Biocatalytic synthesis method of ambrogyl ether

Abstract

The invention discloses a biological catalytic synthesis method of norambrox ether, which comprises the following steps: step 1, starting from trans-nerolidol, carrying out carroll rearrangement reaction to synthesize farnesyl acetone; 2, in the presence of a cofactor, converting farnesyl acetone into high farnesol acetate under catalysis of Bayer-Villiger monooxygenase; step 3, catalyzing the deacetylation of the high-farnesol acetate by using esterase to obtain EE-high-farnesol; and step 4, carrying out enzymatic conversion on farnesol by using the squalene hopaene cyclase mutant to obtain norambrox ether. The transformation process is safe and non-toxic, Bayer-Villiger monooxygenase which is new with a key enzyme, natural co-expressed esterase, alcohol dehydrogenase and squalene and hopaene cyclase mutants matched with the system are used for synergistic transformation, so that not only is the coenzyme for oxidation reaction promoted to be recycled, but also the conversion efficiency is improved; conversion from farnesyl acetone to norambrox ether can be efficiently and specifically catalyzed, and a final product can be directly obtained from a reaction system without separation and purification of an intermediate.

Description

Technical Field

[0001] The present invention belongs to the field of biocatalysis and synthetic biology, and provides a chemical-enzyme synthesis method, which starts from terpenoid compounds of biosynthetic origin such as nerolidol, combines simple chemical transformation with downstream bioenzyme transformation method, and is used for the efficient synthesis of the flavor ingredient ambroxide. Background Art

[0002] Natural ambergris is a precious spice that comes from the grayish-white soft stones in the stomach and intestines of sperm whales. It is more valuable than gold because of its extremely small quantity. Since the source of natural ambergris is scarce and difficult to obtain, related research directions are mostly devoted to developing artificial synthesis methods to replace natural resources. Ambroxol [(-)-Ambroxide] is one of the most critical active ingredients of natural ambergris, with a scent similar to wood, amber and smoke (L. Cristiano et al., Cosmetics 2022,9,13). Ambroxol has important value in the fragrance and cosmetics industry. It is the most highly rated of all synthetic ambergris fragrances. Due to its unique aroma, stability and good volatility, it can increase the durability and diffusivity of fragrances. As one of the excellent substitutes for ambergris and an extremely excellent fixative, it is widely used in the production of high-end perfumes and flavors. Since ambroxol is non-irritating and non-allergic to the human body, it is very suitable for flavoring skin, hair and fabrics, and is also widely used in the cosmetics industry (N. He et al., Chem & Bio Engineering, 2024, 1(2): 91). At the same time, ambroxol is also used in the flavoring and adding of the cigarette industry to improve the flavor quality of tobacco (N. He et al., ACS Sustain Chem Eng, 2023, 11: 1939).

[0003] The main methods of obtaining Ambrox are as follows:

[0004]

[0005] Ambrox has a 16-carbon-atom quasi-halanoid terpenoid, which belongs to a terpene-derived compound containing a non-classical number of carbon atoms. At present, the industrial production of Ambrox is mainly prepared with sclareol, β-dihydroionone, and farnesol analogs as raw materials. Among them, sclareol has a carbon atom skeleton similar to Ambrox, and can be synthesized to obtain optically pure Ambrox. It is the most practical raw material for synthesizing Ambrox, and this route is also the main method for obtaining Ambrox in the industry. Specifically, this route uses sclareol, a natural product extracted from plants, as a raw material, and carries out chemical oxidation, reduction, and cyclization reactions to successively form sclareolide and sclarediol, and finally produce Ambrox. However, these production methods still have many problems from the perspectives of green chemistry, stereochemistry, and supply chain. For example, the key step of the sclareol technical route is to oxidatively degrade the side chain to obtain sclareolide, and an equivalent chemically equivalent oxidant with relatively serious pollution must be used. For example, the traditional synthesis method is chromic anhydride oxidation, that is, chromic anhydride is used to oxidize sclareol to synthesize it. It is easy to operate, but the chromium-containing wastewater generated during the production process has a large environmental pollution, and it is basically no longer used. Barton et al. proposed to oxidize sclareol in tetrahydrofuran with sodium periodate and osmium tetroxide. Subsequently, Reynolds Company of the United States developed a potassium permanganate two-step oxidation method (US3050532). Shanghai Institute of Perfume of China has also developed a potassium permanganate low-temperature oxidation process. These oxidants can oxidatively degrade the side chain of sclareol to obtain sclareolide, but they will cause serious heavy metal pollution. Although the method of oxidative degradation using green oxidants such as ozone and hydrogen peroxide has been reported, its yield and product separation efficiency cannot meet the needs of industrialization, and the residual chemical reagents and poor stereoselectivity greatly limit the application of these synthesis methods. In addition, the cost of these semi-synthetic routes fluctuates greatly due to the supply of sclareol extracted from plants, which is not conducive to the control of product costs. Finally, since Ambrox has multiple different stereoisomer structures and the isomers have certain differences in aroma characteristics, the various types of Ambrox analogues and optical isomers introduced in the chemical synthesis affect the purity and aroma of the final product.

[0006] At present, natural extracts are still the main source of the natural flavors and fragrances market. However, faced with the pressure of the growing global population and the decreasing arable land area, the demand for crops to solve the problem of food and clothing for mankind is obviously more urgent than spice crops. From a long-term development perspective, it has become an inevitable trend to find natural sources of flavors that can replace spice crops, and flavors prepared by biotechnology are regarded as natural products and have a certain premium in the consumer market. In addition, compared with traditional organic synthesis processes, biotechnology also has the advantages of mild reaction conditions, good stereoselectivity, and low environmental pollution. Therefore, the use of biotechnology to prepare natural flavors has become one of the most popular research hotspots in the field of Chinese flavors. There are reports on the production of Ambrox by combining biotransformation and chemical catalysis: one is to use the fungus Cryptococcus albidus ATCC 20918 or Filobasidium magnum JD1025 to ferment sclareol as raw material to produce sclareolide (US5212078A, 1993), and then synthesize Ambrox through chemical transformation; the other is to use the fungus Hyphozyma roseoniger ATCC20624 to produce sclarediol (US4798799A, 1989), and then use sclarediol as raw material to produce Ambrox through chemical method. Hyphozyma roseonigra ATCC 20624 is the only known microorganism that can use sclareol as a single carbon source and metabolize sclarediol with a high conversion rate. Starting from sclareol, it is an attractive alternative to directly convert it into sclarediol by Rhodotorula, and then obtain ambroxan through a simple dehydration cyclization step. However, sclareol is cytotoxic to Rhodotorula, so it is difficult to achieve an economically feasible substrate concentration. In addition, its metabolic pathway has been unclear, which has hindered our heterologous construction of high-yield strains of ambroxan or efficient biocatalytic systems in other chassis cells. Studies have suggested that sclareol may be converted into the corresponding α, β-unsaturated acid by an unknown alcohol-aldehyde dehydrogenase in Rhodotorula, but its subsequent metabolites and metabolic enzymes still need to be further analyzed.

[0007] Givaudan of the United States has developed a technical route Ambrofix (WO2016 / 170099, WO2021 / 110848) that starts from β-farnesene and uses EE-homofarnesol to synthesize optically pure Ambrox in one step by enzyme catalysis. Compared with the semi-chemical synthesis route starting from sclareol, Ambrofix transforms the multi-step low-yield and highly polluting chemical synthesis into a one-step efficient squalene-hopaene cyclase (SHC enzyme) catalyzed cyclization, achieving the maximum degree of atom economy and green sustainability. It is the biggest innovation in the field of Ambrox biosynthesis in recent years. However, in this route, EE-homofarnesol still requires multiple steps of highly dangerous and polluting chemical synthesis steps to obtain it, and this route increases the cost of EE-homofarnesol synthesis due to the cis-trans isomerization of the substrate during the chemical transformation process. The route starts with bio-based (E)-conformation β-farnesene, which is fermented with sugarcane as a carbon source and produced by heterologously expressing farnesene synthase in Saccharomyces cerevisiae (WO2015 / 059293). In the chemical transformation, diazomethane is first generated in situ by N-nitroso-N-methylurea (NMU) and potassium hydroxide in the presence of a palladium (II) catalyst, and the terminal double bond of (E)-conformation β-farnesene is selectively cyclopropanated. Although this process is carried out continuously in a flow system with high atom economy, NMU is a strong carcinogen, mutagen and teratogen, so the process still does not meet the requirements of green chemistry. After the cyclopropanation is completed, the cyclopropyl rearrangement is carried out through a phase transfer-mediated acidification reaction and converted into the corresponding ester, which is deacylated to generate EE-homofarnesol. This process is prone to produce cis-trans isomerized byproducts, which not only increases the synthesis cost, but also affects the flavor and optical purity of the final product.

[0008] Therefore, there is still a need to use synthetic biology and biocatalysis technology to find a market-competitive and green-chemistry-compliant synthesis pathway for ambroxol, so that it can meet consumers' growing demand for natural fragrances.

[0009] The existing chemical synthesis and biosynthesis methods of Ambrox and its analogs have the following defects:

[0010] 1. The existing chemical synthesis route of Ambrox requires the use of heavy metal oxidants with relatively serious pollution, such as osmium tetroxide, potassium permanganate, etc., with low yield and high separation and purification costs. At the same time, the reaction raw material clarysol is extracted from plants, the cost fluctuates greatly due to weather changes, and the supply chain stability is poor.

[0011] 2. The existing biotransformation to obtain Ambrox still requires downstream chemical transformation, and the substrate is the same as the pure chemical synthesis route, which is sclareol extracted from plants, and still faces the problem of supply chain fluctuations. In addition, the substrate sclareol is naturally toxic to cells, and the substrate concentration of biotransformation cannot meet the needs of industrialized efficient production.

[0012] 3. Existing biocatalytic routes such as Ambrofix still require the use of highly toxic reagents to synthesize the substrates required for enzyme catalysis, which cannot meet the requirements of green chemistry. In addition, the cis-trans isomerism of the substrates introduced in the chemical synthesis has increased the production cost of this route. Summary of the invention

[0013] In order to solve the problems in the prior art, the present invention provides, in the first aspect, a Baeyer-Villiger monooxygenase and its naturally co-expressed esterase and alcohol dehydrogenase, a Baeyer-Villiger monooxygenase and alcohol dehydrogenase fusion protein, a Baeyer-Villiger monooxygenase and esterase fusion protein, and an amino acid sequence of a squalene-hopaene cyclase mutant.

[0014] In a second aspect, the present invention provides a gene encoding the Baeyer-Villiger monooxygenase, the naturally co-expressed esterase, the alcohol dehydrogenase, the squalene-hopaene cyclase mutant, and the key enzyme fusion protein described in the first aspect of the present invention.

[0015] In a third aspect, the present invention provides a recombinant plasmid containing the genes encoding Baeyer-Villiger monooxygenase, esterase, alcohol dehydrogenase, squalene-hopaene cyclase mutant, and key enzyme fusion protein as described in the second aspect of the present invention.

[0016] In a fourth aspect, the present invention provides a genetically engineered bacterium containing the recombinant plasmid described in the third aspect of the present invention and its use in the biocatalytic synthesis of Ambrox.

[0017] In a fifth aspect, the present invention provides a biocatalytic synthesis method for ambrox to overcome the shortcomings of the prior art that the reaction raw material sclareol is derived from plant extraction, has poor supply chain stability, and is subject to heavy metal pollution due to chemical conversion; the substrate sclareol is naturally toxic to cells, and the substrate concentration of bioconversion cannot meet the needs of industrial efficient production; and the biocatalytic route requires the use of highly toxic reagents.

[0018] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention includes:

[0019] A Baeyer-Villiger monooxygenase and its naturally co-expressed esterase and alcohol dehydrogenase, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is shown in SEQ ID NO:3, the amino acid sequence of the esterase is shown in SEQ ID NO:4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:7.

[0020] A fusion protein, wherein a Baeyer-Villiger monooxygenase and an alcohol dehydrogenase, or a Baeyer-Villiger monooxygenase and an esterase, are fused using a flexible linker pair, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3, the amino acid sequence of the esterase is selected from one of SEQ ID NOs: 4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO: 7.

[0021] The amino acid sequence of the Baeyer-Villiger monooxygenase and alcohol dehydrogenase fusion protein is shown in SEQ ID NOs: 18-19, and the amino acid sequence of the Baeyer-Villiger monooxygenase and esterase fusion protein is shown in SEQ ID NOs: 20-21.

[0022] In addition to the amino acid sequences listed, any suitable flexible linker known in the art can be used to fuse Baeyer-Villiger monooxygenase to alcohol dehydrogenase, or Baeyer-Villiger monooxygenase to esterase, such as but not limited to: GSG, GGGGS, (GGGGS)2, (GGGGS)3, EAAAK, (EAAAK)2, (EAAAK)3, G8, G6.

[0023] A method for converting farnesyl acetone into EE-homofarnesol comprises the following steps:

[0024] Step 1: in the presence of a cofactor, Baeyer-Villiger monooxygenase catalyzes the conversion of farnesyl acetone into homofarnesol acetate, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3;

[0025] Step 2: Esterase catalyzes the deacetylation of homofarnesol acetate to obtain EE-homofarnesol, wherein the amino acid sequence of the esterase is selected from

[0026] One of SEQ ID NO:4-6.

[0027] Preferably, the Baeyer-Villiger monooxygenase and esterase are in the form of supernatant of crude extract of Escherichia coli. The Baeyer-Villiger monooxygenase, esterase, alcohol dehydrogenase, squalene-hopaene cyclase mutant and key enzyme fusion protein can be present in the reaction mixture as a cell extract prepared from the corresponding cells producing it. Similarly, a single cell strain can also be used to express the above-mentioned Baeyer-Villiger monooxygenase, esterase, alcohol dehydrogenase, squalene-hopaene cyclase mutant and key enzyme fusion protein, and its cell extract can be used as a single biocatalyst for in vitro biocatalytic synthesis of Ambrox. Preferably, the cell is preferably a bacterial host cell for producing the enzyme.

[0028] Cell extracts can be obtained by any suitable method capable of lysing host cells, including but not limited to: ultrasonic treatment, RNase / lysozyme treatment, freeze-thaw treatment or alkali treatment. The cell lysate can be processed by any suitable method known in the art, including but not limited to: filtering, centrifuging or purifying with salt to obtain a clarified cell extract.

[0029] Preferably, the cofactor is selected from NADH and NADPH or a combination thereof.

[0030] The method includes a cofactor regeneration system.

[0031] Preferably, the cofactor regeneration system is an alcohol dehydrogenase / isopropanol cofactor or a glucose dehydrogenase (GDH) / glucose regeneration system.

[0032] A method for converting farnesyl acetone into EE-homofarnesol comprises the following steps: in the presence of a cofactor, using one of the fusion proteins selected from Baeyer-Villiger monooxygenase and esterase to catalyze the conversion of farnesyl acetone into EE-homofarnesol.

[0033] A method for converting farnesyl acetone into Ambrox comprises the following steps:

[0034] Step 1: in the presence of a cofactor, Baeyer-Villiger monooxygenase catalyzes the conversion of farnesyl acetone into homofarnesol acetate, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3;

[0035] Step 2: esterase catalyzes the deacetylation of homofarnesol acetate to obtain EE-homofarnesol, wherein the amino acid sequence of the esterase is selected from one of SEQ ID NOs: 4-6;

[0036] Step 3: Enzymatically converting EE-homofarnesol into Ambrox using a squalene-hopaene cyclase mutant, wherein the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NOs: 8-17.

[0037] The pH of the reaction mixture may be in the range of 4 to 9, preferably 7 to 9 (which includes a pH of about 8.5), and may be maintained by adding a buffer or pH corrector to the reaction mixture. Exemplary buffers for this purpose are Tris-HCl buffer or glycine / NaOH buffer. For the contemplated BVMO enzyme, the temperature is about 15° C. to about 60° C. During the bioconversion process, the temperature may be kept constant or may be varied.

[0038] A gene encoding the Baeyer-Villiger monooxygenase, the nucleotide sequence of which is shown in SEQ ID NOs: 22-24; the gene encoding the esterase, the nucleotide sequence of which is shown in SEQ ID NOs: 25-27; the gene encoding the alcohol dehydrogenase, the nucleotide sequence of which is shown in SEQ ID NO: 28. The gene encoding the squalene-hopaene cyclase mutant, the nucleotide sequence of which is shown in SEQ ID NOs: 29-38; the gene encoding the Baeyer-Villiger monooxygenase and co-expressed alcohol dehydrogenase fusion protein, the nucleotide sequence of which is shown in SEQ ID NOs: 39-40; the gene encoding the Baeyer-Villiger monooxygenase and esterase fusion protein, the nucleotide sequence of which is shown in SEQ ID NOs: 41-42.

[0039] A recombinant plasmid, comprising the gene encoding Baeyer-Villiger monooxygenase, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs:43-45; comprising the gene encoding esterase, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs:46-48; comprising the gene encoding alcohol dehydrogenase, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs:49; comprising the gene encoding squalene-hopaene cyclase mutant, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs:50-59; comprising the gene encoding Baeyer-Villiger monooxygenase and co-expressed alcohol dehydrogenase fusion protein, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs:60-61; comprising the gene encoding Baeyer-Villiger monooxygenase and esterase fusion protein, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs:62-63.

[0040] The expression vector of the recombinant plasmid is pET28a(+).

[0041] A genetically engineered bacterium, comprising the recombinant plasmid.

[0042] The expression host of the genetically engineered bacteria is E. coli BL21 (DE3).

[0043] The genetically engineered bacteria are used in converting a linear polyunsaturated branched-chain ketone substrate into corresponding acetate and an alcohol with a carbon chain shortened by two carbon atoms, and performing enzymatic cyclization using squalene-hopaene cyclase to synthesize terpene-derived compounds containing a non-classical number of carbon atoms.

[0044] The linear polyunsaturated branched ketone is farnesyl acetone and the terpene-derived compound containing a non-classical number of carbon atoms is ambroxan.

[0045] A method for converting nerolidol into ambrox, comprising the following steps:

[0046] Step 1: Starting from trans-nerolidol, a carroll rearrangement reaction is performed to synthesize farnesyl acetone, and nerolidol distillation is coupled with chemical synthesis of farnesyl acetone;

[0047] Step 2: in the presence of a cofactor, Baeyer-Villiger monooxygenase catalyzes the conversion of farnesyl acetone into homofarnesol acetate, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3;

[0048] Step 3: esterase catalyzes the deacetylation of homofarnesol acetate to obtain EE-homofarnesol, wherein the amino acid sequence of the esterase is selected from one of SEQ ID NOs: 4-6;

[0049] Step 4: Enzymatically converting EE-homofarnesol into Ambrox using a squalene-hopaene cyclase mutant, wherein the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NOs: 8-17.

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] 1) The chemical conversion method used in the present invention avoids the use of any highly polluting reagents and completely uses low-cost, operator- and environment-friendly non-toxic reagents.

[0052] 2) At the same time, the technical route optimizes the reaction process, couples the separation of nerolidol with chemical conversion, improves production efficiency and reduces energy consumption.

[0053] 3) The present invention adopts the in vitro biocatalytic method of crude enzyme extracts, and no living cells are involved in the conversion, thus bypassing the conversion concentration limit per unit volume caused by the inhibitory effect of the substrate on the cells, and improving the practicality of this route on an industrial scale.

[0054] 4) The present invention adopts a brand-new enzyme catalysis method to obtain the key substrate EE-homofarnesol of the cyclization reaction. The conversion process is safe and non-toxic, meeting the requirements of green chemistry. At the same time, we use the new Baeyer-Villiger monooxygenase, the naturally co-expressed esterase, the alcohol dehydrogenase and the squalene-hopaene cyclase mutant matched with the key enzyme for synergistic conversion, which not only promotes the recycling of the coenzyme of the oxidation reaction without the need for exogenous addition of expensive coenzymes, but also can efficiently and specifically catalyze the conversion from the substrate farnesyl acetone to ambrox, and the final product can be directly obtained from the reaction system without the need for separation and purification of the intermediates.

[0055] 5) The BVMO enzyme activity discovered by the present invention is better than existing solutions.

[0056] 6) The SHC mutants of the present invention have been specially evolved and screened to meet the requirements of high adaptability, stability and catalytic efficiency in complex catalytic systems. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 In order to use farnesyl acetone as substrate, BVMO was coupled with esterase to obtain the GC-MS chromatogram of EE-homofarnesol;

[0058] Figure 2 GC-MS chromatogram of the products obtained by incubating farnesyl acetone as substrate with the supernatant of crude extract of Escherichia coli expressing the fusion protease of Baeyer-Villiger monooxygenase and esterase under appropriate conditions;

[0059] Figure 3 GC-MS chromatograms of EE-homofarnesol obtained by co-incubating BVMO with different forms of esterase-expressing E. coli under appropriate conditions using farnesyl acetone as substrate;

[0060] Figure 4 The GC-MS chromatograms of farnesyl acetone produced by BVMO, esterase and SHC enzymes are shown, wherein A is the GC-FID chromatogram, the main peak marked by the arrow is Ambrox, B is the comparison result of the mass spectrum of the main peak Ambrox and the standard spectrum in the NIST database, and the arrow marks the molecular ion peak;

[0061] Figure 5 This is a diagram showing the screening results of the SHC enzyme combinatorial library;

[0062] Figure 6 The present invention describes a chemical-enzymatic synthesis route of Ambrox.

[0063] Figure 7 The BVMO converts the substrate methyl heptenone to Baeyer-Villiger oxidation and spontaneous ester hydrolysis, and the gas-mass spectrometry chromatogram of the obtained product, wherein A is the GC-FID chromatogram, B is the comparison result of the mass spectrum of the main product peak methyl-3-penten-1-ol and the standard spectrum in the NIST database, and the arrow marks the molecular ion peak;

[0064] Figure 8 The BVMO conversion of the substrate trans-geranylacetone resulted in Baeyer-Villiger oxidation and spontaneous ester hydrolysis, and the gas chromatography-mass spectrometry chromatogram of the obtained product, where A is the GC-FID chromatogram, B is the comparison result of the mass spectrum of the product peak 4,8-dimethylnona-3,7-dien-1-ol acetate and the standard spectrum in the NIST database, and the arrow marks the molecular ion peak. DETAILED DESCRIPTION

[0065] The present invention is further described below in conjunction with specific examples, which are merely exemplary and do not limit the scope of protection of the present invention. The reagents, kits, and strains involved in each example can all be purchased.

[0066] Unless otherwise defined, the technical terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. The experimental reagents used in the following examples are all conventional biochemical reagents unless otherwise specified; the experimental methods are all conventional methods unless otherwise specified.

[0067] First of all, it should be noted that the definitions of the terms mentioned in the specification of the present invention are known to those skilled in the art. For example, the definitions of some of the terms are as follows:

[0068] BVMO stands for Baeyer-Villiger monooxygenase.

[0069] ADH stands for alcohol dehydrogenase, and GDH stands for glucose dehydrogenase.

[0070] SHC indicates squalene-hopaene cyclase mutant.

[0071] Example 1 The target gene was cloned, overexpressed and purified.

[0072] The total mRNA of Hyphozyma roseonigra ATCC 20624 was extracted using a fungal total RNA rapid extraction kit, and the total cDNA was obtained by reverse transcription using a reverse transcription kit as a PCR template for target gene amplification. Taking the target gene sgs3312 as an example: BVMO-FW (GGGCGCCATGATGACGACTCCAACTATGACAATGCCATC) and BVMO-RV (GAGACTGCAGGTCATTAATGGTTGCTGAGCCACGACTCTTTATG) were used as primers to amplify the BVMO gene fragment encoding sgs3312. Correspondingly, the target gene can also be synthesized to obtain a DNA fragment with codon optimization but the same amino acid sequence to increase the expression of the target gene in a specific host.

[0073] High-fidelity DNA polymerase was used to prepare the reaction system according to the instructions of the kit. pET28a was used as a template and 28a-FW (CAGCAACCATTAATGACCTGCAGTCTCGAGCACCAC) and 28a-RV (GGAGTCGTCATCATGGCGCCCTGAAAATACAGGTTTTC) were used as primers for linear amplification of pET28a.

[0074] The target gene sgs3312 encoding gene fragment was connected to the linearized pET28a vector fragment using a seamless cloning kit to form an expression vector pET28a-sgs3312. The above expression vector was transformed into the Escherichia coli expression strain Escherichia coli BL21 (DE3) to obtain the expression strain BL21-sgs3312. The target gene sgs3312 expressed a protein with a histidine purification tag at the C-terminus, which could be purified and simply immobilized by a Ni-NTA affinity chromatography column.

[0075] Correspondingly, other target genes can also be cloned, overexpressed and purified by the above method.

[0076] Example 2 Transcriptomics data-guided novel enzyme discovery

[0077] New Baeyer-Villiger monooxygenases and naturally co-expressed esterases and alcohol dehydrogenases were obtained by transcriptome analysis and experimental verification of candidate enzymes. Specifically, H. roseonigra ATCC 20624 was usually cultured in yeast-malt medium (YMM) containing 3 g / L yeast extract, 3 g / L malt extract, 10 g / L glucose and 5 g / L tryptophan peptone (pH 6.2) at 24°C and 180 rpm on a rotary shaker. The composition of the basic salt medium (BSM) was as follows: 2.44 g / L KH2PO4, 14.04 g / L Na2HPO4·12H2O, 2 g / L NH4Cl, 0.2 g / L MgCl2·6H2O, 1 mg / L CaCl2·2H2O, 0.01 g / L yeast extract, 5 mL / L metal ion mixture and 0.2 mL / L vitamin mixture. The substrate sclareol was prepared as a 60 mM solution, consisting of 1.85 g sclareol, 16.25 mL Tween 80 and 83.75 mL deionized water. The biotransformation experiment used YMM medium, the substrate sclareol concentration was 15 mM, and static cell reactions were performed as the sole carbon source.

[0078] H. roseonigra cells were cultured in YMM medium until the logarithmic growth phase (approximately 48 hours) and harvested by centrifugation at 3420 g for 15 minutes at 20°C. The cell pellets were washed twice with sterile phosphate buffer (pH 6.2) to remove nutrients and then resuspended in BSM for use as biocatalysts. Biotransformation reactions were performed in 250 mL culture flasks, each containing 50 mL of the reaction mixture, inoculated with the cell suspension to a final OD600 of approximately 30. Biotransformation reactions were performed at 24°C on a rotary shaker at 180 rpm for 100 hours. Control groups were tested without inoculation or exogenous substrates, respectively, and other conditions were the same as those of the biotransformation experiments. No metabolites were detected in the control group. All experiments were repeated three times.

[0079] Cell growth (OD600) was measured by UV-visible spectrophotometer. Residual glucose in the fermentation broth was measured by biosensor analyzer. Clarified extracts were obtained by centrifugation at 16,060 g for 10 min and filtration with a 0.2 μm nylon syringe filter. Products and residual substrates were determined by GC-FID system with nitrogen as carrier gas at a flow rate of 2 mL / min. The sample volume was 1 μL, split mode (split ratio 20:1) was used, the injection port temperature was 250 °C, and the detector temperature was 320 °C. The column temperature program was: 80 °C for 1 min, heating to 280 °C at 20 °C / min, and holding at 280 °C for 2 min. Quantification was performed using the internal standard method with dibutyl phthalate as the internal standard. Analysis of metabolites during the biotransformation of sclareol was performed by using a GC-MS system. Electron impact (EI) ionization was applied with an energy of 70 eV and a scan range of m / z 50-550. The column temperature program was: 150 °C for 1 min, heating to 250 °C at 10 °C / min, and then kept at 250 °C for 8 min. The injection volume was 1 μL, the split ratio was 20:1, the carrier gas was nitrogen, and the flow rate was 2 mL / min. During the biotransformation process, the samples collected at 31 hours were analyzed on a high-precision mass GC / Q-TOF MS instrument equipped with a 7890B gas chromatograph. A HP-5MS column (30 m × 0.25 mm × 0.25 μm) was used to separate the different chemicals.

[0080] After GC-MS detection confirmed that sclareol was converted to sclarediol, RNA was extracted from Rhodotorula sclareol-fed and -unfed conditions using a total RNA extraction kit, frozen in liquid nitrogen for 0.5-1 h, and then stored at -80°C. Transcriptome sequencing and data analysis were performed. The expression level of each gene was calculated as the number of fragments per kilobase per million library size (FPKM). The H. roseonigra genome was sequenced by a third-party company combining an Illumina HiSeq 2500 sequencer and a PacBio RS II system. The ambiguous base N was replaced by PCR amplification using specifically designed PCR primers. Potential coding protein sequences (CDS) were predicted by Prodigal_v2.6.1 software. CDS annotation was based on the BLASTP program using the NR, COG, and KEGG databases. Single nucleotide variations (SNVs) and insertions and deletions (InDels) were identified by Mummer, Mauve, and BLASTP programs.

[0081] Compared with the unfed state, the highly expressed alcohol dehydrogenase, aldehyde dehydrogenase, BVMO and esterase induced in the fed state were listed as candidate enzymes, and the genes were cloned according to the method in Example 1, expressed and entered the screening stage according to the method in Example 3. The enzyme activity was further screened according to the substrate and reaction conditions in Example 4.

[0082] Example 3 Expression, induction, purification and analysis of key enzymes from Baeyer-Villiger monooxygenase, alcohol dehydrogenase, esterase, SHC enzyme or fusion proteins of key enzymes from Rhodotorula

[0083] Induction purification process:

[0084] (1) Inoculation: A single colony of the overexpressed protein stored in a -80°C freezer was inoculated into a test tube (3-5 mL) of LB medium containing 50 μg / mL kanamycin and 50 μg / mL chloramphenicol, and cultured overnight at 37°C on a shaker at 220 rpm.

[0085] (2) Transfer: The cells in the above LB medium were transferred (inoculation volume 1%) to a shake flask containing 50 mL of freshly sterilized LB medium containing 50 μg / mL kanamycin and 50 μg / mL chloramphenicol (to ensure good ventilation, the medium accounts for about 20% of the volume of the shake flask). The shaker speed was set at 220 rpm and the culture temperature was 37°C until the OD600 of the cells was about 0.6-0.8.

[0086] (3) Induction: Add 0.3 mM inducer IPTG (iso-n-propyl-β-D-thiogalactopyranoside) and induce at 18°C ​​and 160 rpm for 16 h.

[0087] (4) Harvesting bacteria: Take 50 mL of bacterial solution, centrifuge at 6000 rpm and 4°C for 5 min to collect the bacteria and discard the supernatant culture medium. Wash the bacteria with 20 mL of 1x PBS solution, centrifuge and discard the supernatant. Place the sample in an ice-water mixture to prevent protein denaturation.

[0088] (5) Ultrasonic disruption: Resuspend the bacteria in 5 mL of 1x PBS solution, pH 7.2 (PBS / bacteria = 8:1 V / M). Place the sample in an ice-water mixture and disrupt the bacterial cells using an ultrasonic disruptor (power ratio 30%, ultrasonic disruption for 5 s, stop for 5 s) for 10 min (after 5 min of disruption, place on ice, and then disrupt for another 5 min) until the bacterial solution becomes transparent.

[0089] (6) Sampling: Take 20 μL of the broken material and 4 μL of 5x loading buffer to a 200 μL centrifuge tube as the total protein sample; centrifuge the remaining broken material (12000 rpm, 4°C for 15 min), take 20 μL of the supernatant and add 4 μL of 5x loading buffer to a 200 μL centrifuge tube as the supernatant sample: remove the supernatant sample, resuspend the precipitate with 5 mL of PBS solution, take 20 μL of the resuspension and 4 μL of 5x loading buffer to a 200 μL centrifuge tube as the precipitate sample. The supernatant sample contains soluble protein, and the precipitate sample contains inclusion bodies. All samples were boiled at 99°C (PCR instrument) for 10 min until the protein was denatured.

[0090] (7) Preparation for electrophoresis: After cooling, the three groups of samples were centrifuged at 12,000 rpm for 10 minutes. 15 μL of each group was loaded for SDS-PAGE electrophoresis.

[0091] (8) Staining: Place in a staining and decolorizing apparatus for 10 minutes to develop color.

[0092] Example 4 Combination of Baeyer-Villiger monooxygenase and esterase from Rhodotorula to catalyze the conversion of farnesyl acetone to EE-homofarnesol

[0093] Using engineered bacteria as raw materials, take 5 mL of BVMO and 5 mL of esterase supernatant (each about 0.5 g bacterial equivalent), add 0.2 g of farnesyl acetone. Buffer system: 1x PBS, pH 7.2, 24°C, reaction time 10 h, until homofarnesol is observed. Figure 1As shown, farnesyl acetone was used as a substrate and incubated with the supernatant of the crude extract of Escherichia coli expressing the key enzyme under appropriate conditions, and the GC-MS chromatogram of the obtained product. Chemically synthesized EE-homofarnesol was used as a standard to verify that the enzyme catalytic system can cascade produce EE-homofarnesol. The Baeyer-Villiger monooxygenase from Rhodotorula catalyzed the conversion of farnesyl acetone to homofarnesol acetate, and the esterase from Rhodotorula catalyzed the deacetylation of homofarnesol acetate to obtain EE-homofarnesol. The substrate farnesyl acetone was completely converted under appropriate conditions.

[0094] The Baeyer-Villiger monooxygenase cofactor (BVMO-cofactor) is a cofactor that assists the BVMO enzyme during the catalytic reaction. The cofactor may be an inorganic molecule or an organic molecule. The BVMO-cofactor may be selected from nicotinamide adenine dinucleotide (NADH) and nicotinamide adenine dinucleotide phosphate (NADPH), or a combination thereof. Preferably, the BVMO-cofactor is present in the reaction mixture at a starting molar concentration relative to BVMO, e.g. the BVMO enzyme is saturated with NAD(P)H. Thus, preferably, the NAD(P)H is present in the reaction mixture at a concentration at least equal to the concentration of the BVMO enzyme.

[0095] In a specific embodiment, the cofactor regeneration system is an alcohol dehydrogenase (ADH) / isopropanol cofactor regeneration system. In another specific embodiment, the cofactor regeneration system is a glucose dehydrogenase (GDH) / glucose cofactor regeneration system. After using the above two cofactor regeneration systems, only a catalytic amount of cofactor needs to be added to the reaction system. Compared with the GDH / glucose system, the use of the ADH / isopropanol cofactor regeneration system has the advantage that the reaction medium will not be acidified.

[0096] When GDH is used as a cofactor circulation system, the preferred reaction conditions are: in the presence of 50 mM Tris-HCl buffer pH 8.5, 10 μM NADPH, 2 g / L GDH and 25 mM glucose (150 mL total volume), acetone is added as a cosolvent to 10% (v / v), and the engineered bacteria are used as raw materials. 50 mL of BVMO and 50 mL of esterase supernatant (each about 5 g bacterial equivalent) are reacted with 7.6 mM farnesyl acetone (2 g / L), and the conversion rate of farnesyl acetone is about 90% within 20 hours.

[0097] When ADH is used as a cofactor circulation system, the preferred reaction conditions are: in the presence of 50 mM Tris-Cl buffer pH 8.5, 10 μM NADPH, 0.5 g / L ADH, 35 mM isopropanol (150 mL total volume), using the engineered bacteria as raw materials, 50 mL BVMO and 50 mL esterase supernatant (each about 5 g bacterial equivalent) were reacted with 4 g / L farnesyl acetone (15.2 mM). The conversion rate of farnesyl acetone was about 90% within 20 hours.

[0098] Example 5: Using a fusion protein of Baeyer-Villiger monooxygenase and esterase to efficiently catalyze the conversion of farnesyl acetone to EE-homofarnesol

[0099] According to the preferred reaction conditions described in Example 4, a fusion protein of Baeyer-Villiger monooxygenase and esterase can be used, which is beneficial to simplify the production process and reduce production costs.

[0100] Specifically, the naturally occurring GDH of Escherichia coli was used as a cofactor circulation system. In the presence of 50 mM Tris-HCl buffer pH 8.5, 10 μM NADPH, and 25 mM glucose (150 mL total volume), acetone was added as a cosolvent to 10% (v / v). Using the engineered bacteria as the raw material, 50 mL of the fusion protein supernatant of Baeyer-Villiger monooxygenase and esterase (about 5 g of bacterial cell equivalent each) was reacted with 7.6 mM farnesyl acetone (2 g / L), and the conversion rate of farnesyl acetone was about 90% within 20 hours.

[0101] At the same time, the enzyme dosage screening results are as follows Figure 2 As shown, farnesyl acetone was used as a substrate and co-incubated with the supernatant of the crude extract of Escherichia coli expressing the fusion enzyme under appropriate conditions, and the gas-mass spectrometry chromatogram of the obtained product. Under the optimized reaction conditions, it was found that the conversion rate of farnesyl acetone was about 10% within 20 hours when 30 mL of the fusion protein supernatant of Bayer-Villiger monooxygenase and esterase was used; after using 50 mL of the fusion protein supernatant of Bayer-Villiger monooxygenase and esterase, the conversion rate of farnesyl acetone did not increase significantly within 20 hours when the enzyme dosage continued to increase.

[0102] Example 6 Comparison of specific enzyme forms in Baeyer-Villiger monooxygenase and esterase catalyzed reactions

[0103] Using engineered bacteria as raw materials, 5 mL of BVMO and 5 mL of esterase whole cells, the crushed crude extract and the crude extract supernatant (each about 0.5 g of bacterial cell equivalent) were taken, and 0.2 g of farnesyl acetone was added. In the reaction carried out in 50 mM Tris-HCL buffer pH 8.5 with 7.6 mM farnesyl acetone (2 g / L), 10 μM NADPH, 2 g / L BVMO, 2 g / L GDH and 25 mM glucose (5 mL, 30°C, 900 rpm), isopropanol was added to 10% (v / v). The production of homofarnesol was detected by GC-MS. Figure 3 As shown, when the substrate dosage is the same, the product generation amount of the supernatant of the Escherichia coli crude extract is greater than that of the Escherichia coli crude extract, and the product generation amount after cell disruption is much greater than that of the whole cell catalysis. It can be seen that the substrate farnesyl acetone may be difficult to enter the cell due to the unfavorable oil-water distribution coefficient. Therefore, the present invention adopts the in vitro biocatalysis method of enzyme crude extract, and no living cells participate in the conversion, bypassing the inability of the substrate to enter the cell or the growth inhibition of the substrate on the cell, and improving the practicality of this route on an industrial scale.

[0104] Example 7 Baeyer-Villiger monooxygenase, esterase, and SHC cyclase are used together in the presence of a cofactor recycling system to directly convert the substrate farnesyl acetone to ambroxol.

[0105] Using engineered bacteria as raw materials, 5 mL of BVMO and 5 mL of esterase crude extract supernatant (each about 0.5 g bacterial equivalent) were taken, and 5 mL of SHC enzyme reaction supernatant (about 0.5 g bacterial equivalent, buffer system 0.1 M citric acid, pH 5.5) was taken, and SDS was added to 0.06%. 0.2 g of farnesyl acetone was added. In the reaction carried out in 50 mM Tris-HCL buffer pH 8.5 with 7.6 mM farnesyl acetone (2 g / L), 10 μM NADPH, 2 g / L BVMO, 2 g / L GDH and 25 mM glucose, isopropanol was added to 10% (v / v). The reaction time was 10 h at 35 ° C and 180 rpm. The reaction product was detected by GC-MS, and ambroxol was observed.

[0106] The Baeyer-Villiger monooxygenase and esterase from Rhodotorula are in the form of supernatant of crude extract of Escherichia coli, and the SHC cyclase is in the form of crude extract of Escherichia coli, which ensures the hydrophobic environment required for the function of membrane-embedded proteins. Since the key enzymes of the catalytic system, Baeyer-Villiger monooxygenase, esterase, and SHC cyclase, are not cis-selective, when cis-farnesyl acetone isomers exist in the substrate, cis-homofarnesol intermediates can be produced, and after SHC enzyme cyclization, four optical isomers and / or isomers of Ambrox can be produced. As shown in the following formula:

[0107]

[0108] like Figure 4 As shown, Baeyer-Villiger monooxygenase, esterase, and SHC cyclase convert the substrate farnesyl acetone to Ambrox in the presence of a cofactor recycling system. The chromatographic peaks of the theoretical four isomers of Ambrox are marked with arrows. It can be seen that Ambrox is the absolute main product, which can be separated from the other three isomers by recrystallization to obtain optically pure Ambrox.

[0109] Example 8 Screening of Squalene-Hopaene Cyclase Mutants in Catalytic Systems

[0110] The squalene-hopaene cyclase mutant is obtained by subjecting the amino acid sequence of the original squalene-hopaene cyclase to the above-mentioned combined mutation, so that the amino acid and its related nucleotide sequence produce directional structural and functional changes, thereby obtaining an optimized SHC enzyme mutant adapted to the chemical-enzyme catalysis system of the present invention, which is helpful for industrial production, specifically:

[0111] The coding gene of the squalene-hopaene cyclase mutant and the expression vector pET28a(+) of Escherichia coli are connected by seamless cloning kit to obtain a recombinant plasmid containing the coding gene of the squalene-hopaene cyclase mutant. For example, in the embodiment of the present invention, one of the recombinant plasmids is represented as pET28a-SHC_M1. The recombinant plasmid pET28a-SHC_M1 is transformed into E.coli BL21(DE3) recipient bacteria, and coated on an LB agar plate containing kanamycin (mass concentration of 50 mg / L), and then cultured at 37°C for 12 hours to grow a single colony on the plate; a single colony is randomly selected and cloned, and then inoculated into LB liquid culture medium for 12 hours and the plasmid is extracted for sequencing. According to the sequencing results, the genetically engineered bacteria are screened out, which is represented as the positive clone E.coli BL21(DE3) / pET28a-SHC1.

[0112] The genetically engineered bacteria are inoculated into 4 mL of LB medium containing kanamycin at a mass concentration of 50 mg / L, and initially cultured for 12 hours at a temperature of 37° C. and a rotation speed of 200 r / min; the genetically engineered bacteria of the initial culture are inoculated into 30 mL of a new TB medium containing kanamycin at a mass concentration of 50 mg / L at an inoculum amount of 1 vt.%, and cultured to an optical density (OD600) of 0.6-0.8 at a temperature of 37° C. and a rotation speed of 200 r / min; then isopropyl-β-D-thiogalactopyranoside (IPTG) inducer is added to a final concentration of 0.1 mM, and induced culture is performed for 16 hours at a temperature of 18° C. and a rotation speed of 200 r / min; finally, the bacteria are centrifuged at 5000×g for 5 minutes and the bacteria are collected, resuspended and washed with a Tris-SO4 buffer solution with a pH of 7.0, and centrifuged at 13000×g for 1 minute, the wet bacteria are collected, and stored at -20°C for later use.

[0113] Using engineered bacteria as raw materials, 5 mL of BVMO and 5 mL of esterase crude extract supernatant (each about 0.5 g bacterial equivalent) were taken, and 5 mL of SHC enzyme reaction supernatant (about 0.5 g bacterial equivalent, buffer system 0.1 M citric acid, pH 5.5) was taken, and SDS was added to 0.06%. 0.2 g of farnesyl acetone was added. In the reaction carried out in 50 mM Tris-HCL buffer pH 8.5 with 7.6 mM farnesyl acetone (2 g / L), 10 μM NADPH, 2 g / L BVMO, 2 g / L GDH and 25 mM glucose, isopropanol was added to 10% (v / v). The reaction time was 10 h at 35 ° C and 180 rpm. The reaction product was detected by GC-MS, and ambroxol was observed. During the oscillation reaction, 0.2 mL of the sample was sampled at regular intervals, and 0.8 mL of n-hexane:isopropanol (v:v=2:1) ​​was added to the sample for extraction, and then analyzed and detected by GC-FID.

[0114] In the embodiment of the present application, the content of the product was analyzed by gas chromatography, and the experimental conditions specifically included: the chromatographic column was 30 mm × 0.32 mm × 0.25 mm; the carrier gas was nitrogen, and the temperature of the detector was 250° C. The temperature was increased from 100° C. to 200° C. at a rate of 15° C. / min, and from 200° C. to 240° C. at a rate of 120° C. / min, and the column temperature was maintained at 240° C. for 4 minutes.

[0115] Figure 5 This is a comparison chart of the enzyme activity and catalytic yield of the original enzyme and mutant of squalene-hopaene cyclase provided in the embodiment of the present invention. Under the same reaction conditions, substrate concentration and enzyme dosage, the enzyme activity quantification method is the mean + standard deviation of the product peak area, and all results are three biological parallel experiments. The red box marks the mutant whose specific activity is better than the starting enzyme wt in a single experiment.

[0116] As can be seen from the figure, the specific activity of the genetically engineered bacteria catalyzed by some squalene-hopaene cyclase mutants is 0.5 times that of the original squalene-hopaene cyclase, and the squalene-hopaene cyclase mutants contained in the genetically engineered bacteria have high specific activity. And because the evaluation of the specific activity of squalene-hopaene cyclase is carried out in the specific catalytic system described in the present invention, such as a certain pH, temperature, buffer system, and cofactor concentration range, an optimized SHC enzyme mutant adapted to the chemical-enzyme catalytic system of the present invention can be obtained.

[0117] Example 9 Coupling of nerolidol distillation and farnesyl acetone chemical synthesis

[0118] Add 22.2g (0.1mol) of crude nerolidol extract and 0.2g (0.01mol) of aluminum isopropoxide to a 500mL round-bottom flask equipped with a fractionating column, add triphenylphosphine palladium (0.005mol, 5mol%), heat the reaction system at 55 degrees under nitrogen protection, and begin to drop 14.3g (0.11mol) of ethyl acetoacetate. Maintain the reaction temperature at 130°C during the dropwise addition process. Low-boiling substances evaporate during the reaction. After the dropwise addition is completed, keep the system temperature at 55°C for 2h until CO2 is released. Add an equal volume of water to quench the reaction, extract with ethyl acetate, and the crude product is directly used for analysis or the next reaction. Connect to a reduced pressure distillation apparatus, collect 166-168°C, 333 kPa, yield 93%, refractive index (20°C): 1.4813. 300 MHz 13C-NMR (CDCL3): δ (ppm, TMS) = 208.8, 136.4, 135.0, 131.3, 124.4, 124.0, 122.5, 43.8, 39.7, 39.6, 29.9, 26.8, 26.5, 25.5, 22.5, 17.7, 16.0.

[0119] Example 10: Synthesis of Ambroxan using a chemical-enzymatic method using biosynthesized nerolidol as a raw material

[0120] The chemical-enzymatic synthesis route of Ambrox described in the present invention is as follows Figure 6As shown, this technical route starts from the biosynthetic terpenoid compound trans-nerolidol, and first synthesizes farnesyl acetone through a simple one-step chemical transformation carroll rearrangement. A new multi-enzyme cascade in vitro catalytic system is used to directly obtain the final product Ambrox without separating the reaction intermediates in a "one-pot method". Among them, the Baeyer-Villiger monooxygenase from red silk yeast catalyzes the conversion of farnesyl acetone into homofarnesol acetate, and the esterase from red silk yeast catalyzes the deacetylation of homofarnesol acetate to obtain EE-homofarnesol as a substrate for the cyclization reaction mediated by squalene and hopene cyclase (SHC). The invention also uses SHC mutants, which enhance the catalytic activity and compatibility with the catalytic system on the basis of existing solutions, ensuring a high conversion rate of the substrate in the catalytic system.

[0121] Specifically, starting from the crude extract of biosynthesized nerolidol, according to the method of Example 8, the distillation of nerolidol is coupled with the chemical synthesis of farnesyl acetone to obtain farnesyl acetone in one step. Then, using this as a substrate, according to the method of Example 3, the key enzymes required for the catalytic system, such as Baeyer-Villiger monooxygenase, alcohol dehydrogenase, esterase, SHC enzyme or fusion protein of key enzymes from Rhodotorula, are synthesized in one pot using the chemical-enzymatic method with farnesyl acetone as a raw material according to the method of Example 7. Preferably, according to the method described in Example 8, a squalene-hopaene cyclase mutant that is more compatible with the catalytic system can be screened out, and the mutant has a higher specific activity, which is helpful for industrial production.

[0122] Example 11 Baeyer-Villiger monooxygenase from Rhodotorula catalyzes the conversion of methylheptenone to methyl-3-penten-1-ol

[0123] Using GDH as a cofactor circulation system, the substrate spectrum of the Baeyer-Villiger monooxygenase from Rhodotorula was tested under the preferred reaction conditions: in the presence of 50 mM Tris-HCl buffer pH 8.5, 10 μM NADPH, 2 g / L GDH and 25 mM glucose (150 mL total volume), acetone was added as a cosolvent to 10% (v / v), and the engineered bacteria were used as raw materials. 50 mL of BVMO (about 5 g bacterial equivalent) was reacted with 7.6 mM methylheptenone. After 20 hours, Baeyer-Villiger oxidation and spontaneous ester hydrolysis products, methyl-3-penten-1-ol, were observed, and the conversion rate of methylheptenone was about 99%. Figure 7 As shown, methyl heptenone was used as a substrate and co-incubated with the supernatant of a crude extract of Escherichia coli expressing BVMO under appropriate conditions. The gas chromatography-mass spectrometry chromatogram of the obtained product, in which the arrow in the mass spectrum indicates the molecular ion peak.

[0124] Example 12 Baeyer-Villiger monooxygenase from Rhodotorula catalyzes the conversion of trans-geranylacetone to 4,8-dimethylnona-3,7-dien-1-ol acetate and 4,8-dimethylnona-3,7-dien-1-ol

[0125] Using GDH as a cofactor circulation system, the substrate spectrum of the Baeyer-Villiger monooxygenase from Rhodotorula was tested under the preferred reaction conditions: in the presence of 50 mM Tris-HCl buffer pH 8.5, 10 μM NADPH, 2 g / L GDH and 25 mM glucose (150 mL total volume), acetone was added as a cosolvent to 10% (v / v), and the engineered bacteria were used as raw materials. 50 mL of BVMO (about 5 g bacterial equivalent) was taken and reacted with 7.6 mM trans-geranylacetone. After 20 hours, the Baeyer-Villiger oxidation product 4,8-dimethylnona-3,7-dien-1-ol acetate and the spontaneous ester hydrolysis product 4,8-dimethylnona-3,7-dien-1-ol were observed, and the conversion rate of trans-geranylacetone was about 86%. Figure 8 As shown, trans-geranylacetone was used as a substrate and co-incubated with the supernatant of a crude extract of Escherichia coli expressing BVMO under appropriate conditions. The gas chromatography-mass spectrometry chromatogram of the obtained product, in which the arrow in the mass spectrum indicates the molecular ion peak.

[0126] The above embodiments are only exemplary and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention.

Claims

1. A Baeyer-Villiger monooxygenase and its naturally co-expressed esterase and alcohol dehydrogenase, characterized in that: The amino acid sequence of the Baeyer-Villiger monooxygenase is shown in SEQ ID NO:3, the amino acid sequence of the esterase is shown in SEQ ID NO:4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:

7.

2. A fusion protein, characterized in that: A Baeyer-Villiger monooxygenase and an alcohol dehydrogenase, or a Baeyer-Villiger monooxygenase and an esterase, using a flexible linker pair are fused, the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3, the amino acid sequence of the esterase is selected from one of SEQ ID NOs: 4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:

7.

3. The fusion protein according to claim 2, characterized in that The amino acid sequence of the Baeyer-Villiger monooxygenase and alcohol dehydrogenase fusion protein is shown in SEQ ID NOs: 18-19, and the amino acid sequence of the Baeyer-Villiger monooxygenase and esterase fusion protein is shown in SEQ ID NOs: 20-21.

4. A method for converting farnesyl acetone into EE-homofarnesol, characterized in that The method comprises the following steps: Step 1: in the presence of a cofactor, Baeyer-Villiger monooxygenase catalyzes the conversion of farnesyl acetone into homofarnesol acetate, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3; Step 2: Esterase catalyzes the deacetylation of homofarnesol acetate to obtain EE-homofarnesol, and the amino acid sequence of the esterase is selected from one of SEQ ID NOs: 4-6.

5. The method for converting farnesyl acetone into EE-homofarnesol according to claim 4, characterized in that: The specific form of the Baeyer-Villiger monooxygenase and esterase is the supernatant of crude extract of Escherichia coli.

6. The method for converting farnesyl acetone into EE-homofarnesol according to claim 4, characterized in that: The cofactor is selected from NADH and NADPH or a combination thereof.

7. The method for converting farnesyl acetone into EE-homofarnesol according to claim 6, characterized in that: The method includes a cofactor regeneration system.

8. The method for converting farnesyl acetone into EE-homofarnesol according to claim 7, characterized in that: The cofactor regeneration system is an alcohol dehydrogenase / isopropanol cofactor regeneration system, and the amino acid sequence of alcohol dehydrogenase is shown in SEQ ID NO:

7.

9. A method for converting farnesyl acetone into EE-homofarnesol, characterized in that The method comprises the following steps: in the presence of a cofactor, using one of the fusion proteins of the Baeyer-Villiger monooxygenase and esterase according to claim 3 to catalyze the conversion of farnesyl acetone into EE-homofarnesol.

10. A method for converting farnesyl acetone into Ambrox, characterized in that: The method comprises the following steps: Step 1: in the presence of a cofactor, Baeyer-Villiger monooxygenase catalyzes the conversion of farnesyl acetone into homofarnesol acetate, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3; Step 2: esterase catalyzes the deacetylation of homofarnesol acetate to obtain EE-homofarnesol, wherein the amino acid sequence of the esterase is selected from one of SEQ ID NOs: 4-6; Step 3: Enzymatically converting EE-homofarnesol into Ambrox using a squalene-hopaene cyclase mutant, wherein the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NOs: 8-17.

11. A coding gene, characterized in that The gene encodes the Baeyer-Villiger monooxygenase gene according to claim 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

24.

12. A coding gene, characterized in that The gene encodes the esterase according to claim 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO: 25-27.

13. A coding gene, characterized in that The gene encodes the alcohol dehydrogenase according to claim 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

28.

14. A coding gene, characterized in that The gene encodes the Baeyer-Villiger monooxygenase and the co-expressed alcohol dehydrogenase fusion protein according to claim 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO: 39-40.

15. A coding gene, characterized in that The gene encodes the fusion protein of Baeyer-Villiger monooxygenase and esterase according to claim 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO: 41-42.

16. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene encoding the Baeyer-Villiger monooxygenase according to claim 11, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:

45.

17. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene encoding the esterase according to claim 12, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs: 46-48.

18. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene encoding the alcohol dehydrogenase according to claim 13, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:

49.

19. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene encoding the Baeyer-Villiger monooxygenase and the co-expressed alcohol dehydrogenase fusion protein according to claim 14, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NOs: 60-61.

20. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene encoding the fusion protein of Baeyer-Villiger monooxygenase and esterase as claimed in claim 15, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO: 62-63.

21. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria comprises the recombinant plasmid according to any one of claims 16 to 20.

22. Use of the genetically engineered bacteria of claim 21 in converting a linear polyunsaturated branched-chain ketone substrate into the corresponding acetate and an alcohol with a carbon chain shortened by two carbon atoms, and performing enzymatic cyclization using squalene-hopaene cyclase to synthesize terpene-derived compounds containing a non-classical number of carbon atoms.

23. The use according to claim 22, characterized in that The linear polyunsaturated branched-chain ketone is farnesyl acetone, and the terpene-derived compound containing a non-classical number of carbon atoms is Ambrox.

24. A method for converting nerolidol into ambrox, characterized in that: The method comprises the following steps: Step 1: Starting from trans-nerolidol, a carroll rearrangement reaction is performed to synthesize farnesyl acetone, and nerolidol distillation is coupled with chemical synthesis of farnesyl acetone; Step 2: in the presence of a cofactor, Baeyer-Villiger monooxygenase catalyzes the conversion of farnesyl acetone into homofarnesol acetate, wherein the amino acid sequence of the Baeyer-Villiger monooxygenase is selected from one of SEQ ID NOs: 1-3; Step 3: esterase catalyzes the deacetylation of homofarnesol acetate to obtain EE-homofarnesol, wherein the amino acid sequence of the esterase is selected from one of SEQ ID NOs: 4-6; Step 4: Enzymatically converting EE-homofarnesol into Ambrox using a squalene-hopaene cyclase mutant, wherein the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NOs: 8-17.

Images