably a mature microRNA) that is a target of the anti-miR, which binds with high affinity and inhibits the microRNA. Thus, anti-miR refers to an oligonucleotide that is generally chemically modified relative to a corresponding oligomer consisting of only nucleotide units, and which is complementary to the target microRNA and is thus an inhibitor of the target microRNA. In the specific case of the present invention, the anti-miR described herein is preferably at least partially complementary to the human microRNA hsa-miR-23b-3p or hsa-miR-218-5p.

[0049] As used herein, "microRNA sponges" are generally designed so that they inhibit microRNAs with a complementary heptamer or octamer fragment (seed region) so that a single sponge structure can be used to block an entire family of microRNAs with the same motif, although they can also contain the entire target sequence for a particular microRNA or only the miRNA-specific region without the seed region to make it specific.

[0050] The expression "pharmaceutically acceptable" or "pharmacologically acceptable" refers to molecular entities and compositions that do not produce any adverse, allergic or other reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable vehicles" include solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, fatty acids such as oleic acid, and similar acceptable agents for the formulation of drugs (e.g., pharmaceutical products suitable for administration to humans).

[0051] “Preventing / to prevent / prevention includes, but is not limited to, reducing, lowering or ameliorating the risk of a symptom, disorder, condition or disease, as well as protecting an animal from a symptom, disorder, condition or disease. Prevention may be applied or administered prophylactically.

[0052] "Treatment" includes, but is not limited to, inhibiting, slowing, stopping, reducing, ameliorating or reversing the progression or severity of an existing symptom, clinical sign, disorder, condition or disease. Treatment may be applied or administered therapeutically.

[0053] "TC50" or "half maximal inhibitory concentration" as referred to herein refers to the concentration of an inhibitor applied to a test organism or test cell line that produces a toxic effect on 50% of the population of exposed organisms or cell lines within a given period of time.

[0054] As used herein, "EC50" or "half maximal effective concentration" refers to the concentration of an antagonist or inhibitor required to achieve a response halfway between baseline and maximum over a given period of time. In other words, EC50 is the concentration required to achieve 50% of the effect caused by treatment.

[0055] "Emax" mentioned herein refers to the maximum response achievable by the applied or administered agent (antagonist molecule in this article). Emax is measured as the maximum fold change of the target protein (e.g., MBNL1 protein) obtained after transfection with a specific anti-miR-23b-3p or anti-miR-218-5p compared to a mock (transfected with a vector or not transfected).

[0056] The "T index" or "therapeutic index / ratio" is a quantitative measure of the relative safety of a drug. In the present invention, the T index is defined as the ratio between the amount of a therapeutic agent that causes 50% toxicity (TC50) and the amount that causes 50% therapeutic effect (EC50) multiplied by the maximum achievable response:

[0057] T index = (TC50 / EC50)*Emax

[0058] As used herein, the term "3' end" refers to the end of a nucleotide chain with a hydroxyl group on the third carbon of the terminal sugar ring. As used herein, the term "5' end" refers to the end of a nucleotide chain with a phosphate group on the fifth carbon of the terminal sugar ring.

[0059] Detailed Description

[0060] As mentioned above, it is desirable to develop improved oligonucleotides comprising chemical modifications which are less toxic but have enhanced therapeutic effects. Therefore, the present invention encompasses two main purposes. On the one hand, the purpose of the present invention is to evaluate the optimal fatty acid conjugated to the oligonucleotide and to design an oligonucleotide having a maximum allowable amount of PS bonds which provide a beneficial effect to the molecule but are not toxic for in vivo administration. On the other hand, the present invention also provides specific microRNA inhibitors, particularly oligonucleotide molecules or analogs thereof, intended to correct the functional deficiency of MBNL (muscle blind-like) proteins, which are derived in part from the overexpression of hsa-miR-23b-3p and hsa-miR-218-5p in patients with myotonic dystrophy (DM), preferably myotonic dystrophy type 1 (DM1).

[0061] First, the inventors tested in vitro the effects of previously published miR-23b and miR-218 antagonist oligonucleotides (Cerro-Herreros et al., 2018 Nat. Commun. 9, 2482) conjugated with different hydrophobic parts (including lipids and fatty acids) on toxicity, efficacy (MBNL1 protein level) and therapeutic index (T index) (Table 1). The miR antagonist sequences used in this study all contain 2'OME modified nucleotides and a mixture of phosphorothioate (PS) bonds and phosphodiester (PO) bonds. Surprisingly, it was found that for both miR-23b and miR-218 antagonist oligonucleotides, conjugation with oleic acid produced a very important improvement in the T index.

[0062] Next, the inventors tested the ability of oleic acid to act as a carrier. Fig.11 The experiments shown in and Example 9 show that oleic acid is an excellent carrier or medium for delivering oligonucleotides to tissues such as muscle and the central nervous system (CNS). In addition, Fig.12 Examples 13 and 10 show that oleic acid mediates oligonucleotide molecules not only in animal models with DM1 phenotypes, but also in healthy animals (monkeys in this context). These results open the way for therapeutic use of oleic acid as a carrier when conjugated to oligonucleotide molecules, especially in the case of diseases affecting muscle and / or CNS, which are two major tissues where oleic acid enhances oligonucleotide delivery.

[0063] DM1 is a neuromuscular disease that affects muscle tissue and the central nervous system. Therefore, the inventors screened for anti-miR sequences with the best T index in DM1 cells from a pool of anti-miRs between 15 and 22 nucleotides in length (including nucleotides carrying different chemical modifications such as LNA, 2'OME and 2'MOE). In this study, the best performing antagonist against human hsa-miR-23b-3p was MD23b-2; for human hsa-miR-218-5p antagonists, the oligonucleotide with the best T index was 218-D / LNA2 (see Tables 2 and 3, Figure 1 ). Modified versions of each of these two molecules were conjugated to oleic acid and tested in the DM1 mouse model (HSA LR The resulting molecules were tested in DM1 cells (modified version of MD23-b2 only) and DM1 cells (modified version of MD23-b2 only). These test results revealed that the conjugation of oleic acid to oligonucleotides containing a PS / PO mixture increased the therapeutic effect of the oligonucleotides (see Tables 4, 5 and 6). Overall, the results obtained in this study allow the applicant to conclude that the best fatty acid to conjugate to oligonucleotide molecules to increase MBNL1 levels in DM1 cells and mouse disease models is oleic acid, and that this conjugation increases the therapeutic index of oligonucleotides when a PS bond / PO bond mixture is present in the molecule.

[0064] In view of these results, in a first aspect, the present invention relates to an oligonucleotide and / or oligonucleotide analog molecule, or a mixture of two or more of said molecules, wherein the oligonucleotide and / or oligonucleotide analog molecule is conjugated to at least one oleic acid molecule at the 3' end and / or 5' end of the oligonucleotide and / or oligonucleotide analog molecule. Preferably, the oligonucleotide and / or oligonucleotide analog is an antagonist of a microRNA. Preferably, the oligonucleotide and / or oligonucleotide analog is an antagonist of a microRNA selected from human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0065] The microRNAs hsa-miR-23b-3p and hsa-miR-218-5p are inhibitors of MBNL gene expression and other gene transcripts, so their inhibitory ability is weakened by the presence of their antagonists. In the context of the present invention, inhibitors, silencers or blockers are compounds that are able to reduce the endogenous activity of the hsa-miR-23b-3p and hsa-miR-218-5p, so these three terms are classified as "antagonists". Although strictly speaking, the term "silencing" can be interpreted as an absolute elimination of this activity, the difference between such elimination or non-absolute reduction of inhibitory activity can depend on the concentration of the compound used, as long as the compound causes a reduction in the inhibitory activity of the microRNA, the compound is sufficient to be regarded as an inhibitor, silencer, blocker or, in short, its antagonist. In addition, considering the possibility of inhibiting microRNA function by targeting mature microRNA, precursor microRNA (pre-microRNA or precursor miRNA) or primary microRNA (pri-microRNA or primary miRNA), if the compound targets mature microRNA, or if the compound targets precursor microRNA or primary microRNA transcript, as long as it can reduce the endogenous activity of the microRNA, it can be regarded as a microRNA inhibitor, silencing agent, blocker or antagonist of the present invention. Therefore, as used herein, these four terms (inhibitor, silencing agent, blocker or antagonist) are used as synonyms in the specification.

[0066] Regarding the nucleotide sequences of the antagonists of the present invention, it is important to note that they should have sufficient complementarity with the endogenous molecules that must be bound. The endogenous molecules are preferably microRNA molecules, more preferably hsa-miR-23b-3p or hsa-miR-218-5p molecules. Human hsa-miR-218-5p and hsa-miR-23b-3p have differences in nucleotide sequence, which must be taken into account when designing antagonist sequences and their microRNA binding sites. "MicroRNA binding site" is a nucleotide sequence contained in the antagonist that is complementary or partially complementary to at least a portion of its target microRNA. Preferably, the microRNA binding site of the antagonist defined herein is complementary or partially complementary to at least a portion of hsa-miR-23b-3p or hsa-miR-218-5p. The sequence of the binding site can be a complete match, which means that it has complete complementarity with the microRNA. Alternatively, the sequence can be partially complementary, which means that when the microRNA is base-paired with the binding site of the antagonist, one or more mismatches may occur. Importantly, if the antagonist is partially complementary to the target microRNA (preferably hsa-miR-23b-3p or hsa-miR-218-5p), its binding site preferably has complete or near-complete complementarity (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or preferably 100% complementary) with the seed region of the target microRNA (preferably hsa-miR-23b-3p or hsa-miR-218-5p). The "seed region" of a microRNA generally comprises or consists of the second nucleotide to the seventh nucleotide from the 5' end of the microRNA.

[0067] Therefore, when designing the anti-miR of the present invention, the sequence of the mature version of the target microRNA and its seed region can be considered. The sequence of their mature versions and their access codes (Mimat) in the miRbase database (www.mirbase.org) are shown below, and the seed region of each of them is represented in bold:

[0068] Hsa (Homo sapiens)-miR-218-5p (MIMAT0000275): 5'-UUGUGCUUGAUCUAACCAUGU-3' (SEQ ID NO: 10); Seed region: UGUGCU (SEQ ID NO: 12);

[0069] hsa-miR-23b-3p (MIMAT0000418): 5′-AUCACAUUGCCAGGGAUUACCAC-3′ (SEQ ID NO: 11); seed region: UCACAU (SEQ ID NO: 13).

[0070] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule is an inhibitor, blocker or antagonist of the type known as anti-miR and microRNA sponge. Preferably, according to the first aspect or any embodiment thereof, the oligonucleotide and / or its analog is an anti-miR, more preferably an anti-miR of hsa-miR-218-5p or hsa-miR-23b-3p.

[0071] In one embodiment, the length of the oligonucleotide and / or its analog is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides. In one embodiment, the length of the oligonucleotide and / or its analog is 10 to 50 nucleotides, more preferably 10 to 30 or 15 to 25 nucleotides. Preferably, the oligonucleotide molecule and / or its analog is an anti-miR whose sequence comprises, consists of or essentially consists of a fragment consisting of a string of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotides or nucleotide analog units that have at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity with the complementary sequence of the region present in SEQ ID NO: 10 (hsa-miR-218-5p) or SEQ ID NO: 11 (hsa-miR-23b-3p). More preferably, the sequence of the nitrogen bases of the nucleotides or nucleotide analogues units contained in the oligonucleotide molecule and / or its analogs has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identity with the complementary sequence of SEQ ID NO: 10 (hsa-miR-218-5p) or SEQ ID NO: 11 (hsa-miR-23b-3p).

[0072] In one embodiment, the antagonist is an anti-miR, the sequence of which comprises a fragment consisting of a series of at least 5 to 8 nucleotides or nucleotide analogs, wherein the sequence of the nitrogenous base of the nucleotides or nucleotide analogs is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-23b-3p as shown in SEQ ID NO: 13. Preferably, the anti-miR comprises a fragment consisting of a series of at least 5 to 8 nucleotides or nucleotide analogs that are 100% complementary to the seed region as shown in SEQ ID NO: 13. In one embodiment, the antagonist is an anti-miR, the sequence of which includes a first segment and a second segment, wherein the first segment consists of a series of at least 5 to 8 nucleotides or nucleotide analog units, wherein the sequence of the nitrogenous bases of the first segment has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the complementary sequence of the seed region of hsa-miR-23b-3p as shown in SEQ ID NO: 13, and wherein the second segment is adjacent to the first segment (i.e., it is located upstream and / or downstream of the first segment), and the second segment consists of a sequence identical to SEQ ID NO: 13. NO: The complementary sequence of the region present in 11 has a series of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 continuous nitrogen bases of nucleotides or nucleotide analogs units with at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity. "Adjacent" mentioned herein refers to the first fragment immediately adjacent to the first fragment, i.e., there is no nucleotide between the first fragment and the second fragment. In some alternative embodiments, the second fragment is located at 6, 7, 8, 9, 10 or 11 nucleotides upstream and / or downstream from the first fragment. More preferably, the second fragment is located at 1, 2, 3, 4 or 5 nucleotides upstream and / or downstream from the first fragment.

[0073] In one embodiment, the antagonist is an anti-miR, the sequence of which comprises a fragment consisting of a series of at least 5 to 8 nucleotides or nucleotide analogs, wherein the sequence of the nitrogenous base of the nucleotides or nucleotide analogs is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p as shown in SEQ ID NO: 12. Preferably, the anti-miR comprises a fragment consisting of a series of at least 5 to 8 nucleotides or nucleotide analogs that are 100% complementary to the seed region as shown in SEQ ID NO: 12. In one embodiment, the antagonist is an anti-miR, the sequence of which includes a first segment and a second segment, wherein the first segment consists of a series of at least 5 to 8 nucleotides or nucleotide analog units, wherein the sequence of the nitrogenous bases of the first segment is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p as shown in SEQ ID NO: 12, and wherein the second segment is adjacent to the first segment (i.e., it is located upstream and / or downstream of the first segment), and the second segment consists of a sequence identical to SEQ ID NO: 13. NO: The complementary sequence of the region present in 10 has a series of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotides or nucleotide analogs units with at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity. "Adjacent" mentioned herein refers to immediately following the first fragment, i.e., there is no nucleotide between the first fragment and the second fragment. In some alternative embodiments, the second fragment is located at 6, 7, 8, 9, 10 or 11 nucleotides upstream and / or downstream from the first fragment. More preferably, the second fragment is located at 1, 2, 3, 4 or 5 nucleotides upstream and / or downstream from the first fragment.

[0074] The concept of oligonucleotides and / or oligonucleotide analog molecules that can be used for the purposes of the present invention and are included within the scope of the present invention also includes those microRNA inhibitors, blockers or antagonists that act on primary microRNAs or precursor microRNAs, which generally alter the biosynthesis of microRNAs and have a negative impact on microRNA activity, mainly due to a reduction in available active microRNAs. In animal cells, immature primary miRNAs are processed into precursor miRNAs by the microprocessor complex in the nucleus, and then the precursor miRNAs are transported to the cytoplasm for further processing into mature miRNAs. It must therefore be understood that targeting primary microRNAs and / or precursor microRNAs of hsa-miR-23b-3p or hsa-miR-218-5p and altering their biosynthesis, thereby reducing the level of the microRNA, should also be able to reduce its activity. Therefore, for the purposes of the present invention, hsa-miR-23b-3p antagonists or hsa-miR-218-5p antagonists must be understood to include not only molecules that are able to act on the mature form, but also those that are able to act on the primary microRNA or precursor microRNA and reduce the level of the mature form of hsa-miR-23b-3p or hsa-miR-218-5p. In order to design them, the following must be taken into account:

[0075] -The primary microRNA (pri-microRNA) of hsa-miR-23b-3p is the transcript of the gene AOPEP (ENSG00000148120; chr9:97488983-97849441).

[0076] -The microRNA precursor (pre-microRNA) of hsa-miR-23b-3p corresponds to the genomic position hg19 chr9:97847490-97847586[+] and corresponds to the sequence: CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAU UAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC (SEQ ID NO: 19). Since the sequence is longer than hsa-miR-23b-3p, it is possible to design antagonists specific for pre-microRNA.

[0077] -hsa-miR-218-5p has two genomic locations encoding it as well as two pre-microRNA precursors, Pre-hsa-mir-218-1 (chr4:20529898-20530007): GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA (SEQID NO:20), and Pre-mir-218-2 (chr5:1681951SI-168195260): GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGC ACCGUGCUCUCCUGCA (SEQ ID NO:21). Both precursors can be used in the design of antagonists.

[0078] - Pre-hsa-mir-218-1 is derived from an intramolecular hairpin structure located inside the transcript of the gene SLIT2 (ENSG00000145147: chr4:20254883-20621284), while hsa-miR-218-5p-2 is derived from the gene SLIT3 (ENSG00000184347, chr5:168088745-168728133 for hsa-miR-218-5p-2), which can be considered as their primary miRNAs, respectively. No other mature microRNAs are part of the same cluster. Thus, in the case of hsa-miR-218-5p, the precursor miRNA or the primary miRNA can be envisioned as a target for antagonists to reduce the mature miRNA and increase MBNL protein levels.

[0079] As shown in the Examples below, especially in Tables 1 and 4, the inventors of the present application developed and optimized a variety of anti-miRs against hsa-miR-23b-3p and hsa-miR-218-5p, whose T index was greatly improved with the addition of oleic acid. Among them, the specific sequences of anti-miRs comprising SEQ ID NO: 1 (antagonist of human hsa-miR-218-5p) and SEQ ID NO: 2 (antagonist of human hsa-miR-23b-3p) are particularly mentioned because they have the best properties and efficiency in DM1 cells, as shown in the Examples section.

[0080] In addition, functional equivalents of SEQ ID NO: 1 or SEQ ID NO: 2 are also contemplated herein, wherein specific changes in specific nucleobases do not significantly destabilize the molecule, and thus its therapeutic effect will be maintained. The functional equivalent sequences are shown in SEQ ID NO: 52-79 (functional equivalents of anti-miR-23b-3p of SEQ ID NO: 2) and SEQ ID NO: 80-110 (functional equivalents of anti-miR-218-5p of SEQ ID NO: 1). The "functional equivalents" mentioned herein refer to other oligonucleotides whose nucleobase sequences are different from those of SEQ ID NO: 1 or SEQ ID NO: 2 but perform the same function and provide the same utility or technical effect as SEQ ID NO: 1 or SEQ ID NO: 2.

[0081] Therefore, in one embodiment, the oligonucleotide molecule and / or its analog is an antagonist of human hsa-miR-218-5p and comprises, consists of or essentially consists of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotides or nucleotide analog units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the sequence of the region present in SEQ ID NO: 1 (TTAGATCAAGCACAA) or SEQ ID NO: 80-110. Preferably, the full-length sequence of the nitrogenous bases of the nucleotides or nucleotide analogues units contained in the oligonucleotide molecule and / or its analogs has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 1 or SEQ ID NO: 80-110.

[0082] In a further embodiment, the oligonucleotide molecule and / or its analog is an antagonist of human hsa-miR-23b-3p and comprises, consists of or essentially consists of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotides or nucleotide analog units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence of the region present in SEQ ID NO: 2 (ATCCCTGGCAATGTGA) or SEQ ID NO: 52-79. Preferably, the full-length sequence of the nitrogenous bases of the nucleotides or nucleotide analogues contained in the oligonucleotide molecule and / or its analogs has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotides in SEQ ID NO: 2 or SEQ ID NO: 52-79.

[0083] It is noteworthy that in the oligonucleotide molecules and / or analogs thereof according to the present invention, each uracil and thymine base within the full length of the oligonucleotide molecules and / or analogs, preferably each uracil and thymine base in the seed region can be optionally replaced by a thymine or uracil base, respectively. This applies to all "T" nucleobases contained in all oligonucleotides disclosed herein, except for SEQ ID NOs: 52-110, in which certain positions, "U" is preferred instead of "T". Therefore, at these positions, U is included instead of T.

[0084] Likewise, each guanosine base within the entire length of the oligonucleotide molecule and / or analog, preferably each guanosine base within the seed region, can be optionally replaced by a hypoxanthine base, respectively. This applies to all oligonucleotides disclosed herein.

[0085] In one embodiment, the oligonucleotides and / or oligonucleotide analogs as antagonists of human hsa-miR-23b-3p or human hsa-miR-218-5p are capable of increasing the endogenous levels of MBNL protein, preferably MBNL1 and / or MBNL2 protein. Preferably, the oligonucleotides and / or oligonucleotide analogs have at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110 and are capable of increasing the endogenous levels of MBNL protein, preferably MBNL1 and / or MBNL2 protein. Preferably, the increase in endogenous levels of MBNL protein compared to untreated cells or untreated tissue is a statistically significant increase, wherein statistical comparisons are preferably performed using Student's t-test, see e.g. Figure 4 . Most preferably, the endogenous level of MBNL protein increases, preferably statistically significantly increases, by at least 1.2-fold, 1.3-fold, 1.4-fold or 1.5-fold changes in treated muscle tissue cells (more preferably quadriceps and gastrocnemius) relative to untreated muscle tissue cells. Preferably, the endogenous level of MBNL protein increases in treated cells or tissues by at least 15%, 20%, 30%, 40%, 50% or more compared to untreated cells or tissues. The "untreated cells or tissues" mentioned herein refer to one or more cells or tissues, including all animals such as mice, which are healthy or present a DM1 phenotype and have not been treated with the oligonucleotides and / or oligonucleotide analogs of the first aspect or any embodiment thereof. Preferably, the untreated cells are muscle cells, and the untreated tissue is muscle tissue.

[0086] The anti-miRs of the present invention, including anti-miRs as defined in SEQ ID NO: 1 or SEQ ID NO: 2, can be further optimized to improve their in vivo stability and efficacy. To this end, several modifications of their chemical structures have been described (for review, see Mckenzie et al., Recent progress in non-native nucleic acid modifications. Chem. Soc. Rev., 2021, 50, 5126-5164). These modifications can be made in the pentose (in a preferred embodiment where the oligonucleotide is an oligoribonucleotide, the modification will be made in the ribose), in the internucleotide linkage, or in the nucleobase, or a combination thereof. When the oligonucleotides or oligoribonucleotides of the present invention are chemically modified, they are referred to as oligonucleotide analogs or oligoribonucleotide analogs, respectively, in the context of the present invention. In one embodiment, the anti-miR is an oligonucleotide analog that contains at least six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen or sixteen chemical modifications throughout the molecule. In one embodiment, the anti-miR is an oligoribonucleotide analog in which all nucleotides are chemically modified.

[0087] Modification of internucleotide bonds : Among the possible modifications for producing the oligonucleotide analogs of the present invention, modifications that produce phosphorothioate bonds are contemplated, which affect the phosphate groups that are part of the "backbone" of the polynucleotide chain, resulting in the introduction of sulfur atoms to replace the oxygen atoms of the phosphate groups that do not serve as bridges between nucleotides; these modifications render the bonds between nucleotides resistant to degradation by nucleases, in addition to other desired pharmacological properties, and are therefore typically inserted between the last 3 to 5 nucleotides at the 5' or 3' end of the oligonucleotide to inhibit degradation by exonucleases, thereby increasing its stability.

[0088] In a preferred embodiment, at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen or more than fifteen of the nucleotides included in the oligonucleotide or oligonucleotide analog molecule according to the first aspect or any embodiment thereof are chemically connected by thiophosphate bonds. Preferably, the length of the oligonucleotide and / or oligonucleotide analog according to the first aspect or any embodiment thereof is 10 to 30 nucleotides, and it comprises at least two nucleotides chemically connected by thiophosphate bonds, wherein the oligonucleotide and / or oligonucleotide analog is conjugated with at least one oleic acid molecule at its 3' end and / or 5' end. In an even more preferred embodiment, the oligonucleotide or oligonucleotide analog molecule comprises a mixture of PS bonds and phosphodiester (PO) bonds, wherein at least two nucleotides in the molecule are chemically connected by thiophosphate bonds, and at least two nucleotides in the molecule are connected by phosphodiester bonds. In a further preferred embodiment, the number of nucleotides chemically connected by thiophosphate (PS) bonds is greater than the number of nucleotides chemically connected by phosphodiester bonds. In one embodiment, the length of the oligonucleotide molecule and / or its analog is between 13 and 17 nucleotides and comprises at least 7, 8, 9 or 10 nucleotides chemically linked by thiophosphate (PS) bonds. In one embodiment, the PS:PO ratio in the oligonucleotide molecule and / or its analog is 1.2:1, 1.5:1, 1.7:1, 2:1, 2.2:1, 2.5:1, 2.7:1, 3:1. Preferably, the PS:PO ratio in the oligonucleotide molecule and / or its analog is between 1.2:1 and 2.7:1, more preferably 1.5:1 or 2.5:1. The "PS:PO ratio" mentioned herein refers to the number of PS bonds corresponding to each PO bond. For example, when the oligonucleotide molecule consists of 15 nucleotides and has 10 PS bonds and 4 PO bonds (see, e.g., SEQ ID NO: 7), the molecule is said to have a PS:PO ratio of 2.5:1. In one embodiment, more than 50%, 55%, preferably 60%, 70% or 75% of the bonds between nucleotides are PS bonds.

[0089] In one embodiment, all nucleotides comprised in the oligonucleotide or oligonucleotide analogue molecule are chemically linked via phosphorothioate bonds.As mentioned above, preferably, the oligonucleotide or oligonucleotide analogue molecule is an antagonist of a microRNA (ie anti-miR).

[0090] Modifications in pentose sugars, preferably ribose:The most widely used sugar modification is the modification in the OH group at the 2' position. Among them, the most important in the context of the present invention are 2'fluorination modifications (2'F: introduction of a fluorine atom at the 2' position of ribose), 2'-O-methoxyethyl (MOE) modifications or 2'O-methyl (OMe) modifications. Therefore, in one embodiment, the oligonucleotide or oligonucleotide analog molecule according to the present invention, preferably anti-miR, is chemically modified to contain at least one pentose with one of the following modifications: 2'fluorination (2'F: introduction of a fluorine atom at the 2' position of ribose), 2'-O-methoxyethyl (MOE) and / or 2'O-methyl (OMe). In one embodiment, all nucleotides in the oligonucleotide molecule are 2'OME modified nucleotides.

[0091] Another modification that can be made in the oligonucleotide or oligonucleotide analog molecule of the present invention (preferably anti-miR) is to form a bicyclic 2'-4' modification. There are a variety of ribose derivatives that lock the carbohydrate ring into a 3'-endo conformation by forming a bicyclic structure using a bridge between the 2' oxygen and the 4' position. In one embodiment, a bridge is formed between the 2' oxygen and the 4' carbon to lock the ribose into a 3' endo conformation, thereby producing a modification called locked nucleic acid (or LNA). The introduction of LNA modification greatly improves the stability of the anti-miR-target miRNA hybrid, significantly improves its thermodynamic stability, and is more resistant to degradation, especially when the modification is located at the end of the molecule. In one embodiment, the first nucleotide starting from the 3' region comprises an LNA modification. In another embodiment, each of the first two oligonucleotides starting from the 5' region comprises an LNA modification. Further modifications of bicyclic nucleotides include bridged nucleic acids, ethyl-bridged (ENA) nucleic acids, constrained ethyl (cEt) nucleic acids, bicyclic (bicyclic DNA) and tricyclic (tricyclic DNA) structures, and conformationally restricted nucleotides (CRNs), which have different affinities for target sequences.

[0092] More modifications include the so-called PMOs (nucleic acids in which the ribose has been replaced by morpholino groups). "Morpholino" refers to a base that is linked to a methylene morpholine ring backbone via a phosphorodiamidate group. Another backbone modification is the so-called PNA ("peptide nucleic acid": a peptide nucleic acid in which the ribose-phosphate groups have been replaced by amino acid moieties, so that the backbone of the nucleotide analog is a structure of repeating units of N-(2-aminoethyl)-glycine bonded by peptide bonds).

[0093] In one embodiment, the oligonucleotide or oligonucleotide analog molecule, preferably anti-miR, according to the invention is chemically modified to comprise at least one pentose in the nucleotides forming the anti-miR, including morpholino nucleic acids (PMOs) or peptide nucleic acids (PNAs).

[0094] Modification of Nucleobases:Due to the high frequency of use, the chemical modification of the oligonucleotides (preferably oligoribonucleotide analogs, preferably anti-miR) of the present invention also includes 5-methylation of the nitrogenous base cytosine (C), which reduces the detection of the oligonucleotide analogs by the immune system. Therefore, in one embodiment, at least one, two, three, four, five or more than five of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule (preferably anti-miR) according to the first aspect or any embodiment thereof contain methylated cytosine. In a preferred embodiment, all cytosines in the oligonucleotide or oligonucleotide analog molecule (preferably anti-miR) according to the first aspect or any embodiment thereof are methylated.

[0095] Another possible modification is 2,6 diaminopurine, which is able to form base pairs with thymidine or uridine with additional H bonds (3 H bonds instead of 2 H bonds in the natural A:T base pair). Therefore, in one embodiment, at least one, two, three, four, five or more than five of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof comprise 2,6 diaminopurine.

[0096] As can be inferred from the definitions of "oligonucleotide molecule" and "oligonucleotide analogue", the definition of oligonucleotide analogues also includes hybrid molecules in which some units are modified and others are not, as well as hybrid molecules between analogues of nucleic acids and peptides, or even hybrid molecules in which some nucleotide units are nucleotides (or their analogues) and others are deoxynucleotides (nucleotides in which the sugar is deoxyribose), as well as analogues of the latter, i.e. RNA-DNA hybrid molecules and their analogues. Other chemical modifications are also possible and known, and they are also included in the possible modifications that produce oligonucleotide analogues.

[0097] For chemical modifications that may be included in oligonucleotides and / or oligonucleotide analogs molecules, the term is particularly applicable to situations where one or more common modifications are known to those skilled in the art of molecular biology in basic research and in particular in the search for therapeutic applications of these molecules. Information about such modifications can be found in general knowledge.

[0098] Modification of oligonucleotides and / or oligonucleotide analogs with other non-nucleotide molecules

[0099] As described above, the first aspect of the present invention provides an oligonucleotide and / or oligonucleotide analog molecule, which is preferably an anti-miR, more preferably an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p, or a mixture of two or more of said molecules, wherein the oligonucleotide and / or oligonucleotide analog molecule is conjugated to at least one oleic acid molecule at the 3' end and / or 5' end of the oligonucleotide and / or oligonucleotide analog molecule. Therefore, all oligonucleotides included in the present invention are conjugated to at least one oleic acid molecule at their 3' end and / or 5' end.

[0100] In some embodiments, other non-nucleotide molecules (such as organic compounds) can also be conjugated to the 3' end and / or 5' end of the oligonucleotide and / or oligonucleotide analog molecule. The conjugation can be direct conjugation or conjugation through a spacer molecule. The "spacer molecule" mentioned herein refers to any molecule that connects an oligonucleotide or an oligonucleotide analog and a non-nucleotide molecule (preferably oleic acid). The spacer molecule can be coupled at the 3' end or the 5' end of the oligonucleotide or oligonucleotide analog. Preferably, the spacer molecule is covalently bound to the oligonucleotide. Preferably, one end of one or more spacer molecules is bound by a bond between the terminal carbon on the spacer molecule and the oxygen group in the phosphate ester at the 3' end of the oligonucleotide, and the other end is bound by a bond between the terminal nitrogen group on the linker and the carboxyl group of oleic acid to form an amide bond, for example Figure 8 shown.

[0101] In a preferred embodiment, the spacer molecule is selected from the group consisting of 3-aminopropyl (NHC3), 5-aminopentyl (NHC5), 6-aminohexyl (NHC6), threonine alcohol or its derivatives. In other embodiments, one or more spacers may include a thiol modifier C6SS (C6SSC6). In a further embodiment, the spacer molecule may include a thiol modifier C6SS (C6SSC6) directly bound to the oligonucleotide, followed by 3-aminopropyl (NHC3), 6-aminohexyl (NHC6), threonine alcohol or its derivatives (see Figure 8 ).

[0102] In some embodiments, the oligonucleotide can be provided as a prodrug and can include a spacer molecule that includes or consists of a self-immolative group. A "self-immolative" group herein refers to a molecule that will spontaneously and irreversibly separate from a molecule (an oligonucleotide in this embodiment) to which it is conjugated. In one embodiment, the self-immolative group is a disulfide bond that will be reduced by naturally occurring thiols (e.g., glutathione) within the cell, resulting in the release of the oligonucleotide.

[0103] The spacer molecule can be an aliphatic linear or branched hydrocarbon chain, cyclohexylphenyl and other aromatic spacers, and polar spacers based on one or more ethylene glycol, glycerol, amino acids, peptides or carbohydrate units. In some cases, the oleyl derivative can be covalently linked to the amino group via an amide bond, or directly linked to the nucleobase via an amine bond, or can be linked to a phosphate bond as an oleyl phosphate.

[0104] Preferably, oleic acid is conjugated to the 3' end of the oligonucleotide. More preferably, oleic acid is conjugated to the 3' end of the oligonucleotide via a spacer molecule (preferably NHC6, threonine or NHC3, such as Figure 8 Note that it is not mandatory to add a spacer molecule as a linker between the oligonucleotide and the oleic acid, see for example SEQ ID NO: 51, in which the oleic acid is conjugated to the 5' end of the oligonucleotide and / or oligonucleotide analog molecule by direct conjugation.

[0105] Preferably, all oligonucleotide molecules disclosed in the present invention are conjugated with at least one oleic acid molecule at their 3' end and / or 5' end, wherein the oligonucleotide molecule further comprises at least two nucleotides chemically linked by a phosphorothioate bond. Preferably, the oligonucleotide molecule further comprises at least two nucleotides chemically linked by a phosphorothioate bond, and at least two nucleotides in the molecule are linked by a phosphodiester bond. More preferably, the number of nucleotides chemically linked by a phosphorothioate (PS) bond is greater than the number of nucleotides chemically linked by a phosphodiester (PO) bond.

[0106] Different methods known in the art can be used to prepare the oligonucleotide of the present invention. Specifically, the oligonucleotide can be synthesized by solid phase method or liquid phase method. The solid phase oligonucleotide synthesis scheme can be used to prepare oligonucleotides functionalized with spacer molecules and oleyl-oligonucleotide conjugates. In this method, a solid support such as a glass (CPG) with controlled aperture is functionalized with the first nucleotide at the 3' end of the oligonucleotide sequence, and the oligonucleotide is usually synthesized in a 3' to 5' direction. Introducing a spacer molecule at the 5' position is carried out by using a phosphoramidite derivative of the spacer molecule, and the phosphoramidite derivative will introduce the spacer molecule into the 5' position of the oligonucleotide by a phosphate bond. Introducing a spacer molecule at the 3' position requires the preparation of a solid support functionalized with a linker molecule, which is a molecule for binding nucleotides to a carrier. The example of a linker molecule is an unstable compound, such as a phthalimide linker or a succinyl linker. It is noteworthy that although the spacer molecule is conjugated with the oligonucleotide molecule and remains conjugated, the linker is a temporary conjugation, and the purpose is to fix the oligonucleotide when using the solid phase method to synthesize oligonucleotides. In the solution phase preparation method, protecting groups (such as benzoyl or acetyl) can be used to replace the linker types defined in the solid phase method.

[0107] Of all oligonucleotides disclosed in the context of the present invention, the following embodiments (including modifications and combinations of modifications) are considered to be preferred:

[0108] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof has a length of 10 to 30 nucleotides and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0109] a. the sequence of the nitrogenous base of the monomeric unit of the nucleotide or nucleotide analog is at least 85%, 90%, 93%, 95%, 98% or 100% complementary to the endogenous molecule to which it must bind (preferably a microRNA molecule, more preferably hsa-miR-23b-3p of SEQ ID NO: 11 or hsa-miR-218-5p of SEQ ID NO: 10), and

[0110] b. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably via a spacer molecule.

[0111] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof has a length of 10 to 30 nucleotides and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0112] a. The sequence of the oligonucleotide comprises a first segment and a second segment, wherein the first segment consists of a series of at least 5 to 8 nucleotides or nucleotide analogs, and the first segment has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the complementary sequence of the hsa-miR-23b-3p seed region as shown in SEQ ID NO: 13, and wherein the second segment is adjacent to the first segment (i.e., it is located upstream and / or downstream of the first segment), and the second segment consists of a sequence identical to SEQ ID NO: 13. The complementary sequence of the region present in NO: 11 has a string of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analog units with at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identity, and

[0113] b. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably via a spacer molecule.

[0114] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof has a length of 10 to 30 nucleotides and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0115] a. the oligonucleotide sequence comprises a first fragment and a second fragment, wherein the first fragment consists of a series of at least 5 to 8 nucleotides or nucleotide analog units having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the complementary sequence of the hsa-miR-218-5p seed region shown in SEQ ID NO: 12, the first fragment, and wherein the second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment), and the second fragment consists of a sequence ... The complementary sequence of the region present in NO:10 has a string of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analog units with at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identity, and

[0116] b. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably via a spacer molecule.

[0117] In one embodiment, the oligonucleotide and / or oligonucleotide analogue molecule according to the first aspect or any embodiment thereof has a length of 10 to 30 nucleotides, wherein:

[0118] a. at least two nucleotides in the molecule are chemically linked via phosphorothioate bonds, and at least two nucleotides in the molecule are linked via phosphodiester bonds, preferably wherein the number of nucleotides chemically linked via phosphorothioate bonds is greater than the number of nucleotides chemically linked via phosphodiester bonds,

[0119] b. whose sequence comprises, consists of, or consists essentially of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analog units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence of the region present in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 52-110, and

[0120] c. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably via a spacer molecule.

[0121] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof has a length of 10 to 30 nucleotides and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0122] a. at least one monomer unit is a nucleotide analogue having one or more chemical modifications in the pentose moiety, preferably in the ribose, the internucleotide linkage, the nitrogenous base or all of these moieties,

[0123] b. the sequence of the nitrogenous base of the monomeric unit of the nucleotide or nucleotide analogue is at least 85%, 90%, 93%, 95%, 98% or 100% identical to the sequence of the nitrogenous base of the monomeric unit of the nucleotide of oligonucleotide SEQ ID NO: 1 or oligonucleotide SEQ ID NO: 2 or its functional equivalent SEQ ID NO: 52-110, and

[0124] c. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably via a spacer molecule.

[0125] In a preferred embodiment, at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen or more than fifteen of the nucleotides comprised in the oligonucleotide or oligonucleotide analog molecule according to the first aspect or any embodiment thereof comprises at least one modification selected from the group consisting of locked nucleic acid, 2'-methoxy, 2'-O-methoxyethyl-, 2'-fluoro, BNA, PMO, PNA, CRN, 2,6 diaminopurine, methylated cytosine and / or any combination thereof.

[0126] In a preferred embodiment, the oligonucleotide and / or oligonucleotide analog molecule is 10 to 30 nucleotides in length and is an antagonist of human hsa-miR-23b-3p or hsa-miR-218-5p, comprising at least two nucleotides chemically linked by phosphorothioate bonds and at least two nucleotides chemically linked by phosphodiester bonds, wherein preferably the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein the oligonucleotide is conjugated to at least one oleic acid molecule, wherein the one oleic acid molecule is conjugated to the 3' end and / or 5' end of the oligonucleotide and / or its analog. Preferably, the oligonucleotide and / or oligonucleotide analogue is conjugated to at least one oleic acid molecule at its 3' and / or 5' end and comprises more PS bonds than PO bonds, and the oligonucleotide and / or oligonucleotide analogue comprises, consists of or essentially consists of a fragment consisting of a string of at least 15 consecutive nitrogen bases of nucleotides or nucleotide analogue units that have at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the sequence of the region present in any of SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110 or their functional equivalents.

[0127] In a preferred embodiment, at least three, four, five, six, seven, eight or more than eight of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule are chemically modified, wherein the chemical modification is selected from the group consisting of: i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE) and / or iii) an additional bridge (LNA) connecting the 2' oxygen and 4' carbon and / or any combination thereof. In a further embodiment, the nucleotides contained in the oligonucleotide analog molecule are chemically modified to include an additional bridge (LNA) connecting the 2' oxygen and 4' carbon of the nucleotides located at least at the 3' end and the 5' end of the oligonucleotide. More preferably, the LNA modification is introduced at least into the 4th, 3rd, preferably the 2nd or last nucleotide located at the 3' end and the 5' end of the oligonucleotide. In addition, preferably, at least one of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule is 2,6 diaminopurine and / or at least methylated cytosine.

[0128] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p and comprises, consists of or consists essentially of: a fragment consisting of a string of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotides or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the sequence of the region present in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2V2 3′Ol), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3′ end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogues units contained in the oligonucleotide molecule and / or its analogues is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identical to the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2V2 3′O1), wherein the oligonucleotide molecule and / or its analogues at least comprises oleic acid conjugated to its 3′ end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 3 or SEQ ID NO: 22.

[0129] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p and comprises, consists of or consists essentially of: a fragment consisting of a string of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the sequence of the region present in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2PS / PO 3′OI), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3′ end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogues is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identical to the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2PS / PO 3'OI), wherein the oligonucleotide molecule and / or its analogues at least comprises oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 4 or SEQ ID NO: 23.

[0130] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p and comprises, consists of or consists essentially of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence of the region present in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2PS / PO 5'OI), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 5' end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogues is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identical to the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2PS / PO 5'OI), wherein the oligonucleotide molecule and / or its analogues at least comprises oleic acid conjugated to its 5' end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51.

[0131] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p and comprises, consists of or consists essentially of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence of the region present in SEQ ID NO:49 or SEQ ID NO:50 (MD23b-2V2 3'OI containing C6SSC6), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogues units contained in the oligonucleotide molecule and / or its analogues is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identical to the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2V2 3'OI containing C6SSC6), wherein the oligonucleotide molecule and / or its analogues at least comprises oleic acid conjugated to its 5' end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2V2 3'OI containing C6SSC6).

[0132] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of or consists essentially of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units having a sequence that is at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the region present in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogues units contained in the oligonucleotide molecule and / or its analogues has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity with the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogues comprises at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 7 or SEQ ID NO: 25.

[0133] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of or consists essentially of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units having a sequence that is at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the region present in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD Oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogues has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity with the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD oleic acid 3'), wherein the oligonucleotide molecule and / or its analogues at least comprises oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 8 or SEQ ID NO: 26.

[0134] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of or consists essentially of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence of the region present in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue comprises oleic acid conjugated to at least its 3' end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogues has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity with the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogues comprises at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 9 or SEQ ID NO: 27.

[0135] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of or consists essentially of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence of the region present in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE oleic acid 3'2), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full length sequence of nitrogenous bases of the nucleotides or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogues has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity with the full length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE oleic acid 3'2), wherein the oligonucleotide molecule and / or its analogues comprises at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide consists of SEQ ID NO: 14 or SEQ ID NO: 28.

[0136] Preferably, the oligonucleotide molecule and / or its analogues of the first aspect comprises or consists of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p), or a sequence having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28.

[0137] Preferably, the oligonucleotide and / or oligonucleotide analogue has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or 100% identity to any one of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28, preferably to SEQ ID NO: 3, 4, 7, 22, 23 or 25, and is capable of increasing, preferably statistically increasing, the endogenous level of MBNL protein, preferably MBNL1 and / or MBNL2 protein, compared to untreated cells or tissues. Most preferably, the oligonucleotide molecule and / or its analogue of the first aspect consists of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28. It should be noted that in the context of the present invention, when the oligonucleotide molecule and / or its analogue is described as specifically consisting of a particular SEQ ID NO, it should be understood that the oligonucleotide molecule and / or its analogue also consists of the chemical modification, spacer molecule and oleic acid conjugation shown in the SEQ ID NO. For example, when the oligonucleotide molecule and / or its analogue consists of SEQ ID NO: 3, 4 or 7, it should be interpreted that the oligonucleotide molecule and / or its analogue consists of the nucleotide sequence defined by SEQ ID NO: 3, 4 or 7 and the chemical modification, spacer molecule and oleic acid conjugation defined by SEQ ID NO: 3, 4 or 7. A detailed description of the chemical modification contained in each SEQ ID NO is contained in the "Sequence Listing" section.

[0138] In addition, the present invention also includes compounds in prodrug form, such as oligonucleotide molecules and / or analogs thereof, that is, in a form or property that is not fully active, but after administration, it will be converted or metabolized in vivo to produce the oligonucleotide molecules and / or analogs thereof with full pharmacological activity described herein.

[0139] The cellular expression of the microRNA to be inhibited should also be considered. According to miRGator v3.0 (miRGator v3.0: a microRNA portal for deep sequencing, expression profiling and mRNA targeting. Sooyoung Cho et al., Nucleic Acids Research, Vol. 41, No. D1, Jan. 1, 2013, pp. D252-D257, https: / / doi.org / 10.1093 / nar / gks1168), hsa-miR-218-5p is expressed in adipose tissue, brain, central nervous system, kidney, heart, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, stem cells, testis, uterus and joints. On the other hand, hsa-miR-23b-3p was expressed in the following tissues: central nervous system, gastrointestinal tract, adipose tissue, breast, bladder, heart, keratinocytes, kidney, liver and biliary system, lung, lymphocytes, nose, pharynx, placenta, prostate, skin, spleen, stem cells, testis, thyroid and uterus. Therefore, one possible embodiment contemplated by the present invention is that the oligonucleotide and / or oligonucleotide analog molecule is preferably an anti-miR, more preferably an antagonist of hsa-miR-218-5p or hsa-miR-23b-3p, or a mixture of two or more of said molecules, and the target miRNA is expressed in at least one or more organs selected from the following group: cerebrum, cerebellum, hippocampus or other organs of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphocytes; or the target miRNA is expressed in primary cultures of any of these organs or one or more cells of an established cell line derived from any of these organs (including induced pluripotent stem cells, abbreviated as IPSC, or stem cells derived from one of these organs). The choice of the specific microRNA to be antagonized, in particular the specific choice between human hsa-miR-218-5p or human hsa-miR-23b-3pp, will also determine the tissue range in which the antagonism can be exerted.

[0140] In a second aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising at least one oligonucleotide as defined in the first aspect or any embodiment thereof, or a mixture of two or more of said oligonucleotides, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients. Preferably, the composition comprises an anti-miR as defined in the first aspect or any embodiment thereof, more preferably an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3p. In one embodiment, the composition comprises one of these anti-microRNAs or a mixture thereof, and any other anti-microRNA or a mixture thereof directed against human hsa-miR-218-5p or human hsa-miR-23b-3p, or in general, the composition comprises any oligonucleotide and / or oligonucleotide analog molecule that is an inhibitor of one of these microRNAs or other microRNAs that downregulate the expression of human genes MBNL1 and / or MBNL2, including a composition that also comprises a pharmaceutically acceptable carrier and / or excipient.

[0141] In one possible embodiment, the pharmaceutical composition comprises an effective dose of an inhibitor or antagonist as defined in the first aspect or any embodiment thereof, preferably an anti-miR, more preferably an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3pp or a mixture thereof. Preferably, the inhibitor / antagonist of human hsa-miR-218-5p present in the composition is an anti-miR type inhibitor represented by SEQ ID NO: 1 or its functional equivalent SEQ ID NO: 80-110 used in the embodiments of the present invention; the inhibitor / antagonist of human hsa-miR-23b-3p present in the composition is an anti-miR type inhibitor represented by SEQ ID NO: 2 or its functional equivalent SEQ ID NO: 52-79, wherein the inhibitor is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end. More preferably, the inhibitor / antagonist contained in the composition is present at a concentration that allows the administration of a therapeutically effective dose.

[0142] "Effective dose" or "therapeutically effective dose" is an amount sufficient to achieve a beneficial or desired clinical outcome. Based on the results obtained for other microRNA molecules before, the effective dose of microRNA inhibitors / antagonists can be about 0.5 mg / kg to about 100 mg / kg, preferably about 1.5 mg / kg to 100 mg / kg for mice or about 0.75 mg / kg to 50 mg / kg for rats. However, accurately determining the effective dose for humans can be based on individual factors for each patient, including size, age, and the nature of the inhibitor or antagonist (e.g., whether it is an expression construct, anti-miR or oligonucleotide analogs, etc.). Nevertheless, ordinary experts in the art can easily determine the dosage based on this specification and knowledge in the art.

[0143] For its clinical application, the composition according to the present invention's purposes will be considered as pharmaceutical composition of the present invention, and they can be prepared in appropriate form for required application.During a specific treatment period, it may be necessary or convenient to apply multiple dosages to the object, daily, weekly, monthly, every two months, every three months or every six months application dosage.In some embodiments, the object receives a pre-dose at the beginning, and the pre-dose is greater than one or more subsequent doses or maintenance doses.In some embodiments, the object receives dosage regularly or for a long time, particularly in the case of treating a chronic disease (such as DM1).

[0144] Colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, pearls and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, other oligonucleotide-based delivery vehicles and liposomes, can be used as administration vehicles for the inhibitors / antagonists of the present invention, and these vehicles are used to form the pharmaceutical compositions of the present invention. Another possibility is to use appropriate salts and buffers to prepare the pharmaceutical compositions of the present invention to stabilize the administration vehicle and facilitate target cell capture. The composition of the present invention can be an aqueous composition comprising an effective amount of an administration vehicle, which comprises an oligonucleotide molecule of the present invention (alone or forming a liposome or other complex) or an expression vehicle of an oligonucleotide molecule of the present invention dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.

[0145] Additional active ingredients may also be added to the composition, provided they do not inactivate the molecules of the invention or their expression vectors.

[0146] The active compound can be prepared as a solution of a free alkali or a pharmacologically acceptable salt in water suitably mixed with a surfactant (e.g., hydroxypropylcellulose). Dispersions can also be prepared in glycerol, polyethylene glycol liquids, mixtures thereof, and oils. Under common storage and use conditions, these preparations usually contain preservatives to prevent microbial growth. Oligonucleotides can also be prepared in solutions of phosphate buffered saline and sodium chloride. For example, oligonucleotides can be prepared in phosphate buffered saline at a pH of 6.5 to 8 (preferably a pH of about 6.8-7) and sodium chloride at a concentration of about 150 mM.

[0147] The compositions of the present invention can generally be formulated in neutral form or salt form. Pharmaceutically acceptable salts include acid addition salts (salts formed with free amino groups of proteins) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid), etc. Salts formed with free carboxyl groups of proteins can also be derived from inorganic bases (e.g., hydroxides of sodium, potassium, ammonium, calcium or iron) or organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).

[0148] In a third aspect, the present invention provides an oligonucleotide as defined in the first aspect or any embodiment thereof for therapeutic use, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any embodiment thereof. Preferably, the oleic acid conjugated to the oligonucleotide molecule and / or its analog serves as a medium to deliver the oligonucleotide molecule and / or its analog to relevant tissues, such as muscle and / or CNS. Therefore, according to the first aspect and at least one oleic acid molecule conjugated to its 3' end and / or 5' end, an oligonucleotide molecule or its analog can be used for a method of treating a human subject in need by therapy, wherein the oligonucleotide molecule and / or its analog is the active ingredient for treatment by therapy, and wherein the oleic acid molecule is used as a pharmaceutically acceptable medium or carrier for the oligonucleotide molecule and / or its analog. The term "active ingredient" used in the present invention refers to a substance that is pharmaceutically active and responsible for the therapeutic effect. In the case of an anti-miR antagonist, the active ingredient is a molecule, preferably an oligonucleotide molecule, that targets endogenous miR. Most preferably, the term "active ingredient" used herein refers to an oligonucleotide molecule and / or its analog as defined in the first aspect of the present invention.

[0149] In a fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any embodiment thereof, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any embodiment thereof, for use in preventing or treating muscle and / or nervous system diseases, preferably muscle diseases involving muscle tissue weakness and atrophy, in particular muscle diseases involving loss of muscle strength, inability to increase and deformity, and / or preferably nervous system diseases involving structural and / or functional changes in the brain and / or other tissues of the CNS. Preferably, the muscle disease is a muscular dystrophy disease. Preferably, the muscular dystrophy disease is selected from Becker muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy, distal muscular dystrophy, Emery-Dreyfus muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy and oculopharyngeal muscular dystrophy. Preferably, the muscle disease is myotonic dystrophy, preferably myotonic dystrophy type 1 and / or myotonic dystrophy type 2. Preferably, the use according to the fourth aspect comprises the use of at least one oleic acid molecule as a vehicle to deliver the oligonucleotide molecule and / or its analogue to relevant tissues (e.g. muscle and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analogue.

[0150] In an optional fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any embodiment thereof, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any embodiment thereof, for use in preventing or treating a disease characterized by insufficient amount or function of MBNL gene and / or protein in a subject in need thereof. Preferably, the use includes the use of at least one oleic acid molecule as a medium to deliver the oligonucleotide molecule and / or its analog to a relevant tissue (e.g., muscle and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analog. "Insufficient amount or function of MBNL gene and / or protein" herein means that the amount or function of MBNL gene and / or protein is statistically significantly lower than that of a healthy subject. In another optional fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any embodiment thereof, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any embodiment thereof, for use in targeting muscle and / or central nervous system cells of a subject in need thereof, preferably muscle cells of a subject suffering from DM or DM1. "Targeting muscle and / or central nervous system cells" herein refers to increasing the insufficient amount of MBNL protein and / or gene in the cells. Central nervous system cells preferably include neurons, but also include glial cells (astrocytes, oligodendrocytes, ependymal cells and microglia), choroid plexus cells, cells associated with blood vessels and coverings. Muscle cells include smooth muscle cells, preferably skeletal muscle cells and cardiomyocytes. Preferably, the increase is a statistically significant increase, preferably compared to control cells or untreated cells.

[0151] In yet another optional fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any embodiment thereof, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any embodiment thereof, for use in preventing or treating a disease characterized by toxic RNA expression (also referred to as an RNA disease or an RNA-mediated / RNA-dominant disease). Preferably, the use comprises the use of at least one oleic acid molecule as a medium to deliver the oligonucleotide molecule and / or its analog to relevant tissues (e.g., muscle and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analog. The disease is typically characterized by unstable microsatellite repeat expansion caused by an unusual mutation mechanism, wherein the expression of the repeat element expansion creates a convergence point for RNA binding proteins by increasing the mass of the target RNA in each cell nucleus and by increasing the affinity of the RNA-protein interaction (which is caused by the high local concentration of binding sites in each mutant transcript). Preferably, the RNA disease or RNA-mediated / RNA-dominant disease is a neuromuscular disease or a neurodegenerative disease, more preferably selected from type 1 diabetes (ORPHA:273) or type 2 diabetes (ORPHA:606); fragile X-associated tremor / ataxia syndrome (ORPHA:93256; FXTAS); C9ORF72 amyotrophic lateral sclerosis and / or frontotemporal dementia (ORPHA:275872; ALS / FTD); spinocerebellar ataxia (SCA) or benign adult familial myoclonic epilepsy (BAFME).

[0152] In yet another optional fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any embodiment thereof, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any embodiment thereof, for use in preventing or treating a disease characterized by an excess amount or function of miR-23b-3p and / or miR-218-5p. "An excess amount or function of miR-23b-3p and / or miR-218-5p" herein means that the amount or function of miR-23b-3p and / or miR-218-5p is at a statistically significantly higher level than that of a healthy subject. Preferably, the disease characterized by an excess amount or function of miR-23b-3p and / or miR-218-5p is myotonic dystrophy, preferably type 1 and / or type 2 myotonic dystrophy. Preferably, the use comprises the use of at least one oleic acid molecule as a vehicle to deliver the oligonucleotide molecule and / or its analogue to relevant tissues (e.g. muscle and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analogue.

[0153] Preferably, the oligonucleotide or oligonucleotide analog molecule as defined in the first aspect or any embodiment thereof, alone or contained in a pharmaceutical composition for use according to the third aspect or the fourth aspect, is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having SEQ ID NO: 1 or SEQ ID NO: 2, respectively, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the oligonucleotide or oligonucleotide analog molecule as defined in the first aspect or any embodiment thereof, alone or contained in a pharmaceutical composition for use according to the third aspect or the fourth aspect, is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having SEQ ID NO: 80-110 or SEQ ID NO: 52-79, respectively, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 80-110 or SEQ ID NO: 52-79.

[0154] More preferably, the oligonucleotide or oligonucleotide analog molecule as defined in the first aspect or any embodiment thereof for use according to the third aspect or the fourth aspect is an antagonist comprising or consisting of SEQ ID NO: 3, 4 or 5 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9 or 14 (anti-miR against hsa-miR-218-5p), or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, 4 or 5 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9 or 14 (anti-miR against hsa-miR-218-5p). More preferably, the oligonucleotide or oligonucleotide analog molecule as defined in the first aspect or any embodiment thereof for use according to the third aspect or the fourth aspect is an antagonist comprising or consisting of SEQ ID NO: 22, 23, 24, 49, 50 or 51 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 25, 26, 27 or 28 (anti-miR against hsa-miR-218-5p), or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, 4 or 5 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9 or 14 (anti-miR against hsa-miR-218-5p). As described above in the first aspect, the oligonucleotide or analog thereof for use according to the third and fourth aspects further comprises at least one oleic acid molecule conjugated to its 3' end and / or 5' end.

[0155] In one embodiment of the fourth aspect, the treatment is palliative treatment for one or more symptoms of myotonic dystrophy type 1 and / or type 2, or palliative treatment for one or more muscle diseases that are part of the symptoms of myotonic dystrophy type 1 and / or type 2. In a preferred embodiment of the fourth aspect, the treatment is for chronic myotonic dystrophy type 1 and / or type 2. In a preferred embodiment, the treatment is therapeutic treatment. Preferably, the use includes the use of at least one oleic acid molecule as a medium to deliver the oligonucleotide molecule and / or its analog to relevant tissues (e.g., muscle and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analog.

[0156] In an embodiment of the third aspect or the fourth aspect, the subject in need thereof is a mammal, preferably a human, more preferably a human suffering from DM, preferably DM1.

[0157] Administration of the antagonist via its possible expression vehicle allows for directing expression to a specific tissue or group of tissues based on the tropism of the underlying vehicle itself and / or by selecting control elements that cause expression of the coding sequence linked thereto only in a specific tissue. In addition, certain specific dosage forms may facilitate better access to one organ or other. Therefore, a possible embodiment of the third or fourth aspect of the present invention, which can be combined with any other aspect, is more directly related to its therapeutic application, which can also be defined as: the use of one of the oligonucleotide and / or oligonucleotide analog molecules of the present invention, a mixture of two or more of said molecules, or a composition comprising at least one of said molecules in the preparation of a medicament for treating myotonic dystrophy type 1 by inhibiting or antagonizing the action of human hsa-miR-218-5p or hsa-miR-23b-3p in one or more organs selected from the following group or stem cells from one or more of these organs: brain, cerebellum, hippocampus or other central nervous system organs, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells. As desired or appropriate, the oligonucleotides of the invention may also be targeted to other organs selected from the group consisting of the cerebrum, cerebellum, hippocampus or other organs of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis and uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells, or stem cells from one or more of these organs, or a combination thereof.

[0158] Considering the stability of anti-miR, it can be considered to be directly administered to mammals, preferably humans, such as by subcutaneous or systemic routes, preferably intravenous or intrathecal, such as dissolved or suspended in a pharmaceutically acceptable carrier (e.g., water or an aqueous solution such as saline or phosphate buffer), or delivered intraarticularly. The compositions for administering them may contain a pharmaceutically acceptable excipient.

[0159] The active composition of the present invention can be applied by any common route, as long as the target tissue can be reached by the route. The route includes oral, nasal, intrathecal or oral routes, and preferably, the application can be carried out by intradermal, transdermal, subcutaneous, intramuscular, intraperitoneal or intravenous routes. As previously mentioned, the composition comprising anti-miR is usually formulated for intravenous or subcutaneous administration. However, since oleic acid enhances the delivery of oligonucleotide molecules and / or its analogs to muscle and / or central nervous system cells when applied intravenously (see Examples 9 and 10), a preferred embodiment is intravenous, intraarterial or subcutaneous administration. In addition, it is also preferred that the intravenous, intraarterial or subcutaneous administration is chronic administration, which means that it is regularly performed (during the whole life of the patient who needs to be administered).

[0160] After formulation, the solution is preferably administered in a form compatible with the dosage form and in a therapeutically effective amount. The preparation can be easily administered in various dosage forms, such as injections, drug release capsules, and the like.

[0161] On the other hand, a method for treating diabetes (preferably type 1 diabetes) of an object in need is provided, the method comprising administering an oligonucleotide or pharmaceutical composition of the present invention to a patient in need thereof. In some embodiments, the oligonucleotide will be present in a concentration allowing administration of a therapeutically effective dose. Preferably, the method comprises the use of at least one oleic acid molecule as a medium to deliver the oligonucleotide molecule and / or its analog to related tissues (e.g., muscle and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analog.

[0162] As described above, the embodiment provides how oleic acid can increase the evidence of delivery to target tissues such as muscle and brain. This leads to the following conclusion: oleic acid can reduce toxicity when the PS amount contained in the molecule is higher than the PO amount, and oleic acid is also an effective medium for delivering oligonucleotide molecules and / or its analogs to target tissues such as muscle and / or CNS. In view of this, a fifth aspect of the present invention relates to at least one oleic acid molecule when the oleic acid is conjugated with oligonucleotide molecules and / or its analogs, preferably with the 3' or 5' conjugated of the oligonucleotide molecules and / or analogs as a pharmaceutically acceptable medium or carrier. Importantly, the use of at least one oleic acid molecule as a pharmaceutically acceptable medium or carrier refers to the use of the oleic acid molecule responsible for transporting, delivering, and carrying the oligonucleotide molecules and / or its analogs conjugated thereto to specific target tissues (preferably muscle and / or central nervous system tissue). In this context, "medium" and "carrier" are considered synonymous, therefore interchangeable.

[0163] Those skilled in the art know how to test whether oleic acid is acting as a mediator for the oligonucleotide molecule and / or its analogues conjugated thereto. For example, a method of assessing whether at least one oleic acid is being used as a mediator is to measure the amount of the oligonucleotide molecule and / or its analogues that reaches the target tissue (preferably the central nervous system and / or muscle tissue) after intravenous, intraarterial or subcutaneous administration, and compare the amount with the amount present in the tissue when the oligonucleotide molecule and / or its analogues are administered without being conjugated to at least one oleic acid.

[0164] Preferably, the oligonucleotide molecule and / or its analog conjugated with oleic acid is the oligonucleotide molecule and / or its analog defined in the first aspect of the present invention or in any embodiment thereof.Therefore, the preferred embodiment of the fifth aspect relates to the use of at least one oleic acid molecule as a pharmaceutically acceptable medium or carrier when the oleic acid is conjugated to the 3' end or 5' end of the oligonucleotide molecule and / or its analog defined in the first aspect, preferably, wherein the oligonucleotide molecule and / or its analog is the active ingredient of the method for treating by therapy defined in the third aspect or the fourth aspect of the present invention or in any embodiment thereof.It is worth noting that the conjugation with the oligonucleotide molecule and / or its analog can be directly conjugated or conjugated by a spacer molecule, as described in the first aspect of the present invention.Preferably, the oleic acid used as a medium is conjugated to the oligonucleotide molecule and / or its analog by a spacer molecule selected from NHC3, NHC5, NHC6, threonine alcohol and its derivatives.

[0165] In an embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the 5' end or 3' end of the oligonucleotide molecule and / or its analog in the first aspect or any embodiment thereof, so that the single oleic acid molecule acts as a medium for the oligonucleotide molecule and / or its analog. In an embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analog in the first aspect or any embodiment thereof, so that the single oleic acid molecule acts as a medium for the oligonucleotide molecule and / or its analog, and the oligonucleotide molecule and / or its analog as defined in the first aspect acts as an active ingredient in the method of treatment by therapy as defined in the third aspect or the fourth aspect.

[0166] In a preferred embodiment, at least one oleic acid molecule conjugated to an oligonucleotide molecule and / or an analog thereof as defined in the first aspect of the present invention or any embodiment thereof is capable of delivering the oligonucleotide molecule and / or an analog thereof to a tissue of interest, such as muscle and / or CNS, more efficiently than when the oligonucleotide molecule and / or an analog thereof is not conjugated to oleic acid, as shown in Example 9 or 10. Thus, the oleic acid molecule is used as an active ingredient delivery vehicle, wherein the active ingredient component is an oligonucleotide molecule and / or an analog thereof as defined in the first aspect or any embodiment thereof.

[0167] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' end or 5' end of the oligonucleotide molecule and / or analog thereof of the first aspect or any embodiment thereof, wherein the oligonucleotide molecule and / or analog thereof comprises a mixture of phosphorothioate bonds and phosphodiester bonds chemically linking nucleotides, preferably wherein the number of nucleotides chemically linked via phosphorothioate bonds is greater than the number of nucleotides chemically linked via phosphodiester bonds.

[0168] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' end or 5' end of the oligonucleotide molecule and / or analogue of the first aspect or any embodiment thereof, wherein the oligonucleotide molecule and / or its analogue is an antagonist of microRNA, preferably an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0169] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' end or 5' end of the oligonucleotide molecule and / or analog thereof of the first aspect or any embodiment thereof, wherein when the oligonucleotide molecule and / or analog thereof is administered by intravenous, intraarterial or subcutaneous route, the oleic acid used as a vehicle delivers the oligonucleotide molecule and / or analog thereof to the muscle and / or central nervous system cells of a subject in need thereof.

[0170] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' end or 5' end of an oligonucleotide molecule and / or its analog as defined in the first aspect or any embodiment thereof, wherein the oligonucleotide molecule and / or its analog is an active ingredient in a method of treatment by therapy, wherein the method of treatment by therapy includes preventing or treating muscle diseases, nervous system diseases and / or RNA diseases.

[0171] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' end or 5' end of an oligonucleotide molecule and / or its analog as defined in the first aspect or any embodiment thereof, wherein the oligonucleotide molecule and / or its analog is an active ingredient in a method of treatment by therapy, wherein the method of treatment by therapy comprises preventing or treating myotonic dystrophy, preferably myotonic dystrophy is type 1 myotonic dystrophy.

[0172] In a fifth aspect, the present invention also provides a conjugate, wherein the conjugate consists of at least one oleic acid conjugated to the 3' end or 5' end of an oligonucleotide molecule or an analog thereof as defined in the first aspect or any embodiment thereof, wherein the oligonucleotide molecule or the analog thereof is used as an active ingredient in a method for treatment by therapy as defined in the third aspect or the fourth aspect or any embodiment thereof, and wherein the at least one oleic acid is used as a pharmaceutically acceptable vehicle for delivering the oligonucleotide molecule or the analog thereof to a target tissue, such as CNS and / or muscle tissue.

[0173] The present invention also includes the following clauses:

[0174] 1. An oligonucleotide molecule, or a mixture of two or more such oligonucleotide molecules, wherein the oligonucleotide molecule has a length of 10 to 30 nucleotides, wherein the oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphorothioate bond, and wherein the oligonucleotide molecule is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end.

[0175] 2. The oligonucleotide molecule of clause 1, wherein the molecule is an antagonist of microRNA.

[0176] 3. The oligonucleotide molecule of clause 2, wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0177] 4. An oligonucleotide molecule according to any one of clauses 1 to 3, wherein the oligonucleotide molecule is 15 to 30 nucleotides in length, wherein at least two nucleotides in the molecule are linked by a phosphodiester bond, and wherein the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0178] 5. An oligonucleotide molecule according to any one of clauses 1 to 4, wherein the length of the oligonucleotide molecule is 15 to 30 nucleotides, and wherein the oligonucleotide molecule comprises a fragment consisting of a string of at least 15 consecutive nitrogen bases of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

[0179] 6. An oligonucleotide molecule according to any one of clauses 1 to 5, wherein the length of the oligonucleotide molecule is 15 to 30 nucleotides, and wherein the oligonucleotide molecule comprises a fragment consisting of a string of at least 15 consecutive nitrogen bases of nucleotides that are exactly the same as the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p).

[0180] 7. An oligonucleotide molecule according to any one of clauses 1 to 6, comprising at least one chemical modification, wherein the chemical modification is selected from the group consisting of:

[0181] i) 2'-O-methyl (2'OMe),

[0182] ii) 2'-O-methoxyethyl (2'MOE), and / or

[0183] iii) An additional bridge (LNA) connecting the 2' oxygen and the 4' carbon.

[0184] 8. An oligonucleotide molecule according to any one of clauses 1 to 7, wherein the oligonucleotide molecule is 15 to 30 nucleotides in length, and wherein the oligonucleotide molecule comprises a stretch of at least 15 consecutive nitrogen bases of nucleotides that are at least 80% identical to the sequence of the region present in SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0185] 9. An oligonucleotide molecule according to any one of clauses 1 to 8, wherein the oligonucleotide molecule is 15 to 30 nucleotides in length, and wherein the nucleotide sequence of the oligonucleotide consists of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0186] 10. A composition, preferably a pharmaceutical composition, comprising at least one oligonucleotide molecule as defined in any one of clauses 1 to 9 or a mixture of two or more such oligonucleotide molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0187] 11. A composition for therapeutic use, preferably a pharmaceutical composition, comprising at least one oligonucleotide molecule as defined in any one of clauses 1 to 9 or a mixture of two or more such oligonucleotide molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0188] 12. A composition, preferably a pharmaceutical composition, for use in targeting muscle cells of a subject in need thereof, comprising at least one oligonucleotide as defined in any one of clauses 1 to 9 or a mixture of two or more such oligonucleotides, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0189] 13. A composition, preferably a pharmaceutical composition, for use in preventing or treating muscle diseases or preventing or treating RNA diseases, comprising at least one oligonucleotide as defined in any one of clauses 1 to 9 or a mixture of two or more such oligonucleotides, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0190] 14. A composition, preferably a pharmaceutical composition, for use according to clause 13, wherein the disease is myotonic dystrophy.

[0191] 15. A composition, preferably a pharmaceutical composition, for use according to clause 14, wherein the myotonic dystrophy is myotonic dystrophy type 1.

[0192] Sequence Listing (5' to 3' direction)

[0193] As described above, the SEQ ID NOs listed below and referred to throughout the application include the nucleobase sequences and, for those oligonucleotides that deviate from their native chemical nature, also include chemical modifications and / or fatty acid conjugations thereof. Throughout the specification, the following nomenclature is used to define chemical modifications included in the SEQ ID NOs disclosed herein:

[0194] -LNA nucleotides are represented by a combination of uppercase and lowercase letters: Ab, Gb, Tb, Cb,

[0195] -Phosphorothioate bonds are represented by lowercase "s",

[0196] -2'-O-MOE RNA nucleotides are represented by a combination of uppercase and lowercase letters: Am, Cm, Gm, Tm,

[0197] -2'-O-methyl nucleotides are represented by lowercase letters: a, g, c, u,

[0198] -2'-fluorinated RNA nucleotides are represented by a combination of uppercase and lowercase letters: Af, Cf, Gf, Tf,

[0199] -2'-O-methyl-2,6-diaminopurine modification is expressed as (dap),

[0200] -Deoxynucleotides are represented by a combination of lowercase and uppercase letters: dA, dC, dG, dT,

[0201] -2'-OMe-5-methyluridine or 2'-OMe-ribothymidine is represented by a lowercase letter "t",

[0202] -5-methyl-2'-O-methylcytidine is expressed as (5Mc),

[0203] - expression (oleic acid) indicates that the oligonucleotide is conjugated with oleic acid,

[0204] - expression (palmitic acid) indicates that the oligonucleotide is conjugated with palmitic acid,

[0205] -(spacer molecule) is preferably selected from NHC3, NHC5, NHC6, threonine or its derivatives. Preferably, the spacer molecule is NHC6 or NHC3,

[0206] - "Y" represents any pyrimidine (C or U / T)

[0207] - "I" stands for hypoxanthine, as hypoxanthine is the nucleobase of inosine.

[0208] SEQ ID NO 1: Antagonist of human hsa-miR-218-5p: TTAGATCAAGCACAA

[0209] SEQ ID NO 2: antagonist of human hsa-miR-23b-3p: ATCCCTGGCAATGTGA

[0210] SEQ ID NO 3: MD23b-2V2 3'OI:

[0211] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(oleic acid)

[0212] SEQ ID NO 4: MD23b-2-PS / PO 3'OI:

[0213] AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb(NHC6)(oleic acid)

[0214] SEQ ID NO 5: MD23b-2-PS / PO 5'OI:

[0215] (Oleic acid)(NHC6)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb

[0216] SEQ ID NO: 6: MD23b-2-PS / PO:

[0217] AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb

[0218] SEQ ID NO 7:218 MOE Oleic acid 3':

[0219] TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb(NHC6)(Oleic acid)

[0220] SEQ ID NO: 8:

[0221] 218MOE DD Oleic acid 3': TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(NHC6)(oleic acid)

[0222] SEQ ID NO:9:

[0223] 218OME / MOE Oleic acid 3': TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(Oleic acid)

[0224] SEQ ID NO: 10: hsa-miR-218-5p: UUGUGCUUGAUCUAACCAUGU

[0225] SEQ ID NO: 11: hsa-miR-23b-3p: AUCACAUUGCCAGGGAUUACCAC

[0226] SEQ ID NO: 12: Seed region of hsa-miR-218-5p: UGUGCU

[0227] SEQ ID NO: 13: Seed region of hsa-miR-23b-3p: UCACAU

[0228] SEQ ID NO: 14:

[0229] 218OME / MOE oleic acid 3'2: TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(oleic acid)

[0230] SEQ ID NO:15:

[0231] 218MOE:TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb

[0232] SEQ ID NO:16:

[0233] MD23b-2V2 3'Pal:AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(free)

[0234] SEQ ID NO:17:MD23b-2V2:AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb

[0235] SEQ ID NO:18:MD23 MOE:AbsTbsCmsCmCmsTmsGmGmsCmAmAmsTbGmsTmGbsAb

[0236] SEQ ID NO:19:hsa-miR-23b-3p matrix RNA fragment(pre-matrix RNA):

[0237] CUCAGGUGCUCUGGCUGCCUGGGUUCCUGGCAUGCUGAUUUGUGACUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC

[0238] SEQ ID NO:20:Pre-hsa-miR-218-5p-1(chr4:20529898-20530007):

[0239] GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA

[0240] SEQ ID NO:21:Pre-miR-218-2(chr5:1681951SI-168195260):

[0241] GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA

[0242] SEQ ID NO 22: MD23b-2V2 3'OI without a specific spacer molecule:

[0243] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine alcohol, or a derivative thereof.

[0244] SEQ ID NO 23: MD23b-2-PS / PO 3'OI without specific spacer molecules:

[0245] AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine alcohol, or a derivative thereof.

[0246] SEQ ID NO 24: MD23b-2-PS / PO 5'OI without specific spacer molecules:

[0247] (Oleic acid)(Spacer molecule)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb, wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine alcohol, or its derivatives.

[0248] SEQ ID NO 25: 218MOE oleic acid 3' without specific spacer molecule:

[0249] TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine alcohol, or a derivative thereof.

[0250] SEQ ID NO: 26: 218MOEDD oleic acid 3' without specific spacer molecule:

[0251] TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine alcohol, or a derivative thereof.

[0252] SEQ ID NO: 27: 218OME / MOE oleic acid 3' without specific spacer molecule:

[0253] TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine alcohol, or a derivative thereof.

[0254] SEQ ID NO: 28: 218OME / MOE oleic acid 3'2 without specific spacer molecules:

[0255] TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine alcohol, or a derivative thereof.

[0256] SEQ ID NO: 29: MD23b-2V2 3'Pal without specific spacer molecule:

[0257] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(spacer)(palmitic acid), wherein the spacer is preferably selected from NHC3, NHC5, NHC6, threonine, or a derivative thereof.

[0258] SEQ ID NO 49: MD23b-2V2 3'OI containing C6SSC6 and NHC6

[0259] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC6)(oleic acid)

[0260] SEQ ID NO: 50: MD23b-2V2 3'OI containing C6SSC6 and NHC3

[0261] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC3)(oleic acid)

[0262] SEQ ID NO 51: MD23b-2-PS / PO 5'OI without spacer molecule:

[0263] (Oleic acid)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb.

[0264] SEQ ID NO 52: Functional equivalent sequence of anti-miR-23b-3p:

[0265] YTCCCTGGCAATGTGA

[0266] SEQ ID NO 53: Functional equivalent sequence of anti-miR-23b-3p:

[0267] ATCCCTYGCAATGTGA

[0268] SEQ ID NO 54: Functional equivalent sequence of anti-miR-23b-3p:

[0269] ATCCCTGYCAATGTGA

[0270] SEQ ID NO 55: Functional equivalent sequence of anti-miR-23b-3p:

[0271] ATCCCTGGCYATGTGA

[0272] SEQ ID NO 56: Functional equivalent sequence of anti-miR-23b-3p:

[0273] ATCCCTGGCAYTGTGA

[0274] SEQ ID NO 57: Functional equivalent sequence of anti-miR-23b-3p:

[0275] ATCCCTGGCAATYTGA

[0276] SEQ ID NO 58: Functional equivalent sequence of anti-miR-23b-3p:

[0277] ATCCCTGGCAATGTYA

[0278] SEQ ID NO 59: Functional equivalent sequence of anti-miR-23b-3p:

[0279] ATCCCTGGCAATGTGY

[0280] SEQ ID NO 60: Functional equivalent sequence of anti-miR-23b-3p:

[0281] GTCCCTGGCAATGTGA

[0282] SEQ ID NO 61: Functional equivalent sequence of anti-miR-23b-3p:

[0283] ATUCCTGGCAATGTGA

[0284] SEQ ID NO 62: Functional equivalent sequence of anti-miR-23b-3p:

[0285] ATCUCTGGCAATGTGA

[0286] SEQ ID NO 63 Functional equivalent sequence of anti-miR-23b-3p:

[0287] ATCCUTGGCAATGTGA

[0288] SEQ ID NO 64: Functional equivalent sequence of anti-miR-23b-3p:

[0289] ATCCCTGGUAATGTGA

[0290] SEQ ID NO 65: Functional equivalent sequence of anti-miR-23b-3p:

[0291] ATCCCTGGCGATGTGA

[0292] SEQ ID NO 66: Functional equivalent sequence of anti-miR-23b-3p:

[0293] ATCCCTGGCAGTGTGA

[0294] SEQ ID NO 67: Functional equivalent sequence of anti-miR-23b-3p:

[0295] ATCCCTGGCAATGTGG

[0296] SEQ ID NO 68: Functional equivalent sequence of anti-miR-23b-3p:

[0297] ITCCCTGGCAATGTGA

[0298] SEQ ID NO 69: Functional equivalent sequence of anti-miR-23b-3p:

[0299] ATCCCTGGCIATGTGA

[0300] SEQ ID NO 70: Functional equivalent sequence of anti-miR-23b-3p:

[0301] ATCCCTGGCAITGTGA

[0302] SEQ ID NO 71: Functional equivalent sequence of anti-miR-23b-3p:

[0303] ATCCCTGGCAATGTGI

[0304] SEQ ID NO 72: Functional equivalent sequence of anti-miR-23b-3p:

[0305] AICCCTGGCAATGTGA

[0306] SEQ ID NO 73: Functional equivalent sequence of anti-miR-23b-3p:

[0307] ATCCCIGGCAATGTGA

[0308] SEQ ID NO 74: Functional equivalent sequence of anti-miR-23b-3p:

[0309] ATCCCTGGCAAIGTGA

[0310] SEQ ID NO 75: Functional equivalent sequence of anti-miR-23b-3p:

[0311] ATCCCTGGCAATGIGA

[0312] SEQ ID NO 76: Functional equivalent sequence of anti-miR-23b-3p:

[0313] ATCCCTIGCAATGTGA

[0314] SEQ ID NO 77: Functional equivalent sequence of anti-miR-23b-3p:

[0315] ATCCCTGICAATGTGA

[0316] SEQ ID NO 78: Functional equivalent sequence of anti-miR-23b-3p:

[0317] ATCCCTGGCAATITGA

[0318] SEQ ID NO 79: Functional equivalent sequence of anti-miR-23b-3p:

[0319] ATCCCTGGCAATGTIA

[0320] SEQ ID NO 80: Functional equivalent sequence of anti-miR-218-5p:

[0321] TTYGATCAAGCACAA

[0322] SEQ ID NO 81: Functional equivalent sequence of anti-miR-218-5p:

[0323] TTAYATCAAGCACAA

[0324] SEQ ID NO 82: Functional equivalent sequence of anti-miR-218-5p:

[0325] TTAGYTCAAGCACAA

[0326] SEQ ID NO 83: Functional equivalent sequence of anti-miR-218-5p:

[0327] TTAGATCYAGCACAA

[0328] SEQ ID NO 84: Functional equivalent sequence of anti-miR-218-5p:

[0329] TTAGATCAYGCACAA

[0330] SEQ ID NO 85: Functional equivalent sequence of anti-miR-218-5p:

[0331] TTAGATCAAYCACAA

[0332] SEQ ID NO 86: Functional equivalent sequence of anti-miR-218-5p:

[0333] TTAGATCAAGCYCAA

[0334] SEQ ID NO 87: Functional equivalent sequence of anti-miR-218-5p:

[0335] TTAGATCAAGCACYA

[0336] SEQ ID NO 88: Functional equivalent sequence of anti-miR-218-5p:

[0337] TTAGATCAAGCACAY

[0338] SEQ ID NO 89: Functional equivalent sequence of anti-miR-218-5p:

[0339] TTGGATCAAGCACAA

[0340] SEQ ID NO 90: Functional equivalent sequence of anti-miR-218-5p:

[0341] TTAGGTCAAGCACAA

[0342] SEQ ID NO 91: Functional equivalent sequence of anti-miR-218-5p:

[0343] TTAGATUAAGCACAA

[0344] SEQ ID NO 92: Functional equivalent sequence of anti-miR-218-5p:

[0345] TTAGATCGAGCACAA

[0346] SEQ ID NO 93: Functional equivalent sequence of anti-miR-218-5p:

[0347] TTAGATCAGGCACAA

[0348] SEQ ID NO 94: Functional equivalent sequence of anti-miR-218-5p:

[0349] TTAGATCAAGUACAA

[0350] SEQ ID NO 95: Functional equivalent sequence of anti-miR-218-5p:

[0351] TTAGATCAAGCGCAA

[0352] SEQ ID NO 96: Functional equivalent sequence of anti-miR-218-5p:

[0353] TTAGATCAAGCAUAA

[0354] SEQ ID NO 97: Functional equivalent sequence of anti-miR-218-5p:

[0355] TTAGATCAAGCACGA

[0356] SEQ ID NO 98: Functional equivalent sequence of anti-miR-218-5p:

[0357] TTAGATCAAGCACAG

[0358] SEQ ID NO 99: Functional equivalent sequence of anti-miR-218-5p:

[0359] TTIGATCAAGCACAA

[0360] SEQ ID NO 100: Functional equivalent sequence of anti-miR-218-5p:

[0361] TTAGITCAAGCACAA

[0362] SEQ ID NO 101: Functional equivalent sequence of anti-miR-218-5p:

[0363] TTAGATCIAGCACAA

[0364] SEQ ID NO 102: Functional equivalent sequence of anti-miR-218-5p:

[0365] TTAGATCAIGCACAA

[0366] SEQ ID NO 103: Functional equivalent sequence of anti-miR-218-5p:

[0367] TTAGATCAAGCICAA

[0368] SEQ ID NO 104: Functional equivalent sequence of anti-miR-218-5p:

[0369] TTAGATCAAGCACIA

[0370] SEQ ID NO 105: Functional equivalent sequence of anti-miR-218-5p:

[0371] TTAGATCAAGCACAI

[0372] SEQ ID NO 106: Functional equivalent sequence of anti-miR-218-5p:

[0373] ITAGATCAAGCACAA

[0374] SEQ ID NO 107: Functional equivalent sequence of anti-miR-218-5p:

[0375] TIAGATCAAGCACAA

[0376] SEQ ID NO 108: Functional equivalent sequence of anti-miR-218-5p:

[0377] TTAGAICAAGCACAA

[0378] SEQ ID NO 109: Functional equivalent sequence of anti-miR-218-5p:

[0379] TTAIATCAAGCACAA

[0380] SEQ ID NO 110: Functional equivalent sequence of anti-miR-218-5p:

[0381] TTAGATCAAICACAA

[0382] SEQ ID NO 111: TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester

[0383] The following examples are intended to illustrate the present invention only.

[0384] Example

[0385] Materials and methods

[0386] Cell culture experiments

[0387] Immortalized MyoD-inducible (doxycycline) DM1 and control fibroblasts (Arandel L. et al. (2017). "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds." Dis Model Mech 10(4): 487-497) were grown in DMEM containing 4.5 g / L glucose, 1% P / S and 10% FBS (Sigma, St. Louis, MO). Transdifferentiation of fibroblasts into myotubes was performed according to (Cerro-Herreros et al. (2018). "miR-23b and miR-218 silencing increase Muscleblind-like expression and alleviate myotonic dystrophy phenotypes inmammalian models". Nat. Commun. 9, 2482).Transdifferentiation was induced on day 0, and different concentrations of test compounds (for MD23b-2, MD23b-8, MD23b-4, MD23b-13, MD23b-7, MD23b-14, MD-23b-1, 23-LNA4, MD23b-10, MD23b-3, anti-miR-23b, MD23b-6, MD23b-12, MD23b-9, M D23b-5, MD23b-11, 23-LNA6, unconjugated-23b, 5'-23b-oleic acid, 5'-23b-linoleic acid, 5'-23b-MeToc, 5'-23b-MeChol, 5'-23b-MePal, 5'-23b-elaidic acid, 5'-23b-stearic acid, OL-MD23b-2, MD23b-2-PS / PO, MD23b-2-PS / PO 5'Ol, unconjugated-218, Ax-218, 5'-218-oleic acid, 5'-218-MeChol, 5'-218-linoleic acid, 5'-218-MePal, 5'-218-MeToc, Sc-oleic acid, MD218-12, MD218-6, MD218-11, unconjugated-218, MD218-13, MD218-5, MD218-4, MD218-15, MD218-10, MD218-3: 10nM, 50nM, 200nM, 1μM and 5μM; for 23-LNA8, AX-23b, MD23b-2V2 3'Ol, MD23b-2V2 3'Ol(C6SSC6)(NHC6), MD23b-2V2 3'Ol(C6SSC6)(NHC3) and MD23b-2V2 3'Ol(threonine): 2nM, 10nM, 50nM, 200nM and 1μM; 23-D / LNA1, 23-D / LNA2 and 218-2F / LNA1: 0.4nM, 2nM, 10nM, 50nM and 200nM); and for 218-D / LNA2, 218-2F / MOE: 0.08nM, 0.4nM, 2nM, 10nM and 50nM), by using X-tremeGENE. TM HP (Roche, Basel, Switzerland) for lipid transfection and replaced with fresh differentiation medium after 4 hours. On day 4, cells were collected in differentiation medium and processed for protein extraction.

[0388] Cell proliferation assay

[0389] As mentioned above, with 10 5 Cells seeded in 96-well plates were transfected with anti-miR 24 hours later; 96 hours later, cells were transfected with CellTiter Cell proliferation was measured using an aqueous nonradioactive cell proliferation assay (Promega, Madison, WI). TC50 was calculated using nonlinear least squares regression and absorbance levels were determined using an Infinite M200 PRO plate reader (Tecan, Mennedorf, Switzerland).

[0390] Quantitative dot blot (QDB) assay

[0391] For activity assays, cells were plated at 8 x 10 4 Cells were seeded in 6-well plates at a density of 10 cells / mL and transfected with anti-miR 24 h later as described previously. For total protein extraction, human muscle cells were sonicated and incubated in 4% paraformaldehyde (5% ethanol) supplemented with protease and phosphatase inhibitor cocktails (Roche Applied Science, Penzberg, Germany). Mouse muscles (gastrocnemius and quadriceps femoris) were homogenized in RIPA buffer (Thermo Fisher Scientific, Waltham, MA). Bovine serum albumin was used as a standard. The BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA) was used for quantification of total protein. For the immunodetection assay, 1 μg / well of cell samples and 2 μg / well of mouse samples were denatured (100°C, 5 minutes) and loaded on QDB plates (Quanticision Diagnostics Inc, Research Triangle Park, NC). Each cell sample was loaded in quadruplicate on two different plates; one for detection of MBNL1 and the other for detection of GAPDH, which was used as an endogenous control. In the case of mouse samples, each sample was loaded in quadruplicate on three different plates, one for detection of MBNL1, one for detection of tubulin, which was used as an endogenous control, and the other for detection of anti-mouse IgG secondary antibody, which was used as a negative control to subtract background. For the QDB protocol, protein was prepared at 2 μg / well. Each sample was loaded in quadruplicate on two different plates, one for detection of MBNL1 and the other for detection of GAPDH, which was used as an endogenous control. To prepare the sample mixture (enough for 10 samples to allow for pipetting errors), the protein extract was placed at the specified concentration, 10.4 μl of loading buffer 4X was added, and finally 50 μl of ddH2O was added. After the sample was prepared, it was boiled in water for 5 minutes and placed on ice after protein denaturation. To load the sample, the QDB plate (Quanticision Diagnostics, Inc) was placed upside down. On each membrane circle, 5 μl of the previously prepared protein mixture was placed. The loaded QDB plate was allowed to dry at room temperature in a well-ventilated space for 30 minutes to completely dry the membrane. After drying, the QDB plate was immersed in transfer buffer (0.039M glycine, 0.048M Tris, 0.37% SDS, 20% methanol) and the plate was gently shaken for 1 minute. The plate was washed 3 times with TBST (137 mM NaCl, 2.7 mM KCl, 20 mM Tris, pH 7.4, plus 0.1% Tween-20) and shielded in a container with blocking buffer (TBST with 5% skim milk). The plate was incubated overnight at 4°C in a 96-well plate with mouse anti-MBNL1 (1:1000, ab77017, Abcam) or mouse anti-GAPDH (1:500, clone G-9, Santa Cruz) primary antibodies. The plate was washed three times with TBST and incubated for 2 hours with the secondary antibody against mouse POD (1:200, Sigma-Aldrich), and then washed again with TBST for three times. The plate was inserted into a 96-well plate containing 100 μL / well ECL substrate (Pierce) solution for 1 min and then inserted into a white 96-well plate for chemiluminescent signal quantification using a Tecan Infiniti200pro microplate reader, selecting the option “plate with cover” in the user interface.

[0392] Plates were incubated with mouse anti-MBNL1 (1:200, MB1a (4A8) (DSHB, Iowa City, IA) and rabbit anti-α-tubulin (1:1000, PA5-16891, Thermo Fisher) primary antibodies at 4°C overnight. Primary antibodies were detected using goat horseradish peroxidase (HRP)-conjugated anti-mouse IgG and anti-rabbit IgG secondary antibodies (1:3500, (Sigma-Aldrich, St. Louis, MO), respectively. Immunoreactions were detected using Pierce™ ECL Western reagents (Thermo Fisher Scientific, Waltham, MA), and luminescence was acquired using an Infinite M200 PRO plate reader (Tecan, Mennedorf, Switzerland).

[0393] RNA extraction, reverse transcription-PCR (RT-PCR), and real-time quantitative reverse transcription-PCR (qRT-PCR)

[0394] Total RNA was isolated from rat gastrocnemius and quadriceps femoris using the miRNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. One microgram of RNA was digested with DNase I (Invitrogen, Carlsbad, California) and reverse transcribed using random hexanucleotides using SuperScript II (Invitrogen, Carlsbad, California). For subsequent PCR reactions, 20 ng of cDNA was used with GoTaq polymerase (Promega, Madison, Wisconsin). Alternative splicing of Atp2a1, Nfix, Mbnl1, and Clcn1 in mouse samples (two muscles) was analyzed using specific primers. Endogenous reference levels for Gapdh levels were established using 0.2 ng of cDNA. PCR products were separated on 2% agarose gels and quantified using ImageJ software (NIH, North Bethesda, Maryland). The percentage of splicing recovery index (PSR) is defined as % SI Value minus Divide by ( minus )(SI: splicing inclusion ratio per sample; DSI: splicing inclusion ratio in disease; HSI: splicing inclusion ratio in health; in all cases, splicing refers to the inclusion of the specified alternative exon). This ratio was calculated for ATP2A1, NFIX, MBNL1, and CLCN1. The primer sequences and exons analyzed are available at (Cerro-Herreros et al. 2018 2018Jun26;9(1):2482.doi:10.1038 / s41467-018-04892-4.) and are reproduced below:

[0395] SEQ ID NO: 30:Gapdh Fwd:ATCAACGGGAAGCCCATCAC

[0396] SEQ ID NO: 31:Gapdh Rv:CTTCCACAATGCCAAAGTTGT

[0397] SEQ ID NO: 32:Atp2a Fwd:GCTCATGGTCCTCAAGATCTCAC

[0398] SEQ ID NO: 33: Atp2a Rv:GGGTCAGTGCCTCAGCTTTG

[0399] SEQ ID NO: 34:Clcn1 Fwd:GTCCTCAGCAAGTTTATGTCC

[0400] SEQ ID NO: 35:Clcn1 Rv:GAATCCTCGCCAGTAATTCC

[0401] SEQ ID NO: 36:Nfix Fwd:TCGACGACAGTGAGATGGAG

[0402] SEQ ID NO: 37:Nfix Rv:CAAACTCCTTCAGCGAGTCC

[0403] SEQ ID NO: 38: Mbnl1 ex5 F:

[0404] AGGGGAGATGCTCTCGGGAAAAGTG

[0405] SEQ ID NO:39:Mbnl1 ex5 R:

[0406] GTTGGCTAGAGCCTGTTGGTATTGGAAAATAC

[0407] Multiplex qRT-PCR was performed using QuantiFast Probe PCR Kit reagents using 1 ng of mouse tissue cDNA as template. Commercial TaqMan probes (Qiagen, Hilden, Germany) were used for mouse (MBNL1 and MBNL2; FAM-labeled probes) and reference (GAPDH, MAX-labeled probe) genes. Results were normalized based on endogenous gene expression of Gapdh. The primers used were as follows:

[0408] SEQ ID NO: 40: Probe Mbnl1: / 56-FAM / TCGCAAATCAGCTGTGAGGAGATTCCCT / 3IAbRQSp /

[0409] SEQ ID NO: 41: Mbnl1 F: TACCGATTGCACCACCAAAC

[0410] SEQ ID NO: 42: Mbnl1 R: GCTGCTTCAGCAAAGTTGTC

[0411] SEQ ID NO: 43: Mbnl2 probe: / 56-FAM / CCCGGCAGACAGCACCATGATCGA / 3IAbRQSp /

[0412] SEQ ID NO: 44: Mbnl2 F: GAGACAGACTGCCCTTTG

[0413] SEQ ID NO: 45: Mbnl2 R: GGTTACGGTGTTTGTCGTTTGT

[0414] SEQ ID NO: 46: Gapdh probe: / 5MAXN / -CGCCTGGTCACCAGGGCTGCT- / 3BHQ_1 /

[0415] SEQ ID NO: 47: Gapdh_F: CAACGGATTTGGTCGTATTGG

[0416] SEQ ID NO: 48: Gapdh_R: TGATGGCAACAAATATCCACTTTACC

[0417] According to the manufacturer's instructions, use specific miRCURY TM -locked nucleic acid microRNA PCR primers (Qiagen, Hilden, Germany) were used to quantify miRNA expression in muscle tissue. Relative gene expression was normalized based on U1 (YP00203909) and U6 (YP00203907) snRNAs.

[0418] Expression levels were measured using the QuantStudio 5 Real-Time PCR System (Applied Biosystems, Foster City, CA). -ΔΔCt Methods Expression was calculated relative to endogenous genes and controls. Pairs of samples were compared using a two-tailed t-test (α=0.05), with Welch correction applied when necessary. Statistical differences were estimated by Student's t-test on normalized data (p<0.05).

[0419] Animal experiments and administration of oligonucleotides

[0420] Mouse handling and experimental procedures followed the European law on the care and experimentation of experimental animals (2003 / 65 / CE) and were approved by the Valencian Agricultural Council. Homozygous transgenic HSALR (line 20b) mice (Mankodi et al. 2000 Science: 289 (5485): 1769-73. doi: 10.1126 / science.289.5485.1769) were provided by Professor C. Thornton (University of Rochester Medical Center, Rochester, NY, USA). The experimental groups were FVB as normal control and HSALR treated with PBS as negative control, as well as HSALR mice treated with all experimental oligonucleotides. The sample size was 4 mice per treatment group, 12 mice in the PBS group, and 18 mice in the FVB group. All groups were injected intravenously (tail vein) with a single dose of 3 mg / kg in 150 μl of 1× PBS (vehicle) or specific oligonucleotides (see Figure 2-5 ). Four days after injection, mice were sacrificed and tissues of interest were frozen in liquid nitrogen for molecular assays.

[0421] Electromyography studies

[0422] As previously described, electromyography was performed under general anesthesia before treatment and at the time of sacrifice (Kanadia et al. 2006 Proc Natl Acad Sci US A. 2006 Aug 1; 103(31): 11748-53. doi: 10.1073 / pnas.0604970103). To eliminate bias, the measurements were performed in a blinded manner. Five acupuncture injections were performed in each quadriceps muscle of both hindlimbs, and myotonic discharges were graded on a five-point scale: 0, no myotonic discharge; 1, occasional myotonic discharges occurred in ≤50% of the acupuncture injections; 2, myotonic discharges occurred in >50% of the acupuncture injections; 3, myotonic discharges occurred in almost all acupuncture injections; and 4, myotonic discharges occurred in all acupuncture injections.

[0423] Forelimb grip strength test

[0424] Forelimb grip strength was measured using a grip dynamometer (BIO-GS3; Bioseb, Pinellas Park, FL). The peak pull (in grams) was recorded on a digital force sensor when the mouse grasped the bar. The force sensor gauge was reset to 0 g after each measurement. The tension was recorded by the gauge when the mouse released its forepaw from the bar. We performed three consecutive measurements at 30-second intervals. Body weight measurements were performed in parallel. The final value was obtained by dividing the mean of the grip force by the body weight of each mouse. Body weight measurements were performed in parallel, and experiments were performed with code-identified animals to eliminate experimental bias.

[0425] Radar chart

[0426] The values ​​obtained are expressed as the recovery index (RI), which measures the recovery of HSA treated with LR How close are the values ​​of different parameters obtained for mice to those of the FVB control group. The RI of different parameters (Mbnl1 protein, Mbnl1 / 2 expression level, splicing restoration, Mbnl1ex5 inclusion restoration, and functional restoration) for each mouse after treatment was obtained according to the following formula: %MT value minus X%MNT, divided by (X%MH minus X%MNT), where MT is the value of each mouse treated (PBS or oligonucleotides), and MNT is the HSA treated with PBS. LR The values ​​are for untreated mice (PBS) and MH are for healthy mice (FVB). These values ​​range from 0 to 1, where 0 is for untreated mice (HSA LR -PBS), and 1 is a healthy mouse (FVB).

[0427] Mbnl1 protein refers to the mean of the values ​​obtained by quantitative dot blot of two muscles (quadriceps femoris and gastrocnemius) of each treatment group.

[0428] The Mbnl1 / 2 expression level refers to the average of the mRNA values ​​of the genes Mbnl1 and Mbnl2 obtained in two muscles (quadriceps femoris and gastrocnemius) by real-time PCR and the average of each treatment group applying the aforementioned formula.

[0429] Splicing recovery refers to the average percentage inclusion of Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in both muscles treated in each group.

[0430] Mbnl1 ex5 inclusion recovery refers to the percentage of Mbnl1 exon 5 inclusion in both muscles treated in each group.

[0431] Functional recovery was defined as the mean of the force / weight values ​​obtained for each mouse after treatment and the myotonic discharge grade for each treatment group. Forelimb grip strength test was used to obtain force, and electromyography was used to obtain myotonic discharge grade.

[0432] Example 1

[0433] We have previously shown that inhibition of miR-23b-3p or miR-218-5p can treat myotonic dystrophy by using commercially available anti-miRs with miR antagonist structures for miR-23b-3p (Ax-23b) or miR-218-5p (Ax-218) (Cerro-Herreros et al. 2018 Nat. Commun. 26; 9(1): 2482. doi: 10.1038 / s41467-018-04892-4.). Transfection of human DM1 cells with these antagonists and injection into a mouse model of the disease resulted in downregulation of target miRNA expression, accompanied by upregulation of MBNL1 (its direct target). The antagonists used were very long (22 nt), contained almost the entire complementary sequence of the miRNA, and were all composed of 2 OME nucleotides. They carry phosphorothioate bonds between the nucleotides at the 3' and 5' ends to increase the stability of the nucleotide portion of the molecule, and are conjugated to cholesterol as a carrier at the 3' end to enhance pharmacokinetic behavior and cellular internalization. In order to find the most effective and safest carrier, we conjugated the polynucleotide portion of Ax-23b (sequence name: non-conjugated-23b in Table 1) to different lipid carriers at the 3' or 5' end of the molecule, which lipid carriers include sterol cholesterol and tocopherol; and fatty acids palmitic acid, stearic acid, elaidic acid, linoleic acid and oleic acid (molecule list in Table 1). We screened human DM1 cells transfected with these conjugated antagonists (Arandel L. et al. (2017). Dis Model Mech 10(4):487-497.). "Immortalized human myotonicdystrophy muscle cell lines to assess therapeutic compounds." Dis Model Mech 10(4):487-497.) to explore their effects on toxicity (cell viability studies) and MBNL1 protein levels.

[0434] Each of these molecules was transfected into DM1 human myotubes at a series of 5 different concentrations, and the percentage of cell viability and MBNL1 protein levels were quantified. We ranked the anti-miRs according to their therapeutic index (TI), defined as follows:

[0435] TI=(TC50 / EC50)*Emax

[0436] in:

[0437] TC50 is the concentration of the compound that reduces cell viability to 50% of the mock concentration.

[0438] EC50 is the concentration of the compound that produces 50% of Emax,

[0439] Emax is the maximum fold change in MBNL1 protein obtained after transfection with a specific anti-miR compared to mock (transfected with vehicle).

[0440] From these experiments, we conclude that:

[0441] -Conjugation with oleic acid (a cis-monounsaturated fatty acid with 18 carbon atoms) was the conjugation that produced the highest T index (see Table 1). The toxicity and efficacy (MBNL1 protein levels) curves of the molecules named "unconjugated-23b" and "5-23B-oleic acid" are shown in Figure 1 C and Figure 1 In B, for direct comparison. Importantly, the low T index of a scrambled oligonucleotide conjugated to oleic acid ("Sc-oleic acid") indicates that oleic acid itself has no effect on the T index.

[0442] - Linoleic acid (a cis polyunsaturated fatty acid with 18 carbon atoms) was the second most effective carrier. Surprisingly, the T-index results obtained with elaidic acid (the trans isomer of oleic acid), palmitic acid (a saturated non-esterified fatty acid with 16 carbon atoms), and stearic acid (a saturated fatty acid with a carbon chain of 18 carbon atoms) were significantly lower. Therefore, our data suggest that cis unsaturated fatty acids are better carriers of anti-miRs in our DM1 cells.

[0443] - Cholesterol is the only carrier we tested that was conjugated at two different positions (3' and 5'). According to our data, it seems that conjugation at the 3' end is more effective than at the 5' end. Cholesterol derivatives such as tocopherol were used and did not improve the T index.

[0444] We performed the same experiments, conjugating the nucleotide part of Ax-218 (sequence name: unconjugated-218 in Table 1) to different lipid carriers (Table 1). Of all the fatty acids tested, oleic acid was confirmed as the best carrier, with cholesterol being more effective at the 3' end than at the 5' end. However, it is worth noting that cholesterol has been associated with toxicity in the mouse liver, even though the liver changes can become reversible after a recovery period (see Cholesterol Registration Dossier ECHA, April 4, 2017, available at https: / / echa.europa.eu / es / registration-dossier / - / registered-dossier / 11031 / 7 / 6 / 1#). However, since the therapeutic dosing of oligonucleotides is intended for long-term treatment, cholesterol as a linker could increase the risk of liver toxicity. In contrast, oleic acid has a favorable safety profile and has been used as a food additive with beneficial effects in humans (see FDA response letter to petition for health claim regarding oleic acid, November 19, 2018, available at https: / / www.fda.gov / food / cfsan-constituent-updates / fda-completes-review-qualified-health-claim-petition-oleic-acid-and-risk-coronary-heart-disease).

[0445] Once we found a suitable vector, our next step was to optimize the sequences and chemical modifications contained in the anti-miR molecules for conjugation to the vector. Therefore, we also performed the same in vitro screen to find the most effective sequences and chemical modifications to improve the T index of non-conjugated (unconjugated) anti-miR in DM1 cells. We generated a set of different single-chain molecules (lengths between 16 and 22 nucleotides) that were complementary to different parts of human miR-23b-3p or miR-218-5p. The molecules included in this screen carried different chemical modifications, including LNA, 2'OME and 2'OME oligonucleotides, and all linkages between nucleotides were phosphorothioate (PS) (list of molecules tested in Tables 2 and 3).

[0446] The molecule with the best T-index score against miR-23b-3p was MD23b-2, and in the case of anti-miR molecules designed to inhibit miR-218-5p, the best-scoring molecule was 218-D / LNA2 (see Tables 2 and 3). Importantly, MD23b-2 had a significantly higher effect on MBNL1 levels (Emax) and T-index compared to 218-D / LNA2. The toxicity and efficacy (MBNL1 protein levels) curves of these molecules are shown in Figure 1A and Figure 1 D.

[0447] Next, we tested the effect of oleic acid conjugation on the best scoring anti-miR sequence MD23b-2 (Table 4). Surprisingly, the conjugated molecule (Ol-MD23b-2) showed a reduced T index compared to MD23b-2. On the other hand, we observed that the conjugation of oleic acid to oligonucleotides with PS / PO mixtures increased their T index (Table 4). The data confirm that in mixed PS / PO oligonucleotides, the effect of oleic acid in the T index is surprisingly significant.

[0448] Table 1

[0449]

[0450] Note: (Pro)(Chol) represents hydroxyproline C5-alkyl cholesterol. (Teg)(Chol) represents 15-atom triethylene glycol cholesterol, depending on the spacer molecule used.

[0451] Table 2

[0452]

[0453] Table 3

[0454]

[0455] Table 4

[0456]

[0457] Example 2

[0458] Next, we selected the best performing oligonucleotides against miR-23b-3p (MD23b-2) and miR-218-5p (218-D / LNA2) in vitro and made some modifications to these molecules to improve their ADMET (absorption, distribution, metabolism, excretion and toxicity) properties in order to evaluate their effects on DM1 (HSA LR ) in vivo therapeutic potential in mouse models. The reasons for the modifications are as follows:

[0459] (1) Methylation of cytosine is a well-known method for inhibiting immune system activation by in vivo treatment with antisense oligonucleotides (Joseph J. Senn et al., Non-CpG-Containing Antisense 2′-Methoxyethyl Oligonucleotides Activate a Proinflammatory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88. Journal of Pharmacology and Experimental Therapeutics September 1, 2005, 314(3)972-979; DOI: https: / / doi.org / 10.1124 / jpet.105.084004).

[0460] (2) Chemically modified nucleotides of the LNA and 2'MOE modification types are known to be more stable than standard RNA, DNA or 2'OME modified oligonucleotides (W. Brad Wan and Punit P. Seth. 2016. The Medicinal Chemistry of Therapeutic Oligonucleotides).

[0461] (3) In all molecules tested in vitro, the phosphodiester (PO) bonds between the nucleotides were replaced with phosphorothioate (PS) bonds to increase their stability and potency. Fully modified PS oligonucleotides are widely used in in vitro studies. However, some in vivo toxicity associated with excess PS bonds in a single molecule has been reported previously (e.g., Smith and Zain. 2019. Therapeutic oligonucleotides: State of the Art. Annual Review of Pharmacology and Toxicology, and Hu et al., 2020. Therapeutic siRNA: state of the art. Signal transduction and targeted therapy) and mixed oligonucleotides PS / PO have been shown to be more stable in vivo (Zhang et al., In vivo stability, disposition and metabolism of a "hybrid" oligonucleotide phosphorothioate in rats. Biochemical Pharmacology. Volume 50, Issue 4, 1995, Pages 545-556, ISSN 0006-2952, https: / / doi.org / 10.1016 / 0006-2952(95)00159-W). Therefore, in order to design antisense oligonucleotides that could be tested in in vivo models, we decided to reduce the amount of PS linkages in subsequent in vivo studies.

[0462] Taking these 3 criteria into account, we generated 4 antisense oligonucleotides:

[0463] -MD23b-2PS / PO, which retains the same chemical modifications found in MD23b-2, but has a lower PS content and all cytosines are methylated.

[0464] -MD23b-2V2, the sequence is identical to MD23b-2, but it has some OME modifications replaced by MOE at the 2' position, has a lower PS content, and all cytosines are methylated.

[0465] -218MOE, which has the sequence of 218-D / LNA2, all natural DNA nucleotides are replaced by 2'MOE, all cytosines are methylated, and the PS content is lower.

[0466] -218OME / MOE, has the sequence of 218-D / LNA2, all of its natural DNA nucleotides are replaced by 2'MOE or 2'MOE, all cytosines are methylated, and the PS content is lower.

[0467] These molecules were used both unconjugated (except 218OME / mol) and conjugated to oleic acid in order to evaluate their potential in HSA. LR The therapeutic potential in mice (model of DM1, see Mankodi, A., et al. (2000). "Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat." Science 289(5485):1769-1773.). Specifically, non-conjugated MD23b-2PS / PO, MD23b-2PS / PO conjugated with oleic acid at the 3' end (MD23b 2PS / PO 3'01), and MD23b-2PS / PO conjugated with oleic acid at the 5' end (MD23b-2PS / PO5'01) were used to evaluate the effect of the site of conjugation with oleic acid on the therapeutic effect. Non-conjugated MD23b-2V2, MD23b-2V2 conjugated with oleic acid at the 3' end (MD23 b-2V2 3'Ol), and MD23b-2V2 conjugated with palmitic acid at the 3' end (MD23b-2V2 3'Palm) were used to confirm whether conjugation with oleic acid produced a stronger anti-miR effect than conjugation with palmitic acid, which was also evaluated in vivo. Both anti-miRs against miR-218-5p were conjugated with oleic acid at the 3' end.

[0468] All these molecules were injected intravenously at a concentration of 3 mg / kg into HSA 3-5 months old LR Strength and myotonia of these mice were assessed before injection and before sacrifice 5 days after a single injection. Figure 2 Results are shown for grip strength (A) and myotonia (B) levels normalized to body weight measured before killing mice. In all mice treated with anti-miR, strength was improved compared to mice injected with PBS, but this difference was statistically significant only in some anti-miRs. Similarly, myotonia was reduced in anti-miR treated mice. The most important reduction in myotonia was achieved by the molecules MD23b-2V2 3'01 and 218MOE oleic acid 3'. For both molecules, the oleic acid conjugated molecule produced a stronger rescue effect than the non-conjugated version, and a stronger effect was produced when conjugated at 3'.

[0469] Example 3

[0470] At the time of sacrifice, the quadriceps and gastrocnemius muscles of the mouse hind limbs were dissected and processed for protein and RNA extraction. The extracted RNA was reverse transcribed and qPCR was performed to detect miR-23b-3p ( Figure 3 A) or miR-218-5p( Figure 3 b) levels, showing that all anti-miRs effectively reduced the levels of their corresponding miRNAs. Importantly, the non-conjugated versions of the anti-miRs were often less effective than the conjugated forms. Among the anti-miRs against miR-218-5p, 218MOE was the least effective.

[0471] Example 4

[0472] qRT-PCR was used to quantify Mbnl1 ( Figure 4 A) and Mbnl2( Figure 4 B) Transcript expression levels in quadriceps and gastrocnemius muscles. Total proteins extracted from these muscles were analyzed by quantitative dot blot analysis for protein Mbnl1 ( Figure 4 C). Despite minor differences between anti-miR-23b-3p and anti-miR-218-5p on Mbnl1 transcript levels, the miR-23b-3b anti-miR had a stronger effect on Mbnl protein. Importantly, we observed no difference in placing the oleic acid carrier at the 3' or 5' position in the molecule MD23b-2PS / PO, and in the case of the molecule MD23b-2V2, the non-conjugated version was significantly less effective than the conjugated versions with oleic or palmitoylic acid, and oleic acid had a stronger effect, especially on Mbnl2 transcript and Mbnl1 protein levels.

[0473] Example 5

[0474] Total RNA was also used to analyze splicing errors in transcripts regulated by the Mbnl1 protein, such as Atp2a1 exon 22, Nfix exon 7, Mbnl1 exon 5, and chloride channel (Clcn1) exon 7a ( Figure 5 and Figure 6 ).

[0475] In HSA LR In mice, Nfix, Clcn1, Atp2a1, and Mbnl1 transcripts showed abnormally increased inclusion of exons 7, 7a, 22, and 5, respectively, but their levels in muscle were restored to 30% to 50% of normal values ​​after treatment with 3 mg / kg of MD23-b V2 3'Ol and other similar molecules.

[0476] Example 6

[0477] To analyze all DM1-related functional and molecular phenotypes measured in the model mice, we generated spider plots ( Figure 7 ), and the recovery index (RIm) of each individual mouse after treatment for different parameters (Mbnl1 protein, Mbnl1 / 2 expression levels, splicing recovery, Mbnl1 ex5 inclusion recovery, and functional recovery) was calculated according to the following formula:

[0478]

[0479] The value MT is the individual value for each treated (PBS or oligonucleotide injected) mouse, is the mean of untreated diseased mice (PBS injected), and is the average of the healthy mice group (FVB). Next, the individual RI values ​​(RIm) were averaged to generate Figure 7 The global RI values ​​are shown.

[0480] These values ​​range from 0 to 1, with 0 being untreated mice (HSA LR -PBS), and 1 is healthy mouse (FVB). Mbnl1 protein refers to the average of the values ​​obtained by quantitative dot blot of the two muscles (quadriceps and gastrocnemius) treated in each group. Mbnl1 / 2 expression level refers to the average of the values ​​obtained by real-time PCR of the muscles (quadriceps and gastrocnemius) and genes (Mbnl1 and Mbnl2) treated in each group using the aforementioned formula. Splicing recovery refers to the average inclusion percentage of Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in the two muscles treated in each group. Mbnl1 ex5 inclusion recovery refers to the inclusion percentage of Mbnl1 exon 5 in the two muscles treated in each group. Functional recovery refers to the average of the force / weight obtained values ​​for each mouse after treatment and the myotonic discharge grade of each treatment group.

[0481] These pictures are Figure 7 As shown in Tables 5 and 6, MD23b-2V2 3'Ol is the anti-miR molecule that produces the strongest rescue in all phenotypes studied. It is noteworthy that the difference in efficacy when the same anti-miR sequence is non-conjugated or conjugated to palmitic acid supports our surprising results in in vitro studies and confirms that the molecule has a significantly stronger therapeutic effect when conjugated to oleic acid. The second best performing molecule is MD23b-2PS / PO 3'Ol, which is slightly better than MD23b-2PS / PO5'Ol. These data also support the results obtained with in vitro conjugation to cholesterol, confirming that conjugation of the carrier at the 3' is beneficial. As observed in vitro, anti-miRs against miR-218-5p produce lower phenotypic rescue. The data support inhibition of miR-23b-3p ( Figure 7 B and Table 5) than inhibiting miR-218-5p ( Figure 7 B and Table 6) have a stronger therapeutic effect. In the case of molecule 218MOE ( Figure 7 B), conjugation with oleic acid also improved its in vivo activity. Therefore, it was confirmed that the effect of oleic acid conjugation on the in vivo therapeutic effect is not limited to a specific nitrogenous base sequence, but has a wider application.

[0482] Table 5

[0483]

[0484] Table 6

[0485]

[0486] Example 7

[0487] In all the anti-miRs tested, we always used an amino-containing spacer to form an amide bond between oleic acid and the oligonucleotide to conjugate oleic acid at either the 3' or 5' end. The first spacer was a 6-aminohexyl group introduced at both the 3' and 5' ends (NHC6 spacer). Next, we tested other types of spacers (NHC6, NHC3, or threonol) as well as spacers of different sizes (3 or 6 carbon atoms) added between the oligo sequence MD23b-2V2 and oleic acid ( Figure 8 ) can improve the effect of the conjugated molecules on MBNL1 protein levels. We observed that all anti-miRs (Tables 7, 8 and Fig. 9 4 in total) were able to produce upregulation of MBNL1 protein. It is noteworthy that the molecule conjugated with threonine alcohol was the most active, as it reached EC50 at the lowest concentration, but the spacer molecule with 6 carbons (NHC6) had the strongest effect on the maximum upregulation of the protein. This data suggests that modification of the spacer molecule can also modulate the efficacy and pharmacodynamics of the anti-miR conjugated to oleic acid of the present invention.

[0488] Table 7

[0489]

[0490] Table 8

[0491] ASO EC50(μM) Emax (maximum multiple change) MD23b-2 V2 3'Ol 0.062 2.30 MD23b-2 V2 3'Ol(C6SSC6)(NHC3) 0.217 1.96 MD23b-2 V2 3'O1(C6SSC6)(NHC6) 0.164 3.05 MD23b-2 V2 3'Ol (threonine alcohol) 0.007 1.98

[0492] Example 8

[0493] Although the synthesis of oligonucleotides is well known in the art, we provide here an example of the synthesis of MD23b-2V23'O1, which is a 16 nt long oligonucleotide composed of LNA, 2'-O-MOE and 2'-O-Me modified nucleotides linked by phosphodiester or phosphorothioate bonds. Its 3' end is partially modified with oleic acid ( Fig.10 ). The oleic acid is introduced by conjugating an activated carboxylic acid to the hexylamino spacer molecule at the 3' end of the precursor oligonucleotide. The synthesis of MD23b-2V23'Ol is based on solid phase synthesis using nucleotides and a spacer molecule -GPG. This process includes two main steps.

[0494] First, an unconjugated oligonucleotide (precursor) of the sequence AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NH2C6) is synthesized. The first phosphoramidite, considered to be a building block in the chain, is attached to a solid surface via a catalytic condensation reaction. This step will be repeated as many times as the nucleotide length of the final sequence. In this case, it is 16 times. After completing the solid phase synthesis, production includes the following steps: cleavage and deprotection, purification, and desalting.

[0495] Second, conjugation with oleic acid. After the desalted unconjugated oligonucleotides from the previous step were conjugated with oleic acid, they were purified, desalted, and lyophilized.

[0496] Example 9

[0497] 1.1 Quantification of MD23 b-2V23'Ol by ELISA

[0498] MD23b-2V2 and MD23 b-2V23'O1 were used. LR The compound of 12mg / kg dosage was administered intravenously to mice. After 14 days, all mice were euthanized, and their brain, kidney, liver, gastrocnemius and quadriceps femoris were taken out, weighed and frozen for further processing. The experiment was carried out by the researcher in a blind manner. During the autopsy procedure, samples of brain, muscle (quadriceps femoris and gastrocnemius), kidney and liver were collected from all experimental groups. Weigh after sample collection, in grams, accurate to 3 decimal places. Each piece is placed in a test tube without RNase, and quickly frozen (for example, 2ml Eppendorf test tube without RNase).

[0499] 1.1.1 Sample preparation

[0500] 1) Remove tissue and wash in phosphate-buffered saline.

[0501] 2) Dry the tissues on absorbent paper and weigh them (20 mg for each tissue; in the case of the brain, 30 mg for each tissue).

[0502] 3) For every 10 mg of tissue, add 100 μL of RIPA buffer supplemented with PhosSTOP EASYpack and Complete ULTRA Tablets, Mini, EASYpack (1 tablet per 10 mL of RIPA buffer).

[0503] 4) Homogenize the tissue in a 2 ml Eppendorf tube using a tissue grinder for 20 seconds, 4 times at 5000 RPM, or until the tissue is completely homogenized.

[0504] 5) Incubate the homogenate at 55°C overnight.

[0505] 6) Centrifuge the homogenate at 15000 rpm for 15 minutes, aliquot the supernatant, and store the aliquots at -20°C until analysis.

[0506] For muscle lysates, use the actual homogenate diluted 1 / 10 in oligo dilution buffer. If samples are above the limit of quantitation, use a 1:40 dilution.

[0507] For brain, use a 1 / 5 dilution, and for liver and kidney, use a 1:400 dilution.

[0508] 1.1.2 Preparation of stock solution for standard curve

[0509] In the case of stock solution preparation for the standard curve. First, a 20 μM stock solution of MD23b-2V23'Ol was prepared. For the standard curve preparation, a 1 μM concentration was used. Therefore, the 20 μM stock solution was diluted in water to a final volume of 1 μM and stored in different aliquots. For each experiment, a fresh standard curve was made, for which it was necessary to heat the 1 μM stock solution at 65 ° C for 15 minutes each time. On the other hand, after the preparation of the tissue homogenate, 55 μL of the homogenate was added to 5445 μL of the compound dilution buffer to obtain a control tissue homogenate.

[0510] 1.1.3 Preparation of standard curve

[0511] To do this, a control tissue homogenate is needed to prepare a standard dilution. Then, to prepare a serial dilution, 1 μM of the desired compound is denatured at 65°C for 15 minutes and vortexed for at least 30 seconds. Then 32 μL of the denatured compound is diluted in 968 μL of the control homogenate. This is the first point of the standard curve (32000 pM). Then for the next point, 500 μL of 32000 pM is diluted in 500 μL of compound dilution buffer (16000 pM). In a similar manner, 8000 pM, 4000 pM, 2000 pM and 1000 pM are prepared.

[0512] Table 9: ELISA design

[0513]

[0514] 1.1.4QC

[0515] Three QC levels (L, M, H) were run in triplicate for each run

[0516] Acceptance criteria:

[0517] QCs ≥ 67% should be ± 30% of the nominal (theoretical) value.

[0518] 1.1.5 ELISA protocol

[0519] - The probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester (stock solution 100 μM in water and 1 μM of this stock solution was prepared in water) required heating at 65° C. for 15 minutes and vortexing for 30 seconds.

[0520] - Before starting the experiment, prepare sample homogenates and serial dilutions of oligonucleotides.

[0521] - Dilute the probe (1 μM) at a concentration of 0.5 nM in hybridization buffer.

[0522] - Add 70 μL of each dilution of the desired compound in triplicate or in duplicate if sample homogenate. Then add 70 μL of the probe at a concentration of 0.5 nM.

[0523] - Seal the plate with PCR film and incubate at 37°C for 30 minutes (this is an important step for hybridization of the probe to the compound!) - Prior to this step, we can do this in a regular clear 96-well plate.

[0524] - Then immediately transfer 100 μL of the hybridization solution to a black neutral streptavidin-coated plate.

[0525] - The plate was then sealed again with PCR film and incubated at 37°C for 30 minutes (this is an important step for the biotin to bind to the avidin coated plate).

[0526] - During the incubation step, prepare micrococcal nuclease in micrococcal nuclease dilution buffer (1.6 μL nuclease + 16 ml buffer). This calculation is done for the entire plate.

[0527] - First remove the liquid, wash the plate 6 times with 100 μL of wash buffer, then dry the plate using absorbent paper by keeping the plate upside down, and add 150 μL of micrococcal nuclease to each well (final amount 30 U / well).

[0528] - After adding micrococcal nuclease, the plate was sealed with PCR membrane and incubated at 37°C for 1 hour (this step was sufficient to cleave at least 99% of the single-stranded probes).

[0529] - Prepare TBS buffer containing 0.25% Tween 20 and antibody (anti-digoxigenin antibody, Roche #11093274910), vortex well, and place it at room temperature. The remaining amount not needed can be stored in aliquots in the refrigerator.

[0530] - First remove the liquid, then wash the plate 6 times with 100 μL of wash buffer, dry the plate and add 150 μL of anti-digoxigenin antibody (conjugated to alkaline phosphatase) diluted 1 / 5,000 in TBS buffer (containing 0.25% v / v Tween 20).

[0531] - Seal the plate with PCR film and incubate at 37°C for 30 minutes.

[0532] - To prepare Attophos substrate, dilute 36 mg powder (in bottle) by adding 60 ml Attophos buffer and store in refrigerator protected from light (best wrapped in aluminum foil).

[0533] - Remove the liquid, wash the plate 6 times with 100 μL wash buffer, dry the plate and add 150 μL Attophos substrate (diluted 1:1 in Attophos buffer).

[0534] - The plate was sealed with PCR film and then wrapped with aluminum foil and incubated at room temperature (RT) for 40 minutes. The fluorescence intensity was then measured using SynergyH1 (Biotek). 444nm excitation and 555nm emission were used. Each well was delayed for 1 second and continuous readings were performed at 60 minutes, 70 minutes, 80 minutes and 90 minutes.

[0535] Table 10: Mean values ​​of MD23b-2V2 3'01 and MD23b-2V2 in brain, gastrocnemius, quadriceps, kidney and liver (ng / g)

[0536] Test items Processing time (days) Dosage (mg / kg) organize Compound (ng / g) MD23b-2V2 3'Ol 14 12 brain 289.9 MD23b-2V2 3'Ol 14 12 Gastrocnemius 25657.9 MD23b-2V2 3'Ol 14 12 Quadriceps 15827.7 MD23b-2V2 3'Ol 14 12 kidney 74971.6 MD23b-2V2 3'Ol 14 12 liver 183881.1 MD23b-2V2 14 12 brain 0.0 MD23b-2V2 14 12 Gastrocnemius 2705.2 MD23b-2V2 14 12 Quadriceps 1790.2 MD23b-2V2 14 12 kidney 18840.3 MD23b-2V2 14 12 liver 39570.1

[0537] Table 11: Fold change in delivery efficiency of MD23B-2V2 3'OL compared to MD23b-2V2

[0538]

[0539] *Fold changes were calculated based on the amount of compound MD23b-2V2

[0540] Results and Fig.11

[0541] We have observed that after 14 days of application, these two compounds are present in muscles (gastrocnemius and quadriceps femoris) as well as in liver and kidney. In all tissues, the control group was below the limit of quantification. And compound MD23 b-2V2 3'01 is the only compound that can reach the brain. In terms of tissue delivery, MD23b-2V2 3'01 compound is superior to MD23 b-2V2 because it can reach all tissues more effectively, including gastrocnemius, quadriceps femoris, liver, kidney and brain. Although we detected a higher amount of MD23b-2V2 3'01 in all tissues, its delivery to gastrocnemius and quadriceps femoris was 9.5 times and 8.8 times that of MD23 b-2V2, respectively. In contrast, the delivery to kidney and liver was only 4 times and 4.5 times, respectively, indicating that the delivery to muscle was enhanced compared to less relevant tissues in the disease. MD23b-2V2 3'01 was able to reach the brain, whereas MD 23b-2V2 did not, suggesting that conjugation with oleic acid facilitates its access to this tissue. Taken together, we conclude that oleic acid improves the delivery of the compound, most importantly to tissues involved in pathology such as muscle and brain.

[0542] Example 10: Determination of MD23 b-2V2 3'OL and MBNL1 protein levels in non-human primate brains

[0543] The aim of this study was to determine exposure in the brain of animals treated with MD23b-2V2 3'OL using an enzyme-linked immunosorbent assay (ELISA). In addition, target engagement on the brain of treated animals was measured by quantifying muscleblind-like type 1 (MBNL1) protein levels from non-human primate brains.

[0544] 1. Experimental Design

[0545] 1.1 Experimental groups and drug administration

[0546] To this end, a total of 8 cynomolgus monkeys (4 males and 4 females) aged approximately 24 to 50 months were divided into 3 experimental groups and also assigned to Phase 1 (maximum tolerated dose (MTD) group assignment) and Phase 2 (fixed dose (FD) group assignment). In Phase 1 (maximum tolerated dose [MTD] phase), one male and one female Asian cynomolgus monkey were assigned to Group 1 and administered intravenously (slow push [10 minutes]) at a dose of 5 mg / kg, 10 mg / kg, 15 mg / kg and 20 mg / kg on days 1, 15, 29 and 43 of the MTD phase in an ascending dose design under non-fasting conditions with a dose volume of 5 mL / kg.

[0547] After completion of the MTD phase, three male and three female cynomolgus monkeys of Asian origin were assigned to Groups 2 and 3 of Phase 2 (fixed-dose phase) and administered vehicle (phosphate buffered saline [PBS, pH: 7.4]) or 20 mg / kg MD23 b-2V2 3'01 (slow bolus [10 minutes]) at a dose volume of 5 mL / kg intravenously on Days 1 and 22 of Phase 2 under non-fasting conditions.

[0548] On the day of sacrifice, brain samples were collected during the necropsy procedure.

[0549] Grouping and Dose Levels

[0550] Table 12: Phase 1: Maximum Tolerated Dose (MTD) Grouping

[0551]

[0552] Table 13: Phase 2: Fixed-dose (FD) groups

[0553]

[0554] 2. Experimental Data

[0555] 2.1 Experimental Procedure

[0556] 2.1.1 Sample collection

[0557] Brains from all animals in Groups 1 to 3 were collected for ELISA quantification, MBNL1 studies, and potential off-target determinations. Two weeks after the last administration of Phase 1 animals and 3 weeks after the end of the treatment period for Phase 2 animals. Each piece was placed in a separate RNase-free Eppendorf tube, frozen in liquid nitrogen, and stored at (-80 ± 10 ° C). A total of 8 brain samples were generated.

[0558] 2.1.2 ELISA quantification

[0559] 2.1.2.1 Sample preparation

[0560] 1) Remove tissue and wash in phosphate-buffered saline.

[0561] 2) Dry the tissue on absorbent paper and weigh it (20 mg for each tissue).

[0562] 3) For every 10 mg of tissue, add 100 μL of RIPA buffer supplemented with PhosSTOP EASYpack and Complete ULTRA Tablets, Mini, EASYpack (1 tablet per 10 mL of RIPA buffer).

[0563] 4) Homogenize the tissue in a 2 ml Eppendorf tube using a tissue grinder for 20 seconds, 4 times at 5000 RPM, or until the tissue is completely homogenized.

[0564] 5) Incubate the homogenate at 55°C overnight.

[0565] 6) Centrifuge the homogenate at 15000 rpm for 15 minutes, aliquot the supernatant, and store the aliquots at -20°C until analysis.

[0566] For brain lysates, the actual homogenate used was a 1 / 5 dilution (80 μL + 320 μL Oligonucleotide Dilution Buffer).

[0567] 2.1.2.2 Preparation of stock solution for standard curve

[0568] In the case of stock solution preparation for the standard curve. First, prepare a 20 μM stock solution of MD23b-2V2 3'Ol. This can be stored at -20 °C for longer periods of time. From this 20 μM stock solution, we can make several dilutions as needed. For the standard curve preparation, we need 1 μM. Therefore, the 20 μM stock solution is diluted in water to a final volume of 1 μM and stored in different aliquots. For each experiment, we need to make a fresh standard curve, for which we need to heat the 1 μM stock solution at 65 °C for 15 minutes each time. On the other hand, after preparing the tissue homogenate, add 55 μL of tissue homogenate to 5445 μL of compound dilution buffer as a control.

[0569] 2.1.2.3 Preparation of standard curve

[0570] To do this, we need a control tissue homogenate to prepare a standard dilution. Then prepare a serial dilution, first take 1 μM of the desired compound, denature at 65 ° C for 15 minutes, and vortex for at least 30 seconds. Then take 16 μL of the denatured compound and dilute it in 984 μL of the control homogenate. This is the first point of the standard curve (16000pM). Then, for the next point, take 500 μL of 16000pM and dilute it in 500 μL of PMO dilution buffer (8000pM). In a similar manner, prepare 4000pM, 2000pM, 1000pM and 500pM.

[0571] Table 14:

[0572]

[0573] 2.1.2.4QC

[0574] Three QC levels (L, M, H) were run in triplicate for each run. Acceptance criteria:

[0575] QCs ≥ 67% should be ± 20% of the nominal (theoretical) value, and QCs at each level ≥ 50% should be ± 20% of their nominal concentration.

[0576] 2.1.2.5 ELISA protocol

[0577] - The probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester (stock solution 100 μM in water and 1 μM of this stock solution was prepared in water) required heating at 65° C. for 15 minutes and vortexing for 30 seconds.

[0578] - Before starting the experiment, prepare sample homogenates and serial dilutions of oligonucleotides.

[0579] - Dilute the probe (1 μM) at a concentration of 0.5 nM in hybridization buffer.

[0580] - Add 70 μL of each dilution of the desired compound in triplicate, or in duplicate if sample homogenate. Then add 70 μL of the probe at a concentration of 0.5 nM.

[0581] - Seal the plate with PCR film and incubate at 37°C for 30 minutes (this is an important step for hybridization of the probe to the compound!) - Prior to this step, we can do this in a regular clear 96-well plate.

[0582] - Then immediately transfer 100 μL of the hybridization solution to a black neutral streptavidin-coated plate.

[0583] -The plate was then sealed again with PCR film and incubated at 37°C for 30 minutes (this is an important step to bind the biotin to the avidin coated plate!)

[0584] - During the incubation step, prepare micrococcal nuclease in micrococcal nuclease dilution buffer (1.6 μL nuclease + 16 ml buffer). This calculation is done for the entire plate.

[0585] - First remove the liquid, wash the plate 6 times with 100 μL of wash buffer, then dry the plate using absorbent paper by keeping the plate upside down, and add 150 μL of micrococcal nuclease to each well (final amount 30 U / well).

[0586] - After adding micrococcal nuclease, the plate was sealed with PCR membrane and incubated at 37°C for 1 hour (this step was sufficient to cleave at least 99% of the single-stranded probes).

[0587] - Prepare TBS buffer containing 0.25% Tween 20 and antibody, vortex well, and place it at room temperature. For the remaining amount not needed, it can be stored in aliquots in the refrigerator.

[0588] - First remove the liquid, then wash the plate 6 times with 100 μL of wash buffer, dry the plate and add 150 μL of anti-digoxigenin antibody (conjugated to alkaline phosphatase) diluted 1 / 5,000 in TBS buffer (containing 0.25% v / v Tween 20).

[0589] - Seal the plate with PCR film and incubate at 37°C for 30 minutes.

[0590] - To prepare Attophos substrate, dilute 36 mg powder (in bottle) by adding 60 ml Attophos buffer and store it in refrigerator protected from light (best wrapped in aluminum foil).

[0591] - Remove the liquid, wash the plate 6 times with 100 μL wash buffer, dry the plate and add 150 μL Attophos substrate (diluted 1:1 in Attophos buffer).

[0592] - The plate was sealed with PCR film and then wrapped with aluminum foil and incubated at room temperature (RT) for 40 minutes. The fluorescence intensity was then measured using SynergyH1 (Biotek). Excitation at 444nm and emission at 555nm were used. Each well was delayed for 1 second and continuous readings were performed at 40 minutes, 50 minutes, 60 minutes, 70 minutes, 80 minutes and 90 minutes.

[0593] 2.1.2.6 Acceptance criteria for ELISA assay

[0594] The accuracy of an analytical method describes how close the mean of the test results obtained by the method is to the true value (concentration) of the analysis. Precision is estimated by the relative error (RE%) of the measurement. The true value of the reference control for both ELISA assays is inconsistent with the theoretical concentration based only on calculations. Therefore, the nominal concentration of the control will be calculated as the mean of all reference sample sets for each concentration level in all analytical batches.

[0595]

[0596] The precision of an analytical method describes how closely the individual measurements of an analyte are obtained when the procedure is applied repeatedly to multiple aliquots of a single homogeneous volume of a biological matrix. Precision is estimated by the coefficient of variation (CV%).

[0597]

[0598] Table 15:

[0599]

[0600] 2.1.3 MBNL determination

[0601] 2.1.3.1 Protein extraction

[0602] NHP brain samples were mechanically disrupted using TissueLyser II (QIAGEN) and homogenized in RIPA buffer (Thermo Fisher Scientific, Cat. No. 89900) supplemented with protease and phosphatase inhibitors (Roche, Cat. No. 11873580001 and 4906845001). Total protein was quantified using PierceTM BCA Protein Assay Kit (Cat. No. 23225) with bovine serum albumin as standard.

[0603] 2.1.3.2 Western Blot:

[0604] For immunodetection of MBNL1 protein and GAPDH protein (internal control for normalization), 15 μg of total protein from each animal sample was denatured by heat treatment at 100°C for 5 min, separated by electrophoresis on 12% SDS-PAGE gels, and subsequently transferred to 0.45 μm nitrocellulose membranes (GE Healthcare).

[0605] The membrane was blocked for 1 hour using PBS-T (8mM Na2HPO4, 150mM NaCl, 2mM KH2PO4, 3mM KCl, 1% Tween 20, pH 7.4) with 5% skim milk. After blocking, the membrane was incubated overnight at 4°C with an anti-MBNL1 mouse primary antibody (1:200, MB1a (4A8) (DSHB, Iowa City, Iowa). After incubation with the primary antibody, the membrane was incubated for 1 hour at room temperature with an anti-mouse secondary antibody (1:3500, (HRP)-conjugated anti-mouse IgG secondary antibody, Sigma-Aldrich, St. Louis, Missouri) conjugated to horseradish peroxidase. Finally, enhanced chemiluminescent substrate (ECL, Pierce) was used for visualization, and an ImageQuant 800 Amersham device (GE Healthcare) was used to obtain images.

[0606] After detecting the immunoreactive band corresponding to MBNL1, the membrane was stripped to remove the currently used antibody, and the band corresponding to the GAPDH protein used as a normalizer was detected. After blocking (as described above), the detection was performed using an anti-GAPDH antibody conjugated to HRP (1:3500, clone G-9, Santa Cruz). For the anti-GAPDH antibody conjugated to HRP, the incubation time lasted for 1 hour, at room temperature. The analysis was performed in duplicate.

[0607] 2.1.3.3 Quantification:

[0608] All images were quantified using the analysis software ImageJ. The results of the amount of MBNL1 protein for each sample were first normalized based on GAPDH, and the ratio was normalized based on the mean of the ratios of untreated animals (relative protein levels).

[0609] 3. Results

[0610] 3.1 Determination of MD23 b-2V2 3'Ol from NHP brain

[0611] Table 16: Concentrations of MD23 b-2V2 3'01 in the brain of cynomolgus monkeys on day 14 (group 1) and day 21 (groups 2 and 3) after the last treatment (nM, ng / mg, ng / g).

[0612]

[0613] Eight samples from eight animals were analyzed in one plate in one analytical run for determination of MD23 b-2V2 3'01 by ELISA. All samples were measured in triplicate. The analytical run met the acceptance criteria.

[0614] All treated animals in both Phase I and Phase II showed some level of the test item during the analysis period. No animals from the control group showed quantifiable levels of MD23b-2V2 3'OL in their brains.

[0615] During the fixed dose period, all animals treated at 20 mg / kg presented some level of the test item in all brains tested. For animals from the MTD, males (P0001) presented levels above the limit of quantitation.

[0616] 3.2MBNL1 relative level

[0617] Table 17: MBNL1 relative levels. Average values ​​for phase I and phase II.

[0618]

[0619] MBNL1 protein levels in Group 1 were quantified in samples collected two weeks after the last dose. The results showed that MBNL1 protein levels were higher in the test brains compared to samples from untreated animals (Table 18, Fig.12 ). Protein levels in the brain were twice as high as those in the control group. The test item produced a pharmacological effect in the brain that resulted in an increase in MBNL protein when compared to untreated animals, and the increase in MBNL protein was still present at 2 and 3 weeks after dosing. The results were similar in males and females.

[0620] 4. Discussion and Conclusion

[0621] Results from quantification by ELISA showed that the treated groups (Groups 1 and 3) had quantifiable levels of MD23b-2V2 3'OL in the brain 2 and 3 weeks after the last intravenous administration of MD23b-2V2 3'OL. In addition, treated animals had higher levels of MBNL1 protein in the brain compared to untreated animals 2 and 3 weeks after the last administration. These results confirm the presence and activity of the test item in the brain of animals treated with MD23b-2 V2 3'OL.

Claims

1. An oleic acid molecule for use as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' end and / or 5' end of an oligonucleotide molecule or an analog thereof, wherein the oligonucleotide molecule or the analog thereof is an active ingredient in a method of treatment by therapy.

2. Oleic acid for use according to claim 1, wherein the oligonucleotide molecule or its analogue comprises a mixture of phosphorothioate bonds and phosphodiester bonds chemically linking nucleotides, and wherein the number of nucleotides chemically linked via phosphorothioate bonds is greater than the number of nucleotides chemically linked via phosphodiester bonds.

3. Oleic acid for use according to claim 1 or 2, wherein the oligonucleotide molecule or its analogue is an antagonist of microRNA. 4 . Oleic acid for use according to claim 3 , wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.

5. Oleic acid for use according to any one of claims 1 to 4, wherein when the oligonucleotide molecule or its analog is administered via intravenous, intraarterial or subcutaneous route, the oleic acid used as a vehicle delivers the oligonucleotide molecule or its analog to the muscle and / or CNS cells of a subject in need thereof.

6. Oleic acid for use according to any one of claims 1 to 5, wherein the method of treatment by therapy comprises preventing or treating muscle diseases, nervous system diseases, and / or RNA diseases.

7. Oleic acid for use according to claim 6, wherein the disease is myotonic dystrophy.

8. Oleic acid for use according to claim 7, wherein the myotonic dystrophy is myotonic dystrophy type 1.

9. An oligonucleotide molecule, or a mixture of two or more such oligonucleotide molecules, conjugated to at least one oleic acid molecule at its 3' end and / or 5' end, wherein the oligonucleotide molecule is an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p, has a length of 10 to 30 nucleotides, and comprises a fragment consisting of a string of at least 15 consecutive nitrogen bases of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

10. The oligonucleotide molecule according to claim 9, further comprising a mixture of phosphorothioate bonds and phosphodiester bonds chemically linking the nucleotides, wherein the number of nucleotides chemically linked via phosphorothioate bonds is greater than the number of nucleotides chemically linked via phosphodiester bonds.

11. An oligonucleotide molecule according to any one of claims 9 or 10, wherein the oligonucleotide molecule comprises a fragment consisting of a series of at least 15 consecutive nitrogen bases of nucleotides that are exactly the same as the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p).

12. An oligonucleotide molecule according to any one of claims 9 to 11, wherein the oligonucleotide molecule has at least 80% identity with SEQ ID NO: 22, 23 or 25, and wherein the spacer molecule defined in the SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine, and derivatives thereof.

13. The oligonucleotide molecule according to any one of claims 9 to 12, wherein the oligonucleotide molecule has at least 80% identity with SEQ ID NO: 22, 23 or 25, wherein the spacer molecule defined in SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine, and derivatives thereof, and wherein the oligonucleotide molecule is capable of increasing the endogenous level of MBNL1 and / or MBNL2 protein. 14 . The oligonucleotide molecule according to claim 9 , wherein the nucleotide sequence of the oligonucleotide consists of SEQ ID NO: 3, 4 or 7.

15. A composition, preferably a pharmaceutical composition, comprising at least one oligonucleotide molecule according to any one of claims 9 to 14 or a mixture of two or more such oligonucleotide molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

16. A composition according to claim 15 for therapeutic use.

17. The composition of claim 15, when administered via intravenous, intraarterial or subcutaneous routes, is used to target muscle cells and / or central nervous system cells in a subject in need thereof.

18. The composition of claim 15, which is used for preventing or treating muscle diseases, nervous system diseases, and / or RNA diseases.

19. The composition for use according to claim 18, wherein the disease is myotonic dystrophy.

20. The composition for use according to claim 19, wherein the myotonic dystrophy is myotonic dystrophy type 1.

Images