Anoectochilus roxburghii WUS-related transcription factor ArWOX10 and application thereof

Abstract

The invention relates to a transcription factor ArWOX10 related to anoectochilus formosanus WUS and application of the transcription factor ArWOX10. The transcription factor ArWOX10 comprises polypeptide with an amino acid sequence as shown in SEQ ID NO. 2. The invention also provides a nucleotide sequence SEQ ID NO. 1 for coding the protein. The invention provides a theoretical basis for promoting the growth of anoectochilus formosanus and improving the drought stress resistance by utilizing a molecular biological technology, and has important application value.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering application, relates to an important homeobox in the growth and development process of roxburghii roxburghii, and specifically relates to a roxburghii roxburghii WUS-related transcription factor ArWOX10 and an application thereof. Background Art

[0002] Golden thread lotus[ Anoectochilus roxburghii (Wall.) Lindl.] is a perennial herbaceous plant of the genus Orchidaceae, and is a rare and precious Chinese medicinal material in my country; the whole plant can be used as medicine, with a sweet taste and a flat nature, and has the effects of clearing heat and cooling blood, removing dampness and detoxifying, and is known as the "king of medicine". In recent years, the wide application of golden thread vine in many fields has led to a continuous increase in demand in the domestic and foreign markets. However, the viability period of golden thread vine flower powder and stigma is relatively short, and the natural reproduction rate of seeds is low. Golden thread vine seeds have embryo abortion after fertilization, resulting in reproductive disorders in golden thread vine. Although the technologies of golden thread vine germplasm resource evaluation, seedling breeding, tissue culture seedling transplanting, and ecological cultivation are becoming more and more mature, long-term asexual reproduction and unreasonable seed retention have led to species degeneration, decreased resistance, and unstable quality, affecting the quality of Chinese medicinal materials and clinical efficacy.

[0003] WUS (WUSCHEL) homeodomain genes, also known as WOX (WUSCHEL-related homeobox) gene family, are a family of transcription factors that can be specifically expressed in plants. They contain a highly conserved helix-loop-helix-turn-helix structure of about 60 amino acids and are a subfamily of the Homeobox (HB) transcription factor superfamily. The study of the function of WOX family genes began with the screening of Arabidopsis stem development mutants. Existing functional studies have shown that WOX genes play an important regulatory role in plant tissue and organ development, embryonic development, callus formation and maintenance, hormone signal transduction, and stem cell maintenance. WOX family genes are widely involved in many biological processes such as plant growth and development and stress response, but there are no reports on the involvement of WOX proteins in the growth and development of Anoectochilus roxburghii and in stomatal movement in response to drought stress. Summary of the invention

[0004] In order to fill the gap in the WOX family genes of Anoectochilus roxburghii, the present invention discloses the nucleotide coding sequence and amino acid sequence, subcellular localization, and transgenic plant growth phenotype of the WOX transcription factor ArWOX10 of Anoectochilus roxburghii 'Hongxia', which will provide a basis for the future regulation of the WOX family genes of Anoectochilus roxburghii 'Hongxia'. ArWOX10 Gene expression provides a theoretical basis for improving the breeding efficiency of golden thread vine.

[0005] The present invention provides a 'Hongxia' WOX transcription factor ArWOX10 of Aromatica roxburghii with the functions of promoting early flowering of plants and drought resistance. The transcription factor ArWOX10 comprises a polypeptide (protein) having an amino acid sequence as shown in SEQ ID NO.2; or a protein having the characteristics of the 'Hongxia' WOX transcription factor ArWOX10 of Aromatica roxburghii with one or more amino acids substituted, deleted or added to the amino acid sequence as shown in SEQ ID NO.2.

[0006] On the other hand, the present invention provides a gene encoding the above-mentioned Anoectochilus roxburghii 'Hongxia' WOX transcription factor ArWOX10, and the nucleotide sequence of the above-mentioned encoding gene is specifically: (a) the base sequence is shown in positions 1 to 1680 of SEQ ID NO.1; or (b) a sequence with at least 70% homology with the nucleotides shown in positions 1 to 1680 of SEQ ID NO.1.

[0007] In the present invention, "isolated DNA" and "purified DNA" mean that the DNA or fragment has been separated from the sequences located on both sides of it in the natural state, and also means that the DNA or fragment has been separated from the components accompanying the nucleic acid in the natural state, and has been separated from the proteins accompanying it in the cell.

[0008] In the present invention, the coding gene of the WOX transcription factor ArWOX10 of Anoectochilus roxburghii 'Hongxia' refers to a nucleotide sequence encoding a polypeptide having the protein activity of Anoectochilus roxburghii 'Hongxia', such as the nucleotide sequence at positions 1 to 1680 shown in SEQ ID NO.1 and its degenerate sequence. The degenerate sequence refers to a sequence generated after one or more codons in the nucleotides at positions 1 to 1680 shown in SEQ ID NO.1 are replaced by degenerate codons encoding the same amino acids. Due to the degeneracy of codons, a degenerate sequence with a homology of as low as about 70% with the nucleotide sequence at positions 1 to 1680 shown in SEQ ID NO.1 can also encode the sequence shown in SEQ ID NO.2. The above coding gene can also refer to a nucleotide sequence with a homology of at least 70% with the nucleotide sequence shown in SEQ ID NO.1.

[0009] The above coding gene may also refer to a variant form of the sequence shown in SEQ ID NO. 1 that can encode the same function as the natural Anoectochilus 'Hongxia' WOX transcription factor ArWOX10. These variant forms include (but are not limited to): usually 1 to 120 nucleotides of deletion, insertion and / or substitution, and addition of less than 90 nucleotides at the 5' and / or 3' ends.

[0010] In the present invention, the real-time fluorescence quantitative PCR method can be used to analyze the ArWOX10 Anoectochilus chinensis 'Hongxia' ArWOX10 The presence or absence and quantity of mRNA transcripts of a gene in a cell.

[0011] In addition, according to the present invention, the roxburghii 'Hongxia' ArWOX10 Gene nucleotide sequence and amino acid sequence can be used to screen for Anoectochilus roxburghii 'Hongxia' based on nucleic acid homology or expressed protein homology. ArWOX10 Gene-related homologous genes or homologous proteins.

[0012] Anoectochilus roxburghii 'Hongxia' of the present invention ArWOX10 The full-length sequence of gene-related nucleotides or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed in the present invention, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified in each time together in the correct order.

[0013] Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the proliferated host cells by conventional methods.

[0014] In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0015] In addition to recombinant production, fragments of the protein of the invention can also be produced by direct peptide synthesis using solid phase techniques. Each fragment of the protein of the invention can be chemically synthesized separately and then chemically linked to produce the full-length molecule.

[0016] The present invention also provides a recombinant expression vector, which comprises the coding gene of the above-mentioned Anoectochilus roxburghii 'Hongxia' WOX transcription factor ArWOX10; the above-mentioned recombinant expression vector is pHB-ArWOX10.

[0017] The present invention also provides a recombinant bacterium, which is obtained by transforming the above-mentioned recombinant expression vector into a host cell; the above-mentioned host cell is Agrobacterium GV3101.

[0018] The present invention also provides an application of the coding gene of the above-mentioned Anoectochilus roxburghii 'Hongxia' WOX transcription factor ArWOX10 in promoting the growth of Anoectochilus roxburghii and improving its drought resistance.

[0019] The above application includes: constructing a recombinant expression vector containing the above coding gene of the above transcription factor ArWOX10, transforming a plant host, and cultivating and screening to obtain transgenic plants.

[0020] Beneficial effects: As a rare and precious Chinese medicinal material, Anoectochilus roxburghii has a large market demand. This invention cloned the coding sequence of ArWOX10, an important regulatory transcription factor in the growth and development of Anoectochilus roxburghii 'Hongxia' for the first time, and used real-time fluorescence quantitative PCR to analyze ArWOX10 Gene expression patterns, transient expression analysis of the transcription factor ArWOX10 in tobacco leaf epidermal cells, and regulation of stomatal closure to improve drought tolerance; to provide a basis for future use of genetic engineering technology to regulate ArWOX10 The temporal and spatial expression of genes provides a theoretical basis for promoting early flowering, drought stress resistance and new variety breeding of plants, and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Anoectochilus roxburghii 'Hongxia' WOX Evolutionary tree analysis diagram of genes and WOX homologous genes of multiple species and protein domain prediction analysis diagram; A is the evolutionary tree analysis diagram of ArWOX10 of Anoectochilus roxburghii and WOX homologous genes of multiple species; B is the protein domain analysis diagram; Figure 2 This is the localization map of the transcription factor ArWOX10 of Anoectochilus roxburghii 'Hongxia' in the epidermal cells of tobacco leaves; Figure 3 Anoectochilus 'Hongxia' ArWOX10 The expression changes of genes in different tissues of Anoectochilus roxburghii and under PEG-simulated drought stress; A is the tissue expression pattern diagram; B is the stem and leaf expression pattern diagram under 20% PEG treatment; Figure 4 Wild type and overexpression ArWOX10 Growth phenotype of the gene plant under long-day conditions (16 h / 8 h light / dark); Figure 5 For overexpression ArWOX10 The effect of genes on flower morphology and the ability of plants to tolerate drought with closed stomata, where A is the flower morphology diagram; B is the plant's tolerance to drought stress; and C is the plant's closed stomata response to drought. DETAILED DESCRIPTION

[0022] The technical scheme of the present invention is described in detail below through examples, but the protection scope of the present invention is not limited to the examples. The experimental methods without specific conditions in the following examples are usually used according to conventional conditions, such as the conditions described in the Molecular Cloning Experiment Guide (original book fourth edition), or the conditions recommended in the reagent instructions.

[0023] Example 1 , Anoectochilus 'Hongxia' ArWOX10 Gene cloning (1) Acquisition of plant materials Total RNA was extracted from the stems, leaves, buds, flowers and other tissues of the normally growing Anoectochilus roxburghii 'Hongxia'.

[0024] (2) RNA extraction Hunan Aikerui Bioengineering Co., Ltd. SteadyPure Total RNA was extracted using the RNA extraction kit, the integrity of RNA was identified by gel electrophoresis, and the purity and concentration of RNA were determined by a spectrophotometer (Nanodrop 2000).

[0025] (3) Full-length cloning of genes Based on the nucleotide sequence and protein function annotation results provided by the laboratory's previous full-length transcriptome analysis, we obtained the ArWOX10 Full length of gene.

[0026] The extracted RNA was reverse transcribed (TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix) to obtain cDNA. The first-strand cDNA was used as a template and the primers ArWOX10 - F (5'-ATGGATTCTGGCGACGA-3') and ArWOX10-R (5'-CGCATTTCAAACGGTCATAA-3') were used for PCR to amplify a 1680 bp fragment, which was recovered and ligated to the pMD18-T vector. M13-47 and RV-M were used as universal primers and sent to Hangzhou Youkang Biological Company for sequencing.

[0027] Example 2 , Anoectochilus 'Hongxia' ArWOX10 Gene sequence information and homology analysis Anoectochilus roxburghii 'Hongxia' of the present invention ArWOX10 The full-length open reading frame sequence of the gene is 1680 bp, and the detailed sequence is shown in SEQ ID NO.1. The sequencing results were combined with the ORF Finding (https: / / www.ncbi.nlm.nih.gov / orffinder / ) prediction of NCBI to obtain the ArWOX10 The ORF reading frame of the gene was amplified by PCR to obtain 1680 bp of Anoectochilus chinensis 'Hongxia' ArWOX10 The nucleotide sequence (SEQ ID NO.1) was used to deduced the amino acid sequence of the transcription factor ArWOX10 protein of Anoectochilus roxburghii 'Hongxia' based on the open reading frame sequence, which contained 559 amino acids, a molecular weight of 138.07 kDa, and an isoelectric point (pI) of 4.96. The detailed sequence is shown in SEQ ID NO.2.

[0028] Anoectochilus 'Hongxia' ArWOX10The amino acid sequence of the gene's encoded protein was predicted using the MEME program for protein domain prediction, and the results showed that it contained two characteristic domains of WOX transcription factors, HOX and START, such as Figure 1 B. Phylogenetic tree analysis showed that the transcription factor ArWOX10 of Anoectochilus roxburghii 'Hongxia' was closely related to the WOX10 protein of Dendrobium officinale. Figure 1 As shown in A.

[0029] Example 3 , Construction of recombinant expression vector pHB-ArWOX10 and analysis of subcellular localization of transcription factor ArWOX10 in tobacco leaves Specific primers F (5'- GACGAGCTGTACAAGGGATCCATGGATTCTGGCGACGA-3') and R (5'- GATCAATTCGAGCTCCTGCAGTTATGACCGTTTGAAATGCG -3') were designed from the start codon and the stop codon, and restriction sites were introduced on both sides of the full-length gene sequence. The target fragment plasmid with restriction sites was combined with the pHB binary transformation vector. Bm I and SpeI double enzyme digestion, recovery of the digested vector and ArWOX10 The fragments were connected using T4 ligase at 4°C for 12-14 hours to construct the pHB-ArWOX10 recombinant expression vector.

[0030] The correct recombinant expression vector was screened by PCR and sequencing, and the recombinant plasmid was transformed into Agrobacterium competent GV3101 by freeze-thaw method to obtain the recombinant bacteria (host cell) Agrobacterium GV3101 containing the recombinant expression vector.

[0031] The identified GV3101 strain was inoculated into 5 mL YEP (containing 50 mg / L Kan) and cultured at 28°C and 180 rpm until the OD 600 Take 1 mL of bacterial solution and add it to 25 mL of YEP liquid medium. Culture at 28°C until OD 600 0.6; take 10 mL of bacterial solution and centrifuge at 4500 rpm for 15 min; suspend the bacteria in MS liquid medium until OD 600 The concentration of AS and MES was about 0.6, and AS and MES were added and placed at room temperature for more than 3 hours; then injected into tobacco leaves, cultured in dark conditions for 48 hours, and observed using a laser confocal microscope at an excitation wavelength of 514 nm, such as Figure 2 shown.

[0032] Example 4 , Anoectochilus roxburghii ArWOX10 Gene expression changes in different tissues of Anoectochilus roxburghii and under drought stress (1) Material acquisition: Anoectochilus roxburghii was subjected to drought stress treatment with 20% PEG8000, and samples were collected at 0 h, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h. The samples were wrapped in aluminum foil and placed in liquid nitrogen, and then transferred to a -80°C ultra-low temperature refrigerator for storage until use.

[0033] (2) The extraction of RNA, determination of RNA purity and concentration, and acquisition of cDNA were carried out as described in Example 1.

[0034] (3) Design specific primers to perform real-time fluorescence quantitative PCR to analyze the expression of genes in various tissues. ArWOX10 Gene sequences, designed for real-time PCR ArWOX10 Specific primers for gene quantitative analysis, primer q ArWOX10 -F (5'-ACTGATGAACCTCTTTGGACT-3'), primer q ArWOX10 -R (5'-GTCAACCAATGCTAAGGAATT-3'), internal reference gene ArActin Primer ArActin- F(5'-GCTAGTGGCCGTACAACTGG-3'), ArActin -R(5'-GCCAGCAAGGTCCAATCGAA-3').

[0035] (4) Standard curve of target gene and internal reference gene: dilute the standard cDNA solution with ddH2O, use the diluted cDNA as template, and use the target gene and internal reference gene as standard curve. ArActin Real-time PCR amplification was performed with specific primers, and melting curves and standard curves were drawn. The melting curves were analyzed to confirm whether the melting curves of the target gene and the internal reference gene showed a single peak, thereby verifying the specificity of the primers and the uniqueness of the PCR amplification product. The appropriate dilution multiple of the cDNA template was determined by the standard curve to provide an accurate quantitative basis for subsequent experiments.

[0036] (5) Real-time fluorescence quantitative analysis of the target gene in the sample to be tested: Using the first strand of the synthesized cDNA as a template, the target gene and the internal reference gene are used ArActin The specific primers were used for fluorescence quantitative analysis, and the real-time PCR reaction was performed using a Bio-Rad CFX real-time fluorescence quantifier. The reaction system was 20 μL, and the reaction program was as follows: pre-denaturation at 95°C for 30 s, 95°C for 15 s, 55°C for 15 s, and 72°C for 15 s, and 40 cycles.

[0037] (6) Adopt 2 -△△CtThe results showed that in tissues at different developmental stages, ArWOX10 Gene expression levels increased significantly in leaves, such as Figure 3 As shown in A; and under PEG treatment, ArWOX10 The gene expression level was significantly down-regulated in the stem, while in the leaves it showed an overall trend of first increasing and then decreasing. Figure 3 As shown in B.

[0038] Example 5 , ArWOX10 Arabidopsis thaliana (1) Pre-shaking Agrobacterium: Pick a positive single clone and transfer it to 5 mL of YEP liquid medium containing 50 mg / L Kan and 25 mg / L Rif, and culture it at 28°C and 180 rpm for 24 h; (2) Propagation of Agrobacterium: The pre-shaken Agrobacterium culture was propagated at a dilution of 1:100 into YEP medium containing the same resistance strain, cultured at 28°C, 200 rpm for 13-16 h until OD 600 Reach about 0.6, 18℃, 3500 rpm, 15 min to collect bacteria; (3) Transformation of Arabidopsis thaliana by the inflorescence immersion method: The specific steps for using the Agrobacterium-mediated inflorescence immersion method to infect Arabidopsis thaliana are as follows.

[0039] ① Before infection, cut off the flowers that have bloomed and formed pods, leaving only the unopened flowers, and provide sufficient watering and fertilization to prepare for infection.

[0040] ② Prepare resuspension solution MS + 20 g / L sucrose (pH 5.8). Resuspend the Agrobacterium cells in the resuspension solution and adjust the OD 600 The value is adjusted to 0.8-1.0, and then Silwet L-77 is added to make the concentration reach 0.02%, and the infection solution is obtained by shaking.

[0041] ③ Select wild-type Arabidopsis that has been treated the day before, immerse the inflorescence of each Arabidopsis completely in the infection solution, and vacuum for 10 minutes.

[0042] ④ Place the Arabidopsis thaliana upside down in the dark for one day, and then place it in the greenhouse for normal culture at a temperature of 22°C, a humidity of 65%, 16 hours of light, and 8 hours of darkness.

[0043] (4) Screening of transgenic positive strains Genomic DNA and RNA were extracted using kits from Quanshijin Biotechnology Co., Ltd. (Beijing), and positive plants were identified by PCR amplification.

[0044] Example 6 , overexpression ArWOX10 Arabidopsis phenotypic analysis (1) Observation of growth phenotype of transgenic plants The research objects of Arabidopsis phenotypic observation and measurement include positive homozygous T3 generation plants and positive homozygous T3 generation seeds (OE), while wild-type Arabidopsis is used as a negative control (WT). The measured indicators cover plant growth cycle, plant height, and flower anatomical morphology.

[0045] The method for observing the plant growth cycle is to randomly select three transgenic plants on the 40th day after sowing Arabidopsis, observe the difference in growth cycle between them and the control plants, and record photos, such as Figure 4 As shown, it can be seen that overexpression ArWOX10 The method for observing the anatomical morphology of flowers is to randomly select three flowers with similar opening degree after the control plants and transgenic plants grow to the flowering period, carefully cut them open with a blade and tweezers, and neatly place the pistil, stamen, corolla and sepals in order on a black cloth, and take photos to record them. Figure 5 As shown in A.

[0046] (2) Stomatal movement experiment of transgenic plants under drought Wild-type and transgenic Arabidopsis seeds were placed in 1 / 2 MS medium containing 0 and 100 mM sorbitol and cultured for 10 days for phenotype observation and photography. Figure 5 B. After the transgenic Arabidopsis, tobacco and golden thread lotus leaves were dehydrated for 30 min in vitro, the degree of stomatal opening and closing was observed under a laser confocal microscope. Figure 5 C, where (a) represents the stomata of Arabidopsis leaves, (b) represents the stomata of tobacco leaves, and (c) represents the stomata of Anoectochilus roxburghii leaves; expression under drought ArWOX10 The stomatal opening degree of the leaves of the plants was less than that of the unsupported leaves or the wild-type leaves, indicating that ArWOX10 positively regulates drought tolerance.

[0047] The above-mentioned technologies not specifically mentioned are all referred to the prior art.

[0048] As described above, although the present invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the present invention itself. Various changes in form and details may be made without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A WOX transcription factor ArWOX10 from Anoectochilus roxburghii 'Hongxia', characterized in that: The transcription factor ArWOX10 includes a polypeptide having an amino acid sequence as shown in SEQ ID NO.

2.

2. A gene encoding the WOX transcription factor ArWOX10 of Anoectochilus roxburghii 'Hongxia' according to claim 1, characterized in that: The coding gene includes the nucleotide sequence shown in SEQ ID NO.

1.

3. A recombinant expression vector, characterized in that: The invention comprises the coding gene of the WOX transcription factor ArWOX10 of the roxburghii 'Hongxia' described in claim 2.

4. Use of the gene encoding the WOX transcription factor ArWOX10 of Anoectochilus roxburghii 'Hongxia' according to claim 2 in promoting the growth of Anoectochilus roxburghii and improving its drought stress resistance.

5. Use of the gene encoding the WOX transcription factor ArWOX10 of Anoectochilus roxburghii 'Hongxia' according to claim 4 in promoting the growth of Anoectochilus roxburghii and improving its drought resistance, characterized in that: The application includes: constructing a recombinant expression vector containing the coding gene of the transcription factor ArWOX10, transforming a plant host, and cultivating and screening to obtain transgenic plants.

Images