Transcription factor gene osrav9 for regulating rice resistance to rice blast and application thereof
By cloning and overexpressing the OsRAV9 gene, we constructed overexpression and CRISPR/Cas9 knockout vectors to enhance rice blast resistance, solve the environmental problems caused by chemical pesticide control, provide molecular mechanism guidance for rice blast resistance genes, and improve the safety of rice production.
Patent Information
- Application Number
- CN202510159601.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-12
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2045-02-12
AI Technical Summary
In current technologies, the prevention and control of rice blast mainly relies on chemical pesticides, which poses problems of environmental pollution and ecological damage. Furthermore, research on rice blast resistance genes has not been in-depth, and there is a lack of effective molecular mechanism guidance, which affects the safe production of rice.
By cloning and overexpressing the OsRAV9 gene, overexpression vectors and CRISPR/Cas9 knockout vectors were constructed to enhance rice blast resistance. The OsRAV9 gene was used as a positive regulator to improve rice resistance to rice blast.
Overexpression of the OsRAV9 gene significantly enhanced rice blast resistance, while mutants were more susceptible to rice blast, indicating that OsRAV9 plays an important role in rice blast resistance by regulating the accumulation of hydrogen peroxide in rice to improve resistance.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the functional identification and application of the transcription factor OsRAV9 gene in regulating rice resistance to rice blast. Background Technology
[0002] Rice is one of the most important grain crops in my country, with an annual sowing area of about 30 million hectares, accounting for about 33% of the total grain crop planting area and a total output accounting for 45% of my country's total grain output. Biological disasters are one of the important factors affecting the stable and high yield of rice in my country (Lin MM, Liu XL, Lin X. Status and Development Trend of Rice Production in China. Hans Journal of Agricultural Sciences, 2023, 13(6): 562-567). Rice blast is a rice disease caused by heterothallic ascomycetes. The rice blast fungus can infect the roots of rice, as well as the above-ground parts including stems, leaves, leaf sheaths and panicle necks. It has become one of the three major diseases that seriously hinder rice production, causing yield losses of up to 11% to 30% per year, and in severe cases, even complete crop failure (Yang Can, Wang Yucui, Wu Weihuai, et al. Research progress on population genetic structure and pathogenicity of rice blast fungus [J]. Anhui Agricultural Sciences, 2015, 43(13): 111-114.). Currently, the use of chemical agents remains the main measure for controlling rice blast. Although chemical pesticides are effective in the short term, the environmental pollution, ecological damage, and human health risks they bring cannot be ignored. Therefore, continuously exploring rice blast resistance genes and analyzing their molecular mechanisms of resistance will provide theoretical guidance and germplasm resources for the breeding of rice blast-resistant varieties, which is of great reference value for the safe production of rice.
[0003] The RAV gene family consists of plant-specific transcription factors belonging to the B3 superfamily. These genes possess one or more DNA-binding domains, including the B3 domain and the AP2 domain. They play crucial roles in plant growth and development, signal transduction, and abiotic stress responses (Genome-wide identification and expression analysis of transcription factors of RAV family in litchi. Yue XQ, Yang CK, Yue Z, Kai BZ. 2022). The AP2 / ERF (APETALA2 / ethylene responsive factor) transcription factor is one of the largest transcription factor families in plants and plays a vital role in regulating abiotic stress responses in rice. When rice encounters adverse conditions, the AP2 / ERF transcription factor can bind to cis-acting elements such as GCAC(A / G)N(A / T)TCCC(A / G)ANG(C / T), GCC-box(AGCCGCC), and DRE / CRT(A / GCCGAC) in the promoter regions of stress-related genes, thereby regulating the expression of these genes and improving the rice's adaptability to adverse environments (Tsubasa SJ, Ling Y. ERF gene clusters: working together to regulate metabolism. Trends Plant Sci, 2021, 26:23-32.). Furthermore, the AP2 / ERF transcription factor family plays important functions and regulatory roles in plant growth, development, and metabolite synthesis. All AP2 / ERF family proteins contain at least one highly conserved AP2 DNA-binding domain consisting of 60–70 amino acid residues (Nakano T, Suzuki K, Fujimura T, Shinshi H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol, 2006, 140:411-432.). Some AP2 / ERF proteins contain transcriptional repressor domains, and transcription factors containing the EAR (L / FDLNL / F(X)P) motif play a negative regulatory role in the expression of plant stress response genes.Most RAV genes encode the conserved sequence R / KLFGV, called the BRD (B3 repression domain), which mainly functions as a transcriptional repressor (Kagaya Y, Tsukaho H. Arabidopsis transcription factors, RAV1 and RAV2, are regulated by touch-related stimuliin in a dose-dependent and biphasic manner. Genes Genet Syst, 2009, 84:95-99.). Furthermore, each AP2 / ERF transcription factor contains one or more nuclear localization signaling regions, primarily containing arginine and lysine, which regulate the transcription factor's entry into the nucleus to perform its function (Wang Y H. Rice ERF Transcriptional Activator DRF2 Regulates Wax Biosynthesis in Leaf Surface. MS Thesis of Chinese Academy of Agricultural Sciences, Beijing, China, 2010). AP2 / ERF transcription factors, especially the ERF and DREB subfamilies, occupy important positions in rice stress response signaling pathways. Under normal growth conditions, the expression level of AP2 / ERF genes is usually low, but it increases significantly when subjected to abiotic stress. AP2 / ERF can bind to elements such as GCC-box, DRE / CRT, or GT-1 (GAAAAA) to regulate the expression of downstream target genes, ultimately causing physiological and biochemical changes and helping to resist external abiotic stress.
[0004] In summary, the RAV gene family plays diverse roles in plant biology, with functions encompassing growth and development, stress response, and hormone signaling. In-depth research on the RAV gene family helps us understand how plants adapt to and respond to complex environmental changes, providing a theoretical basis and molecular tools for crop improvement and agricultural production. However, the function of the RAV family in resisting rice blast in rice remains unclear. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of existing technologies and to provide an application of the transcription factor gene OsRAV9 in rice blast resistance. This application involves overexpressing OsRAV9 to enhance rice blast resistance, providing a new genetic resource for blast-resistant rice.
[0006] (1) Cloning of the OsRAV9 gene
[0007] RNA was extracted from leaves of the japonica rice variety Nipponbare and reverse transcribed into cDNA using Superscript III (purchased from Invitrogen, USA). Reaction conditions: 65℃ for 5 min, 50℃ for 60 min, and 70℃ for 10 min. Using rice genome information, amplification primers OsRAV9-full-F (5'ATGGGGGTGGTCAGCTTCTC 3') and OsRAV9-full-R (5'ATCACCAGAGTCCAACACATTACCT3') were synthesized to amplify the full-length cDNA of the OsRAV9 gene (1722 bp). PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 2 min 50 sec, 28 cycles; extension at 72℃ for 7 min. The PCR product obtained by amplification was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced to obtain the required gene ORF, the sequence of which is the nucleotide sequence shown in SEQ ID NO:1, encoding a 365 amino acid sequence (the sequence shown in SEQ ID NO:2).
[0008] (2) OsRAV9 gene overexpression and construction of CRISPR / Cas9 knockout lines
[0009] This invention constructed an overexpression vector pU1301-OsRAV9-Flag (see Figure 2, A) and a CRISPR / Cas9-OsRAV9 gene knockout vector (Figure 2, B). The applicant used Agrobacterium-mediated transformation to transform these two vectors into the japonica rice variety Nipponbare, obtaining positive lines for gene overexpression and positive lines for CRISPR / Cas9. The expression levels were detected, and two T1 generation overexpression lines (numbered OE-RAV9-14 and OE-RAV9-13, see Figure 3, A) and two CRISPR / Cas9 transformed lines were selected. (Detection primers were designed upstream and downstream of the target site to amplify the corresponding fragments and perform sequencing. Materials with gene editing at the target site, resulting in large fragment deletions or premature translation termination, were screened for subsequent experiments. Finally, two lines with premature termination, numbered rav9-4 and rav9-9 (see Figure 3, B), were selected as materials for subsequent experiments.)
[0010] (3) Identification of the OsRAV9 gene in rice blast resistance
[0011] This invention evaluated OsRAV9 transgenic materials (overexpression lines and CRISPR / Cas9 mutant lines) against rice blast. The results showed that, compared to the control materials, the OsRAV9 overexpression materials exhibited enhanced resistance to rice blast, while the mutant materials were more susceptible to the disease.Figure 4 Hydrogen peroxide levels were detected 5 days after rice blast inoculation, showing that overexpressing plants had higher hydrogen peroxide content. Figure 5 This indicates that OsRAV9 is a positive regulator of rice resistance to rice blast.
[0012] Advantages of this invention:
[0013] (1) This invention analyzes the expression pattern of rice elongation factor complex genes induced by rice blast, screens and identifies the OsRAV9 gene, and finds that OsRAV9 is a positive regulatory factor for rice resistance to rice blast. Through genetic transformation, overexpression of this gene yields new rice lines resistant to rice blast, and it can also serve as a potential marker gene for rice resistance materials.
[0014] (2) Rice overexpressing OsRAV9 showed significantly enhanced resistance to rice blast, while the rav9 mutant was more susceptible to rice blast. This indicates that the OsRAV9 gene is involved in the rice resistance response to rice blast and plays an important role. Increasing the expression level of the OsRAV9 gene can regulate the accumulation of hydrogen peroxide in rice, thereby enhancing the rice's resistance to rice blast. Attached Figure Description
[0015] Figure 1 OsRAV9 induced expression pattern and phylogenetic tree analysis diagram. Figure label explanation: Figure 1 OsRAV9 was significantly induced to express after inoculating wild-type Nipponbare rice with rice blast fungus at 0, 48, 72, 96, and 144 hours, compared with the control.
[0016] Figure 2: Construction of OsRAV9 overexpression vector and CRISPR / Cas9 gene knockout vector. Figure labeling: Figure A in Figure 2 is a map of the pU1301-OsRAV9-3*Flag overexpression vector. Figure B in Figure 2 is a map of the CRISPR / Cas9-OsRAV9 gene knockout vector.
[0017] Figure 3: Detection results of transgenic progeny. Figure labeling: Figure A in Figure 3 shows the detection results of OsRAV9 overexpression material (T1 generation). Figure labeling: Two transgenic rice lines, OE-RAV9-14 (high expression level) and OE-RAV9-13 (medium expression level), were selected for subsequent studies. Figure B in Figure 3 shows the detection of RAV9 mutant gene editing type. Two mutant lines, rav9-4 and rav9-9, with premature translation termination, were selected for subsequent studies.
[0018] Figure 4 : Identification of rice blast resistance in control materials and transgenic materials. Figure labeling explanation: Figure 4Figure A shows the phenotypic observation of the control material (WT) and transgenic materials (OE-14, OE-13, rav9-4, rav9-9) 5 days after inoculation with rice blast fungus. Figure 4 Figure B in the middle shows the statistical results of plaque area. The results indicate that, compared with the control material, OsRAV9 overexpression is more resistant to rice blast, while the RAV9 mutant is more susceptible to rice blast.
[0019] Figure 5 Determination of hydrogen peroxide content in control and transgenic materials 5 days after inoculation with rice blast fungus. Detailed Implementation
[0020] Description of sequences in a sequence list
[0021] SEQ ID NO: 1 is the nucleotide sequence of the OsRAV9 gene cloned in this invention.
[0022] SEQ ID NO: 2 is the protein sequence encoded by the OsRAV9 gene.
[0023] The following examples define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the OsRAV9 gene, and for verifying the function of the OsRAV9 gene. Based on the following description and these examples, those skilled in the art can determine the essential features of the invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from its spirit and scope.
[0024] Example 1: Isolation and Cloning of the OsRAV9 Gene
[0025] 1. Rice RNA extraction and reverse transcription
[0026] Total RNA was extracted from fresh leaves of the wild-type japonica rice variety Nipponbare (a publicly used rice material). The MiniBEST Plant RNA Extraction Kit was used, following the instructions for the TaKaRa PrimeScript TMRT reagent Kit with gDNA Eraser. The obtained RNA samples were first subjected to a genomic DNA removal reaction. The DNA removal reaction solution consisted of: 2.0 μL 5×gDNAEraser Buffer, 1.0 μL gDNAEraser, 1.0 μg RNA, and 6.0 μL RNase-free ddH2O. After mixing, the mixture was incubated in a dry bath at 42°C for 2 min. The digested mixture was then used for reverse transcription. The reaction solution consisted of: 1.0 μL PrimeScript RT EnzymeMix I, 4.0 μL RT Primer Mix, 4.0 μL 5×Prime Script Buffer 2, 1.0 μL RNase-Free ddH2O, and 10.0 μL of the digested mixture. Reverse transcription reaction conditions: 37℃, 15 min; 85℃, 5 sec, 4℃ storage.
[0027] 2. Analysis of the OsRAV9 gene expression pattern induced by rice blast fungus
[0028] To investigate whether the OsRAV9 gene is involved in the disease resistance process of rice, this invention used RT-qPCR to detect the relative expression levels of the OsRAV9 gene transcription at 0, 48, 72, 96, and 144 hours after inoculation with *Bacillus oryzae* in wild-type rice and rice inoculated with *Bacillus oryzae*. The results showed that the OsRAV9 gene was significantly upregulated by *Bacillus oryzae*. Wild-type Nipponbare rice is a conventional japonica rice variety. When the rice reached the 4-leaf stage in a greenhouse, detached leaves were inoculated with *Bacillus oryzae*. The *Bacillus oryzae* strain Guy11 is a conventional *Bacillus oryzae* pathogen. Inoculation with *Bacillus oryzae* was performed using the conventional leaf-cutting method, specifically inoculating the front 5 cm of leaves from rice plants at the four-leaf-one-heart stage. The culture of *Bacillus oryzae* followed published methods. After inoculation, total RNA was extracted from inoculated leaves at different time points and reverse transcribed into cDNA as a template. OsRAV9-specific primers were designed: forward primer qOsRAV9-F (5'CGTCTGTTGTTTCATCTTCGAT 3') and reverse primer qOsRAV9-R (5'CATTTGCAATCTCTGACCTGAC 3'). Rice endogenous actin (gene accession number AK101613) was used as an internal reference gene: Actin-F (forward primer 5'GAGACCTTCAACACCCCTGCTA-3') and reverse primer Actin-R (5'ATCACCAGAGTCCAACACATTACCT3'). A real-time quantitative RT-qPCR kit was used for analysis. The Geeen PCRMaster Mix (proceded according to the kit instructions) was used in a BIO-Rad CFX Connect (manufactured by BIO-Rad) real-time PCR instrument. Results showed that OsRAV9 expression was significantly upregulated in rice blast induction, suggesting that OsRAV9 may be involved in rice's resistance response to rice blast fungus.
[0029] 3. Obtaining the OsRAV9 gene sequence
[0030] The full-length sequence of OsRAV9 was cloned using cDNA from Nipponbare japonica rice as a template, with forward primer OsRAV9-full-F (5'ATGGGGGTGGTCAGCTTCTC 3') and reverse primer OsRAV9-full-R (5'TAGGTGCCCTGCTGTTATAG 3'). PCR reaction conditions: 94℃ pre-denaturation for 3 min; 30 cycles of 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 1 min followed by 330 sec; extension at 72℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector, positive clones were screened and sequenced, and positive strains were stored at -80℃. The open reading frame (ORF) of the desired OsRAV9 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The 574 amino acids corresponding to the open reading frame (ORF) of the OsRAV9 gene were determined using BlastX (http: / / www.ncbi.nlm.nih.gov), and the protein sequence encoded by the OsRAV9 gene was inferred as shown in the sequence listing SEQ ID NO: 2.
[0031] Example 2: OsRAV9 overexpression and CRISPR / Cas9 gene knockout vector construction
[0032] 1. Construction of overexpression vectors
[0033] To verify the gene function of OsRAV9, the applicant constructed an overexpression vector to transform Nipponbare embryogenic callus. Using the plasmid of the OsRAV9 positive clone obtained in Example 1 as a template, overexpression primers were designed, with homologous recombination adapter bases added to both ends of the primers. These primers were named the forward primer OsRAV9-OE-F (5'GAACGATAGCCGGTACCATGGGGGTGGTCAGCTT') and the reverse primer OsRAV9-OE-R (5'CTTTGTAATCGGATCCCTATAACAGCAGGGCACC 3'), respectively, and PCR amplification was performed. The obtained PCR products were subjected to agarose gel electrophoresis and purified, then stored at -20℃ for later use. The pU1301-3*Flag strain was activated in liquid LB medium (with 50 mg / L kanamycin added), and the plasmid was extracted. The plasmid was then double-digested with KpnI and BamHI, and the digested products were purified and stored at -20℃ for later use. The OsRAV9 target fragment, recovered from the above enzyme digestion, was infused with the linearized vector pU1301-3*Flag using a homologous recombinase to obtain the recombinant vector (pU1301-OsRAV9-3*Flag). The specific reaction system was as follows: 1.0 μL of double-digested linearized pU1301-3*Flag vector, 1.0 μL of 5×CEⅡBuffer, 0.5 μL of Exnase II homologous recombinase, 0.8 μL of PCR-purified and recovered OsRAV9 with the vector adapter, and the volume was brought to 5.0 μL with sterile ddH2O. After incubation at 37℃ for 0.5 h, heat shock transformation was performed on Escherichia coli strain DH5α. The specific transformation procedure is as follows: Thaw *E. coli* DH5α competent cells stored at -80℃ on ice. Add 50 μL of competent cells to 5 μL of the ligation reaction mixture, mix gently, and place on ice for 15-30 min. After the ice bath, incubate at 42℃ for 90 sec, then immediately place on ice for 3 min. Add 400 μL of LB liquid medium and incubate at 37℃, 200 rpm for 45 min to recover the cells. After recovery, centrifuge at 5000 rpm for 2 min, discard 300 μL of supernatant, and resuspend the cells in the remaining supernatant. Spread the bacterial suspension evenly on LB solid medium (with 50 mg / L kanamycin added) and incubate inverted at 37℃ overnight. Pick single clones, select 2-3 positive clones for sequencing, and preserve the strain without any mutations and the corresponding plasmid, naming it recombinant plasmid pU1301-OsRAV9-3*Flag.The correctly sequenced recombinant plasmid pU1301-OsRAV9-3*Flag was transformed into competent Agrobacterium tumefaciens EHA105 cells using a freeze-thaw method. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added). The culture was shaken at 28°C for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.
[0034] 2. Construction of CRISPR / Cas9 gene knockout vector
[0035] Utilizing the CRISPR-P 2.0 developed by the State Key Laboratory of Genetic Improvement for Major Crops in Central China (Central China Agricultural University) CRISPR- Pv2.0 (hzau.edu.cn) Design of OsRAV9 guide RNA (gRNA). Based on the OsRAV9 DNA sequence and gene structure, two gRNAs were designed (i.e., gRNA1: 5'GCAGTCGTCGCGGTACAAGG 3'; gRNA2: 5'CGCGGCCACCAACTTCCCCG 3'). Adapter primers RAV9-gRNA1-U3F (5'GCAGTCGTCGCGGTACAAGGgttttagagctagaaata 3'), RAV9-gRNA1-U3R (5'CCTTGTACCGCGACGACTGCtgcaccagccgggaat 3'), and RAV9-gRNA2-U3F (5'...
[0036] CGCGGCCACCAACTTCCCCGgttttagagctagaaata 3'),RAV9-gRNA2-U3R(5'
[0037] CGGGGAAGTTGGTGGCCGCGtgcaccagccgggaat 3'), and the adapter primers S5AD5-F (5'CAGATGATCCGTGGCAACAAAG3') and S5AD5-R (5'TTTCTAGCTCTAAAACAAAA 3') required for gRNA to be ligated into the expression vector pRGEB32; L5AD5-F (5'CAGATGATCCGTGGCAACAAAGCACCAGTGGTCTAG3') and L5AD5-R (5'
[0038] TTTCTAGCTCTAAAACAAAAAAAAAAGCACCGACTCG3'). Using pGTR plasmid as a template, PCR amplification was performed using three primer pairs: L5AD5-F / RAV9-gRNA1-U3R, RAV9-gRNA1-U3F / RAV9-gRNA2-U3R, and RAV9-gRNA2-U3F / L5AD5-R. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 30 sec, 26 cycles; 72℃ extension for 7 min. The three obtained RCR products were diluted 20-50 times and mixed in equal volumes. 1 μL of the above mixture was used as a template for amplification using primer pair S5AD5-F / S5AD5-R. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 45 sec, 26 cycles; 72℃ extension for 7 min. The obtained product (i.e., a DNA fragment containing two gRNAs in tandem) was purified and its concentration was determined. The CRISPR / Cas9 expression vector pRGEB32 was digested with BsaI, and the digestion product was purified and recovered to obtain a linearized pRGEB32 vector. The purified PCR product was ligated into the linearized pRGEB32 vector using infusion recombination. Specific reaction conditions: 100 ng PCR product, 50-80 ng linearized pRGEB32 vector, 1 μL infusion enzyme (Takara), 1 μL 10× infusion buffer, ddH2O added to 10 μL, reacted at 50℃ for 30 min. The above reaction product was heat-shocked and transformed into *E. coli* DH5α. Single clones were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmid was transformed into *Agrobacterium tumefaciens* EHA105 competent cells. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium, and in this example, 30 mg / L rifampicin and 50 mg / L kanamycin were added), and cultured at 28°C with shaking for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.
[0039] Example 3: Genetic transformation of rice
[0040] 1. Callus Induction: Prepare sterile callus induction medium in advance. Pour 40-50 mL of induction medium into a 100 mL Erlenmeyer flask. Remove the husks from rice seeds (Nipponbare variety, same as above). Perform aseptic operations in a laminar flow hood, first soaking the seeds in 75% ethanol solution for 1 min, then soaking them in 0.1% HgCl2 solution for 15-20 min, and finally washing them 5-10 times with sterile water. Inoculate 8-12 seeds into each flask and incubate in the dark at 28℃ for 40-50 days to induce callus formation.
[0041] 2. Subculture: Prepare the subculture medium 2-3 days in advance, using the callus induction medium formula. Sterilize the medium using standard methods to ensure it is dry (medium with excessive moisture is detrimental to callus growth). Select pale yellow, granular, dry, and highly viable callus tissue from the induced callus and transfer it to the subculture medium. Incubate in the dark at 28°C for 20 days.
[0042] 3. Pre-culture: Dispense sterile pre-culture medium into 500mL Erlenmeyer flasks in advance. Before the experiment, add 300μL of 100Mm acetylsyl syringone and 5mL of 40% glucose to every 250mL of medium, mix well, and fill 8-10 plates of medium into each flask. From the subcultured callus, pick out pale yellow, granular, dry, and viable callus tissue and transfer it into the culture plates of pre-culture medium. Inoculate about 60-80 pieces of callus tissue the size of mung beans into each plate. If the callus tissue is too large, it can be crushed with sterile forceps. Incubate in the dark at 8℃ for 3 days.
[0043] 4. Infection and Co-culture: Two days before the experiment, Agrobacterium strains containing the target gene (OsRAV9) were streaked onto Petri dishes containing antibiotics (30 mg / L rifampin and 50 mg / L kanamycin) to activate the bacteria. Prepare suspension medium (100 mL / strain), co-culture medium (250 mL / strain), large Petri dishes, small Petri dishes (lined with absorbent paper and filter paper, sterilized and dried before use), and several 250 mL sterile Erlenmeyer flasks. The streaked Agrobacterium was scraped into 1 / 2 N6 suspension medium (N6 medium is a commonly used plant tissue culture medium, with 100 μL AS + 2 mL 50% glucose added), and incubated at 28℃ and 200 rpm for 30 min. Simultaneously, the pre-cultured callus was collected into 250 mL sterile Erlenmeyer flasks while shaking the bacteria. The Agrobacterium culture was poured into the callus and soaked for 30 min. Discard the bacterial suspension. First, invert the Erlenmeyer flask containing the callus tissue onto a sterile dish to absorb the bacterial suspension. Then, spread the callus tissue onto filter paper in a sterile dish, cover it with another sheet of filter paper, and gently press the callus tissue with sterile forceps to absorb the surface bacterial suspension. Allow it to air dry for 3-4 hours. Use a sterile spoon to evenly spread the fully dried callus tissue onto the co-culture medium (it's best not to move it after spreading to reduce contact between the medium and the callus surface and prevent excessive growth of Agrobacterium). Incubate in the dark at 19°C for 3 days.
[0044] 5. Washing and Screening (S1 medium): Prepare sterile water, large and small dishes (containing absorbent paper and filter paper), several 250mL Erlenmeyer flasks, and screening medium. Transfer the co-cultured callus to a washing cup, pour in sterile distilled water until the callus is completely submerged, cover and shake for 20-30 seconds, then discard the sterile distilled water. Repeat this process 2-3 times. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, let stand for 5 minutes, then discard the sterile distilled water. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, then let stand for 10 minutes. Finally, discard the sterile distilled water, add sterile distilled water containing 500mg / L carbenicillin, and shake at 200rpm for 30 minutes. Discard the distilled water and allow the callus to air dry. Transfer the treated callus to screening medium and incubate in the dark at 28℃ for 20 days.
[0045] 6. Screening (referred to as culture medium S2): Prepare screening culture medium S2. Add 300 μL carbenicillin, 250 μL hygromycin, and 5 mL 50% glucose to each 250 mL culture medium. After pouring, open the lid on a clean bench and blow with sterile air for 1.5-2 hours. The surface of the screening medium should not be too wet, otherwise it will not be conducive to the inhibition of Agrobacterium and the growth of resistant callus during screening. Select dry callus that is not contaminated with Agrobacterium from S1 culture medium and place it on S2 culture medium (inoculate 25 to 30 callus tissues per plate). Incubate in the dark at 28°C for 20 days.
[0046] 7. Callus differentiation: Prepare the differentiation medium 3-4 days in advance. Select small pieces of pale yellow, dense, and dry resistant callus tissue, inoculate them into the differentiation medium, and culture them at 28℃ under light (light intensity 3000 Lux) for 40 days. Seedlings will differentiate in the later stage of culture.
[0047] 8. Rooting: Prepare the rooting medium 2-3 days in advance. Prepare 4-5 sterile empty dishes; remove the differentiated seedlings from the differentiation medium, taking only one seedling from each callus, trimming excessively long leaves and roots with scissors, and inoculate them into rooting tubes, with 1-2 seedlings in each tube; culture in a light culture room (light intensity 3000 Lux) for 15-20 days, and after the roots have grown sufficiently, harden off the seedlings for 4-7 days, and then transplant them to the greenhouse.
[0048] The specific culture medium formulation and preparation method for rice genetic transformation involved in the embodiments of the present invention are as follows:
[0049] Mother liquor formula:
[0050] 1. MSmax stock solution (10X)
[0051]
[0052] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.
[0053] 2. MSmin stock solution (100X)
[0054]
[0055] Note: Na2MoO4 must be dissolved separately before mixing with other components, and then diluted with distilled water to a final volume of 1000 mL. Store at room temperature.
[0056] 3. N6max stock solution (10X)
[0057]
[0058] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.
[0059] 4. N6min stock solution (100X)
[0060]
[0061] Dilute to 1000 mL with distilled water and store at room temperature.
[0062] 5. Fe2+-EDTA stock solution (100X)
[0063] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;
[0064] Add 300 mL of distilled water to another reagent bottle and heat to 70 °C. Then add 3.73 g of Na2EDTA·2H2O and dissolve it. Mix the solutions from the two reagent bottles and keep them at 70 °C for 2 hours. Then add distilled water to make up to 1000 mL and store at 4 °C protected from light.
[0065] 6. Vitamin stock solution (100X)
[0066]
[0067]
[0068] Add distilled water to a final volume of 1000 mL and store at 4°C.
[0069] 7. AAmax stock solution (10X)
[0070]
[0071] Add distilled water to a final volume of 1000 mL and store at room temperature away from light.
[0072] 8. AAmin stock solution (100X)
[0073]
[0074] Dissolve Na2MoO4 separately, then mix it with other components and add distilled water to bring the volume to 1000 mL. Store at room temperature away from light.
[0075] 9.6-BA stock solution (1 mg / mL)
[0076] Add 100 mg of 6-BA to 1.0 mL of 1 M KOH and shake until 6-BA dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.
[0077] 10. KT stock solution (1 mg / mL)
[0078] Add 100 mg of KT to 1.0 ml of 1 M KOH and shake until KT dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.
[0079] 11.2,4-D stock solution (1 mg / mL)
[0080] Add 100 mg of 2,4-D to 1.0 mL of 1 M KOH and shake for 5 min. Then add 10 mL of distilled water and shake until the 2,4-D dissolves. Make up to 100 mL with distilled water and store at room temperature.
[0081] 12.100μM AS stock solution
[0082] AS 0.196g;
[0083] 10 mL of DMSO;
[0084] Aliquot into 1.5mL centrifuge tubes and store at 4°C.
[0085] 13. IAA stock solution (1 mg / mL)
[0086] Add 100mg of IAA to 1.0ml of 1N KOH and shake until the IAA dissolves. Then, bring the volume to 100ml with dH2O and store at room temperature away from light.
[0087] 14. NAA stock solution (1 mg / mL)
[0088] Add 100 mg of NAA to 1.0 mL of 1 M KOH and shake until the NAA dissolves. Then, bring the volume to 100 mL with distilled water and store at room temperature away from light.
[0089] Culture medium formulation:
[0090] 1. Induction medium
[0091]
[0092] pH value: 5.9
[0093] Add distilled water to a final volume of 1000 mL.
[0094] 2. Subculture medium
[0095]
[0096] pH value: 5.9
[0097] Add distilled water to a final volume of 1000 mL.
[0098] 3. Pre-culture medium
[0099]
[0100]
[0101] pH value: 5.6. Add distilled water to a final volume of 250 mL.
[0102] 4. Co-culture medium
[0103] pH value: 5.6. Add distilled water to a final volume of 250 mL.
[0104] 5. Suspension culture medium
[0105] pH value: 5.4. Add distilled water to a final volume of 100 mL.
[0106] 6. Screening culture medium
[0107]
[0108] pH value: 6.0. Add distilled water to a final volume of 250 ml.
[0109] 7. Differentiation medium
[0110] pH value: 6.0. Add distilled water to a final volume of 1000 mL.
[0111] 8. Rooting medium
[0112] pH: 5.8. Add distilled water to a final volume of 1000 mL. Example 4: Identification of inoculation with transgenic rice blast fungus.
[0113] 1. Preparation of Tomato-Oat Medium (OM): Boil water until boiling, weigh 40g of rolled oats, add to the boiling water and cook for 30 minutes, then filter to obtain the juice; add 150mL of freshly squeezed tomato juice to the oat juice, add water to make up to 1L, and add 1.6% agar; sterilize by conventional high temperature and autoclaving. For the medium used for sporulation of rice blast fungus, add 0.6g of CaCO3 to 1L of medium.
[0114] 2. Purification and preservation of *Blastoma oryzae* strains: In a clean bench, the conidial solution of *Blastoma oryzae* was pipetted onto a 1.6% water agar plate and incubated at 28°C for 12 hours. Under a dissecting microscope, single germinating conidia were picked up with a needle and aliquoted onto OM plates, which were then incubated at 28°C. After incubation for 2-3 days, the mycelia formed from the single conidia were transferred to new OM plates. These purified single-spore strains could be used for subsequent experiments. Mycelial blocks of the strain to be preserved were aliquoted onto OM plates lined with sterile filter paper and incubated at 28°C. After the colonies had fully colonized the petri dishes, the filter paper was removed and placed into a sterile sulfuric acid paper bag. The sulfuric acid paper bag was placed in a desiccator for one week, then transferred to a sealed container and stored at -20°C.
[0115] 3. Sporulation: Wild-type strain Guy11 was inoculated onto OM plates and incubated upside down in a 28°C light incubator. After 5 days of growth, the mycelium was broken up completely with a smear loop and evenly spread onto a new OM plate, which was then incubated upside down in a 28°C light incubator. After 36 hours, the newly visible aerial mycelium was gently washed off with a cotton swab, covered with double layers of gauze, and incubated at 28°C light. After 48 hours, the conidia on the OTA plates were thoroughly washed with 30 mL of distilled water into 50 mL centrifuge tubes.
[0116] 4. Spore inoculation: Wash conidia from the OM plate cultured for 5 days with 30 mL of 0.025% Tween solution, then filter through a funnel made of three layers of lens paper into 50 mL centrifuge tubes, adjusting the conidia concentration to 2 × 10⁻⁶. 5 Species / mL. Take 5-10 μL of the prepared spore suspension and inoculate it onto the surface of rice leaves. Seal the inoculation box with sealing film to maintain warmth and humidity, and incubate under darkness with a black cloth. After 36 hours, remove the black cloth and expose to light (light intensity), continue incubation under humidity for another 48 hours, then remove the sealing film. Disease typically begins 5 days after inoculation.
[0117] 5. Identification of rice blast resistance in transgenic seedlings: Thirty leaves each from transgenic rice and control plants after disease infection were selected, and images of fungal patches were taken. The area of the fungal patches was statistically analyzed using ImageJ software. Five days after inoculation, 0.1 g each of transgenic rice and control leaves were weighed, and the proline content was determined according to the instructions accompanying the hydrogen peroxide (H2O2) content detection kit. Three to five replicates were taken for each measurement line, and the average value was calculated.
Claims
1. The application of overexpression of the transcription factor OsRAV9 gene in improving rice blast resistance, characterized by: The nucleotide sequence of the rice OsRAV9 gene is shown in SEQ ID NO:1.
Citation Information
Patent Citations
Plants with increased seed size
CN108012523A