Application of retin-1 or substance for synthesizing retin-1 in preparation of preparation for preventing and treating asthma

Abstract

The invention belongs to the technical field of biological medicine, and discloses application of retin-1 or a substance for synthesizing the retin-1 in preparation of a medicine for preventing and treating asthma. According to the application disclosed by the invention, an asthma mouse model induced by dermatophagoides pteronyssin-1 is constructed, an adenovirus overexpressed by the omentin-1 gene is used for intervention, and related physiological characteristics of a mouse subjected to intervention treatment are detected, so that the overexpression of the omentin-1 gene is proved to be capable of remarkably relieving allergic asthma lung inflammation; the application and industrialization prospects in the field of preventing and treating asthma diseases are considerable.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to the application of omentin-1 or a substance synthesizing omentin-1 in the preparation of a preparation for preventing and treating asthma. Background Art

[0002] Asthma is a chronic inflammation of the airways characterized by airway hyperresponsiveness and reversible airflow limitation. It is mainly characterized by cough, wheezing, chest tightness, and dyspnea. Currently, inhaled glucocorticoids and long-acting β-receptor agonists are the first-line drugs for the treatment of asthma, but the treatment effect is not good for some asthma patients. It is necessary to further explore more beneficial and efficient prevention and treatment preparations.

[0003] Omentin-1 ( omentin-1 ), also known as intelectin-1 (ITLN-1), is a new type of adipokine that is specifically and highly expressed in human visceral adipose tissue and mouse intestines, and is also expressed in lung bronchial epithelial cells. Previous studies have shown that supplementation of omentin-1 has been shown to have a preventive effect in metabolic-related diseases such as osteoporosis, atherosclerosis, and diabetes. In addition, overexpression of omentin-1 can significantly prevent and treat pulmonary fibrosis.

[0004] US Patent Document US20100021899A1 discloses a method for preventing a disease or predicting an increased risk of a disease, such as obesity, obesity-dependent subacute inflammation, atherosclerosis, cardiovascular disease, and metabolic disease, by measuring the level of omentin-1 in a subject.

[0005] Japanese patent document JP2015151386A discloses a partial peptide of human omentin-1 with physiological activity and a drug containing the modified peptide as an active ingredient, and provides its use as a drug for treating heart disease. The therapeutic principle disclosed is that omentin-1 inhibits myocardial cell apoptosis.

[0006] Chinese patent document CN114432431A discloses that omentin-1 has the function of inhibiting bone morphogenetic protein. Its therapeutic principle is to inhibit the binding of bone morphogenetic protein to its receptor, weaken the activation effect on downstream signaling pathways, and solve the uncertainty and risks brought about by the changes in the expression levels of existing drugs.

[0007] However, there are no reports on the preventive and therapeutic effects of omentin-1 gene overexpression on asthma. Summary of the invention

[0008] In order to solve the above technical problems and achieve the above objectives, the present invention provides the use of omentin-1 or a substance synthesized from omentin-1 in the preparation of a preparation for preventing and treating asthma.

[0009] The invention discloses an application of omentin-1 or a substance synthesizing omentin-1 in preparing a preparation for preventing and treating asthma.

[0010] In the above application, preferably, the substance for synthesizing omentin-1 comprises any one or more combinations of engineered nucleic acids, small molecules, antibodies, polypeptides and protein products.

[0011] Preferably, the engineered nucleic acid is plasmid DNA or mRNA, and the engineered nucleic acid is present on the same expression vector.

[0012] Preferably, the expression vector contains the following nucleic acid elements in order: a .CMV promoter nucleotide sequence; b. Omentin-1 encoding gene sequence; c. EGFP nucleotide sequence.

[0013] Preferably, the omentin-1 encoding gene sequence is shown as SEQ ID No.1 or SEQ ID No.2; the CMV promoter nucleotide sequence is shown as SEQ ID No.3; and the EGFP nucleotide sequence is shown as SEQ ID No.4.

[0014] Preferably, the expression vector is a viral vector.

[0015] More preferably, the viral vector comprises any one or more combinations of lentivirus, retrovirus, adenovirus, alphavirus, vaccinia virus and adeno-associated virus vectors.

[0016] Preferably, the asthma includes any one or more of allergic asthma, non-allergic asthma, exercise-induced asthma, late-onset asthma, asthma with fixed airflow limitation and obesity-induced asthma.

[0017] More preferably, the asthma simulation model used is an allergic asthma mouse model induced by house dust mite extract. Preferably, the dosage form of the drug is any one of injection, oral solution, capsule, tablet, spray or ointment.

[0018] Compared with the prior art, the present invention has the following beneficial effects: The present invention proposes for the first time to apply the overexpression of omentin-1 gene to the preparation for preventing and treating asthma. Through the construction of relevant mouse models, intervention treatment and result detection, it is proved that omentin-1 has the following effects on asthma: reducing the infiltration of airway inflammatory cells and lung tissue inflammatory cells, and improving the destruction of lung tissue. It shows that omentin-1 or substances synthesized from omentin-1 have significant effects in the preparation of drugs for treating and preventing allergic asthma, and its application and industrialization prospects are considerable. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 This is a comparison chart of the results of H&E staining of airway tissues of HDM mice injected with adenovirus overexpressing the omentin-1 gene through the tail vein in Example 1 of the present invention; Figure 2 This is a comparison chart of the H&E staining results of lung tissue of HDM mice injected with adenovirus overexpressing the omentin-1 gene through the tail vein in Example 1 of the present invention; Figure 3 The total number of cells and the number of various related cells contained in the bronchoalveolar lavage fluid of the lung tissue of the HDM mice injected with adenovirus overexpressing the omentin-1 gene through the tail vein in Example 1 of the present invention; DETAILED DESCRIPTION In order to more clearly explain the technical content of the present invention, it is described in detail in conjunction with specific embodiments and drawings. Obviously, the enumerated embodiments are only preferred implementation schemes of the present technical solution, and other technical solutions that can be obviously derived by technicians in this field based on the disclosed technical content still belong to the protection scope of the present invention.

[0021] Definitions of specific terms are described in more detail below.This disclosure is not intended to be limited in any way by the exemplary list of substitutes described herein.

[0022] The terms "omentin-1 and omentin-1". In this patent, omentin-1 is equivalent to omentin-1, and the two have the same meaning. In some documents, substances with the same meaning are also called lectin-1 or intlectin-1 or equivalent expressions, which should be within the scope of protection of this application.

[0023] The term "asthma" refers to a heterogeneous group of diseases characterized by chronic airway inflammation; it includes respiratory symptoms such as wheezing, shortness of breath, chest tightness, and cough that vary and worsen over time, with variable expiratory airflow limitation.

[0024] The term "allergic asthma" refers to a type of asthma that usually begins in childhood and is associated with a past and / or family history of allergic diseases such as eczema, allergic rhinitis, or food or drug exposure. Examination of induced sputum in these patients before treatment often reveals eosinophilic airway inflammation.

[0025] The term "non-allergic asthma" refers to a type of asthma that is not related to allergies and in which the cell profile of the patient's sputum may be neutrophils, eosinophils, or contain only a few inflammatory cells.

[0026] The term "exercise-induced asthma" refers to the narrowing or compression of the airways during intense physical activity.

[0027] The term "late-onset asthma" refers to a type of asthma that occurs for the first time in adulthood.

[0028] The term "occupational asthma" refers to the type of asthma caused by work exposure in adults with asthma.

[0029] The term "asthma with mixed airflow limitation" refers to the persistent or incompletely reversible airflow limitation that develops in some patients with long-term asthma, as well as expressions with equivalent meanings in certain literature, which should be within the scope of protection of the application.

[0030] The term "obesity asthma" refers to the fact that some obese asthmatics have prominent respiratory symptoms and minimal eosinophilic airway inflammation.

[0031] It should be understood that, based on the content disclosed in the present invention, those skilled in the art can use other well-known techniques in the art to synthesize nucleic acids, small molecules, antibodies, polypeptides or proteins that can overexpress omentin-1, which is easy to achieve for those skilled in the art. No matter what method is used to obtain nucleic acids, small molecules, antibodies, polypeptides or proteins that overexpress omentin-1 and use them for the prevention and treatment of asthma, they all belong to the protective scope of the present invention. Asthma can also be allergic asthma, non-allergic asthma, exercise-induced asthma, delayed asthma, occupational asthma, asthma combined with mixed airflow limitation, obesity-induced asthma, etc. mentioned in the above terms.

[0032] The preparation includes any one or a combination of nucleic acid, small molecule, antibody, polypeptide and protein. The preparation also includes at least one pharmaceutically, food science or health care product acceptable carrier. The dosage form of the preparation is any one of injection, oral solution, capsule, tablet, spray or ointment.

[0033] Nucleic acid expression vectors include: lentiviral vectors; retroviral vectors; adeno-associated virus (AAV) vectors; biosynthetic mRNA vectors, etc.

[0034] The present invention constructs an allergic asthma model and uses an adenovirus that overexpresses omentin-1 for intervention. By detecting relevant physiological characteristics of mice after intervention, such as changes in lung tissue damage, changes in airway structural cells, and changes in airway mucus and inflammatory factor secretion, the protective effect of overexpressing omentin-1 on the lungs is clarified.

[0035] Embodiment 1: A kind of omentin-1 ( omentin-1 ) or the use of substances that synthesize omentin-1 in the preparation of preparations for the prevention and treatment of asthma. Any substance that overexpresses synthetic omentin-1 can achieve significant effects in the preparation of drugs for the treatment and prevention of allergic asthma.

[0036] For example, the substance for synthesizing omentin-1 can be a nucleic acid expression vector, which contains nucleic acid elements in the following order: a .CMV promoter nucleotide sequence; b. Omentin-1 encoding gene sequence; c. EGFP nucleotide sequence; Wherein the omentin-1 encoding gene sequence is hITLN1[NM_017625.3] or mItln1[NM_010584.3]. Non-limiting examples of implementation: The nucleotide sequence encoding human hITLN1 is shown in SEQ ID No. 1: ATGAACCAACTCAGCTTCCTGCTGTTTCTCATAGCGACCACCAGAGGATGGAGTACAGATGAGGCTAATACTTACTTCAAGGAATGGACCTGTTCTTCGTCTCCATCTCTGCCCAGAAGCTGCAAGGAAATCAAAGACGAATGTCCTAGTGCATTTGATGGCCTGTATTTTCTCCGCACTGAGAATGGTGTTATCTACCAGACCTTCTGTGACATGACCTCTGGGGGTGGCGGCTGGACCCTGGTGGCCAGCGTGCACGAGAATGACATGCGTGGGAAGTGCACGGTGGGCGATCGCTGGTCCAGTCAGCAGGGCAGCAAAGCAGTCTACCCAGAGGGGGACGGCAACTGGGCCAACTACAACACCTTTGGATCTGCAGAGGCGGCCACGAGCGATGACTACAAGAACCCTGGCTACTACGACATCCAGGCCAAGGACCTGGGCATCTGGCACGTGCCCAATAAGTCCCCCATGCAGCACTGGAGAAACAGCTCCCTGCTGAGGTACCGCACGGACACTGGCTTCCTCCAGACACTGGGACATAATCTGTTTGGCATCTACCAGAAATATCCAGTGAAATATGGAGAAGGAAAGTGTTGGACTGACAACGGCCCGGTGATCCCTGTGGTCTATGATTTTGGCGACGCCCAGAAAACAGCATCTTATTACTCACCCTATGGCCAGCGGGAATTCACTGCGGGATTTGTTCAGTTCAGGGTATTTAATAACGAGAGAGCAGCCAACGCCTTGTGTGCTGGAATGAGGGTCACCGGATGTAACACTGAGCACCACTGCATTGGTGGAGGAGGATACTTTCCAGAGGCCAGTCCCCAGCAGTGTGGAGATTTTTCTGGTTTTGATTGGAGTGGATATGGAACTCATGTTGGTTACAGCAGCAGCCGTGAGATAACTGAGGCAGCTGTGCTTCTATTCTATCGTTGA。

[0037] The nucleotide sequence encoding mouse Itln1 is shown in SEQ ID No.2: ATGACCCAACTGGGATTCCTGCTGTTTATCATGGTTGCTACCAGAGGTTGCAGTGCAGCTGAAGAGAACCTGGACACCAACAGGTGGGGCAATTCTTTCTTTTCCTCTCTGCCCAGAAGCTGCAAGGAAATCAAGCAGGAGCACACAAAGGCACAAGATGGTCTCTATTTCCTGCGCACGAAGAATGGTGTCATCTACCAGACCTTCTGTGACATGACCACTGCAGGTGGTGGCTGGACCCTGGTGGCTAGTGTGCATGAGAACAACATGCGTGGGAAGTGCACTGTGGGTGATCGCTGGTCCAGTCAGCAAGGCAACAGAGCTGACTACCCAGAGGGGGATGGCAACTGGGCCAACTACAACACCTTTGGGTCTGCAGAGGCTGCCACAAGTGATGACTACAAGAACCCTGGCTACTTTGACATCCAGGCTGAGAACCTGGGCATCTGGCACGTGCCCAACAAAAGCCCCCTGCACAACTGGAGGAAGAGCTCCCTGCTGAGGTACCGCACCTTCACTGGCTTCCTGCAGCACTTGGGACATAATCTGTTTGGCCTCTACAAGAAGTACCCAGTGAAATACGGAGAAGGAAAGTGTTGGACTGACAATGGCCCAGCATTACCTGTGGTCTATGACTTTGGTGATGCTCGGAAGACAGCCTCTTATTACTCCCCCTCTGGCCAGAGGGAATTTACTGCAGGATATGTTCAGTTCAGAGTGTTTAATAATGAGAGAGCGGCCAGTGCCTTGTGTGCTGGCGTGAGGGTCACTGGATGTAATACTGAACATCACTGCATCGGTGGAGGAGGATTCTTCCCAGAAGGTAACCCCGTGCAGTGTGGAGACTTTGCGTCATTTGATTGGGATGGATATGGAACTCACAATGGGTACAGCAGTAGCCGGAAGATAACTGAAGCAGCTGTGCTTCTGTTTTATCGCTGA。

[0038] CMV promoter nucleotide sequence, as shown in SEQ ID No.3: TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATC。

[0039] EGFP nucleotide sequence, as shown in SEQ ID No.4: .

[0040] More specifically, the substance for synthesizing omentin-1 can also be a viral expression product obtained by overexpressing the omentin-1 encoding gene in a viral vector. The efficacy of adenovirus overexpressing omentin-1 in preventing and treating allergic asthma model mice was evaluated below.

[0041] 1. The steps for preparing adenovirus overexpressing Omentin-1 are as follows: (1) Gene cloning: Obtain the gene sequence encoding Omentin-1 (for example, the following experiment uses the nucleotide sequence encoding mouse Itln1, as shown in SEQ ID No. 2), and then insert the gene into the pAdTrack vector (which can also be replaced by an adenovirus shuttle vector such as pAdEasy); (2) Construction of recombinant adenovirus: The shuttle vector containing the Omentin-1 gene and the adenovirus backbone plasmid are co-transfected into the HEK293 cell line for homologous recombination. In the cell, the shuttle vector and the backbone plasmid will recombine through the homologous arms to form a complete adenovirus genome. (3) Adenovirus packaging: The recombinant adenovirus genome will be replicated and packaged into mature virus particles in HEK293 cells, and then collected and purified to obtain assembled adenovirus; (4) Virus titer determination: The virus titer was determined by infecting HEK293 cells and counting the number of plaques formed; (5) Virus amplification: If necessary, the virus can be further amplified to increase the yield; (6) Virus storage: Finally, the prepared adenovirus is stored in a -80°C refrigerator to maintain its activity.

[0042] 2. The experimental process is as follows: (1) Construction of allergic asthma model mice and drug administration design After passing the quarantine, C57BL / 6J mice were randomly divided into a normal control mouse group (Sham), an asthmatic mouse group (HDM), and an asthmatic mouse group with adenovirus overexpressing omentin-1 (HDM+ Ad- omentin-1 ). The allergic asthma mouse model was established using house dust mite extract. Specifically: Sham group: 6-8 week-old mice were acclimated for one week and then injected with 50 μl PBS on day 0, day 2, day 4, day 10, day 11, day 12, and day 13.

[0043] HDM group: 20 μg of HDM was coughed on day 0, day 2, day 4, day 10, day 11, day 12, and day 13, and the corresponding HDM concentration was diluted to 50 μl with PBS. HDM+ Ad- omentin-1 Group: 100 μl of 1×10^9 PFU / ml adenovirus overexpressing omentin-1 gene was injected into the tail vein on day -7 and day 0, respectively, and then 20 μg of HDM was choked on days 1, 2, 4, 10, 11, 12, and 13.

[0044] After 2 weeks of the above intervention, the mice were anesthetized and killed, and lung tissue, bronchoalveolar lavage fluid and other specimens were collected for H&E, PAS staining, ELISA and other tests.

[0045] (2) Evaluation of the efficacy of adenovirus overexpressing the omentin-1 gene in preventing and treating asthma: The airway mucosal epithelial structure of mice in the blank control group was intact, the cilia were neatly arranged, the alveolar structure was clear, and the alveoli were of uniform size; the asthma group of mice induced by HDM had aggregation of inflammatory cells around the airways, goblet cell metaplasia, increased mucus secretion, shedding of the bronchial mucosal epithelium, increased mucosal folds that protruded into the lumen, cilia shrinkage, narrowing of the lumen, and varying degrees of inflammatory cell infiltration in the pulmonary interstitium, which were consistent with the pathological changes of allergic asthma.

[0046] like Figure 1 As shown in the figure, H&E staining showed that in asthmatic mice treated with adenovirus overexpressing omentin-1, the accumulation of inflammatory cells around the airways of the mice was reduced, the airway structure was relatively intact, and the morphology was relatively normal. Figure 2 As shown in the figure, the alveolar structure of the blank control mice (Sham group) was clear and complete, and the alveolar size was uniform; the inflammatory infiltration in the alveolar area of ​​the model group (HDM group) was obvious. omentin-1 Gene overexpression adenovirus (HDM+Ad- omentin-1 The above changes were alleviated in HDM mice (group) intervention. The results suggest that overexpression of omentin-1 can improve allergic airway inflammation and eliminate lung tissue.

[0047] In airway inflammation, such as Figure 3 As shown in the figure, flow cytometry was used to detect the total number of inflammatory cells and the expression levels of various types of cells in the bronchoalveolar lavage fluid, and enzyme-linked immunosorbent assay was used to detect the expression level of HDM-specific antibodies in serum. It was found that HDM could induce a significant increase in the number of inflammatory cells in the bronchoalveolar lavage fluid, as well as a significant increase in the number of eosinophils (Eos), lymphocytes (Lym), and neutrophils (Neu) ( Figure 3 AE), the expression level of HDM-specific IgG1 in serum was significantly increased ( Figure 3 FG), but overexpression of omentin-1 gene could reverse the above changes.

[0048] The embodiments described above are only preferred specific implementation modes of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and concepts of the present invention within the technical scope of the present invention, which should be covered by the protection scope of the present invention.

Claims

1. Use of omentin-1 or a substance synthesized from omentin-1 in the preparation of drugs for preventing and treating asthma.

2. The use of omentin-1 according to claim 1 in the preparation of a preparation for preventing and treating asthma, characterized in that: The substance for synthesizing omentin-1 includes any one or more combinations of engineered nucleic acids, small molecules, antibodies, polypeptides and protein products.

3. The use according to claim 2, characterized in that: The engineered nucleic acid is plasmid DNA or mRNA, and the engineered nucleic acid is present on the same expression vector.

4. The use according to claim 3, characterized in that: The expression vector contains the following nucleic acid elements in order: a .CMV promoter nucleotide sequence; b. Omentin-1 encoding gene sequence; c. EGFP nucleotide sequence.

5. The use according to claim 4, characterized in that The omentin-1 encoding gene sequence is shown as SEQ ID No.1 or SEQ ID No.2; the CMV promoter nucleotide sequence is shown as SEQ ID No.3; and the EGFP nucleotide sequence is shown as SEQ ID No.

4.

6. The use according to claim 3, characterized in that: The expression vector is a viral vector.

7. The use according to claim 6, characterized in that: The viral vector includes any one or more combinations of lentivirus, retrovirus, adenovirus, alphavirus, vaccinia virus and adeno-associated virus vectors.

8. The use according to any one of claims 1 to 7, characterized in that: The asthma includes any one or more of allergic asthma, non-allergic asthma, exercise-induced asthma, late-onset asthma, asthma with fixed airflow limitation and obesity-induced asthma.

9. The use according to claim 8, characterized in that: The simulated asthma model used is an allergic asthma mouse model induced by house dust mite extract.

10. The use according to any one of claims 1 to 7, characterized in that: The dosage form of the drug is any one of injection, oral solution, capsule, tablet, spray or ointment.

Images