SgRNA for efficient cytosine base editing of sheep SOCS2 gene and application thereof

By using cytosine base editing technology combining sgRNA-S1 with the CBE system, a stop codon was introduced into the sheep SOCS2 gene, solving the problem of low editing efficiency in existing technologies and achieving efficient editing and significant improvement in sheep growth performance.

CN119876151BActive Publication Date: 2026-03-24JIANGSU ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510133129.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-06
Publication Date
2026-03-24
Estimated Expiration
2045-02-06

AI Technical Summary

Technical Problem

Current technologies have low base editing efficiency for the sheep SOCS2 gene, making it difficult to achieve efficient knockout and affecting the improvement of sheep growth performance.

Method used

By combining sgRNA-S1 with the CBE system, including a fusion protein containing Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear translocation signal, a stop codon was introduced into the sheep SOCS2 gene using cytosine base editing technology, achieving efficient editing.

Benefits of technology

The editing efficiency of the SOCS2 gene in sheep was improved to over 85%, and the resulting edited sheep had a higher body weight than the wild type, significantly improving sheep growth performance and providing technical support for the creation of new fast-growing meat sheep breeds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876151B_ABST
    Figure CN119876151B_ABST
Patent Text Reader

Abstract

The present application relates to the field of genetic engineering and animal genetics and breeding, in particular to a sgRNA for efficient cytosine base editing (CBE) of sheep SOCS2 gene and application thereof. The efficiency of cytosine base editing of SOCS2 gene of sheep fibroblast cells by sgRNA-S1 provided by the present application is as high as 85%; the efficiency of cytosine base editing of sheep embryos by sgRNA-S1 provided by the present application is as high as 80%, and SOCS2 gene edited sheep is obtained. The present application generates C to T mutation at the second exon of SOCS2 gene by cytosine base editing, introduces a stop codon, and prematurely terminates SOCS2 protein translation, thereby achieving efficient knock-out of SOCS2 gene and creating SOCS2 gene base edited sheep, which provides technical support for creating new germplasm of fast-growing mutton sheep and provides a new approach for creating new sheep breeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and animal husbandry genetics and breeding, and in particular to an sgRNA for efficient cytosine base editing of the sheep SOCS2 gene and its applications. Background Technology

[0002] The suppressor of cytokine signaling 2 (SOCS2) is a member of the SOCS family and participates in the regulation of various physiological and pathological processes, including growth, metabolism, bone formation, and immunity. SOCS proteins share a similar structure, including an N-terminal extended SH2 domain (ESS), followed by a central Src homology 2 (SH2) domain that recognizes target sequences (pY), and a C-terminal SOCS box that interacts with the ElonginB / C adapter complex (EloB / C). All SOCS proteins can bind to EloBC and specifically recruit Cullin5 to form different SOCS EloB / C-Cullin5-Rbx2 (CRL5SOCS) E3 ligases, catalyzing ubiquitin transfer and proteasomal degradation of specific substrates, thereby participating in the regulation of various biological processes. Studies have found that the SH2 domain and SOCS box in the SOCS2 gene are essential for the SOCS2 protein to act as an E3 ligase catalyzing ubiquitin transfer and the degradation of specific substrates by the proteasome. If the leucine at position 163 of the SOCS box in the SOCS2 gene is mutated to proline, the cysteine ​​at position 167 is mutated to phenylalanine, or the SOCS box is knocked out, the SOCS2 protein cannot interact with ElonginB / C, thus losing its function of regulating GHR through ubiquitination. Chen et al. found that the SH2 domain in the SOCS2 protein specifically recognizes the N-terminal domain of SLC7A11. The SOCS box forms a complex with EloB / C, recruiting ubiquitin molecules and specifically inducing ubiquitination of the SLC7A11 protein, ultimately leading to HCC ferroptosis and radiosensitization (Chen et al., 2022).

[0003] In mice, SOCS2 gene-deficient mice showed a 30-40% increase in growth, with proportional increases in the size of various organs (including muscle and skeletal muscle length). Furthermore, SOCS2 gene-deficient mice exhibited longer femurs, tibias, and humeri, along with increased bone mass. In sheep, studies have shown that the C / T mutation in the SOCS2 gene causes a mutation at position 96 of the SOCS2 protein, replacing arginine with cysteine, altering the protein's three-dimensional structure and affecting sheep growth performance. Weaned lambs carrying the T mutation had higher body weight than wild-type lambs, and significantly increased body height, width, and tibia length (Rupp et al., 2015).

[0004] Cytosine base editing (CBE) can produce C→T or G→A transitions, thus converting CAG, CAA, and CGA into stop codons, thereby prematurely terminating gene translation and achieving gene knockout. Yao et al. (2021) used AncBE4max to edit the MSTN gene in Kazakh sheep fetal fibroblasts, achieving a maximum editing efficiency of 26.7%. Xu et al. (2022) used BE4-Gam to induce FecGH (p.S395F) editing of the GDF9 gene, increasing lambing performance in sheep with an editing efficiency of 16.3%. These results demonstrate that base editing can improve sheep growth and reproductive traits, thereby increasing economic benefits.

[0005] Currently, in the research on SOCS2 gene base editing, only Zhou et al. used the BE3 system to generate the p.R96C mutation of the SOCS2 gene in Tan sheep. The mutant sheep gained weight significantly faster than the wild type, but the editing efficiency was low, only 25.0%. Summary of the Invention

[0006] The purpose of this invention is to provide an sgRNA for efficient cytosine base editing of the SOCS2 gene in sheep and its application, thereby addressing the problems existing in the prior art. The sgRNA provided by this invention can improve the base editing efficiency of the SOCS2 gene in sheep, achieving efficient knockout of the SOCS2 gene. The resulting edited sheep have a higher body weight than wild-type sheep, providing technical support for the efficient creation of fast-growing meat sheep breeds through SOCS2 gene editing.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides an efficient sgRNA-S1 for editing the sheep SOCS2 gene, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0009] The present invention provides DNA encoding the above-mentioned sgRNA1-S1, the DNA and nucleotide sequence of which are shown in SEQ ID NO.7.

[0010] This invention provides a biomaterial containing the aforementioned DNA.

[0011] Preferably, the biomaterial includes a recombinant expression vector or expression cassette.

[0012] This invention provides a composition for efficiently editing the sheep SOCS2 gene. The composition comprises an sgRNA-S1 system and a CBE system. The sgRNA system comprises the aforementioned sgRNA-S1 or the aforementioned biological material. The CBE system comprises a fusion protein consisting of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal, biological material expressing the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal, or mRNA expressing the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal; the biological material comprises a recombinant expression vector or expression cassette.

[0013] The present invention provides the use of the above-described sgRNA-S1, the above-described DNA, the above-described biological material, or the above-described composition in any of the following:

[0014] (1) Prepare products for sheep SOCS2 gene editing;

[0015] (2) Preparation of SOCS2 gene-edited sheep;

[0016] (3) Sheep molecular breeding.

[0017] This invention provides a method for efficiently editing the sheep SOCS2 gene, the method comprising any one of method (a), method (b), and method (c);

[0018] The method (a) includes the following steps: introducing biological materials expressing sgRNA-S1 and biological materials expressing fusion proteins into sheep cells to edit the sheep SOCS2 gene; the biological materials include recombinant expression vectors or expression cassettes;

[0019] Method (b) includes the following steps: introducing sgRNA-S1 and the fusion protein into sheep cells to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into sheep cells to edit the sheep SOCS2 gene;

[0020] The method (c) includes the following steps: introducing sgRNA-S1 and the fusion protein into a sheep embryo to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into a sheep embryo to edit the sheep SOCS2 gene;

[0021] The fusion protein consists of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal; the nucleotide sequence of the sgRNA-S1 is shown in SEQ ID NO.5.

[0022] Preferably, in methods (b) and (c), the mass ratio of sgRNA-S1 to the fusion protein expressing Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal is 1:2, and the mass ratio of sgRNA-S1 to the mRNA expressing the fusion protein expressing Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal is 1:2.

[0023] The present invention discloses the following technical effects:

[0024] 1. The SOCS2 gene in sheep fibroblasts was edited using the sgRNA-S1 cytosine bases provided by this invention, achieving an efficiency of up to 85%. Sheep fibroblasts were co-transformed with the recombinant vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1 and the CBE vector. After one week of puromycin screening, single clones were selected. Detection revealed that 85% of the single clones showed editing at the target site, indicating an editing efficiency of 85%, significantly improving the editing efficiency.

[0025] 2. Using the sgRNA-S1 cytosine base editing provided by this invention, SOCS2 gene-edited sheep with increased body weight were obtained, with an editing efficiency of up to 80%. The high editing efficiency (up to 80%) of sgRNA-S1-based sheep production, coupled with their higher body weight compared to wild-type sheep, is of great significance for reducing the cost of SOCS2 gene-edited sheep production and rapidly cultivating new fast-growing meat sheep breeds.

[0026] 3. This invention can also be used for the study of the function of the sheep SOCS2 gene.

[0027] In summary, this invention uses cytosine base editing to generate a C-to-T mutation at the second exon of the SOCS2 gene, introducing a stop codon to prematurely terminate the translation of the SOCS2 protein, thereby achieving efficient knockout of the SOCS2 gene and creating SOCS2 gene-edited sheep. This provides technical support for the creation of new fast-growing meat sheep breeds and offers a new approach to the creation of new sheep breeds. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 This is a sequencing peak diagram showing the SOCS2 gene editing type in a single clone cell line; the arrows indicate the bases that were edited; SOCS2 - / - Cell lines representing homozygous editing of the SOCS2 gene; SOCS2 + / - Cell lines representing heterozygous editing of the SOCS2 gene; SOCS2 + / + Represents a wild-type cell line with the SOCS2 gene;

[0030] Figure 2 Sequencing peaks for the editing type in newborn SOCS2 gene-edited lambs; where the arrows indicate the bases that were edited; SOCS2 - / - Lake sheep representing homozygous SOCS2 gene editing; SOCS2 + / - Lake sheep representing heterozygous editing of the SOCS2 gene; SOCS2 + / + Represents wild-type Hu sheep with the SOCS2 gene;

[0031] Figure 3 The results show the SOCS2 protein expression levels in the hindquarters of Hu sheep with different SOCS2 gene editing types; where WT represents the hindquarters muscle sample from wild-type Hu sheep with the SOCS2 gene; SOCS2 - / - and SOCS2 + / - These represent samples of the hindquarter muscle from sheep that underwent SOCS2 homozygous and heterozygous editing, respectively.

[0032] Figure 4 Comparison of growth performance between the SOCS2 gene-edited Hu sheep group and the control Hu sheep group. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] Example 1: Preparation of sgRNA-S1 and CBE system mRNA of SOCS2 gene in sheep cells and embryos

[0039] 1. Construction of sgRNA expression vector

[0040] The sheep SOCS2 gene sequence (Gene ID: 101115017) was used as the target sequence to design oligonucleotide DNA sequences, which were then sent to a commercial primer synthesis company for synthesis (approximately 1 OD per sequence, purified by PAGE). The specific sequences are as follows:

[0041] Sg-S1 F: accgAGAGCCAGTGGGGGACCGCG, SEQ ID NO.1;

[0042] Sg-S1 R: aaacCGCGGTCCCCCACTGGCTCT, SEQ ID NO.2;

[0043] The two oligo DNA fragments were dissolved in ultrapure water, mixed and annealed to form a double-stranded DNA fragment sg-S1-F / R with sticky ends containing BsaI restriction sites.

[0044] The double-stranded DNA fragment sg-S1-F / R and the BsaI-digested pGL3-U6-sgRNA-PGK-puromycin (provided by addgene) linear plasmid were ligated and transformed to obtain the recombinant vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1. The inserted fragment was fused with the fragment on the vector to express sgRNA-S1.

[0045] 2. In vitro transcription of mRNA in sgRNA-S1 and CBE systems

[0046] Using the recombinant vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1 as a template, primers sg-S1-TF (sequence: TAATACGACTCACTATAGAGAGCCAGTGGGGGACCGCG, SEQ ID NO.3) and sgRNA-R primers (sequence: AAAAGCACCGACTCGGTGCCA, SEQ ID NO.4) with a 5' T7 promoter were designed and synthesized for PCR amplification and gel purification to obtain an sgRNA-S1 in vitro transcription template containing the T7 promoter. 200 ng of the recovered in vitro transcription template was then used according to an in vitro transcription kit (Ambion, MEGA shortscript). TM The sgRNA-S1 was transcribed in vitro according to the instructions of the T7 Transcription Kit to obtain sgRNA-S1. The nucleotide sequence of sgRNA-S1 is: 5'- agagccagugggggaccgcg The target sequence of the sgRNA is 5'-agagccagtgggggaccgcg-3' (SEQ ID NO. 6), which is the sequence of sheep SOCS2 gene (Gene ID: 101115017) from 1938 to 1957 nt. The DNA encoding this sgRNA has the nucleotide sequence shown in SEQ ID NO. 7, specifically: 5'- agagccagtgggggaccgcg gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3'. The underlined sequence is the target fragment identified by sg-S1 above, which is the sequence of sheep SOCS2 gene (Gene ID: 101115017) 1938-1957nt.

[0047] Using the AncBE4max plasmid (provided by addgene) as a template, primers AncBE4max-F (sequence: 5'-TAATACGACTCACTATAGGGAGAG-3', SEQ ID NO. 8) and AncBE4max-R (sequence: 5'-CGGTTAGACTTTCCTCTTCTT-3', SEQ ID NO. 9) containing a T7 promoter at the 5' end were designed and synthesized for PCR amplification and gel purification to obtain an in vitro transcription template containing the fusion of multiple genes including Cas9, cytosine deaminase, uracil glycosidase inhibitor, and nuclear translocation signal in AncBE4max. 1000 ng of the purified in vitro transcription template was then used according to an in vitro transcription kit (Ambion, mMESSAGE mMACHINE). TM In vitro transcription was performed according to the instructions of the T7 ULTRA Transcription Kit to obtain mRNA containing multiple genes fused together, including Cas9, cytosine deaminase, uracil glycosidase inhibitor, and nuclear translocation signal, from the AncBE4max plasmid.

[0048] Example 2: Application of sgRNA-S1 in editing the SOCS2 gene in sheep fibroblast cell line

[0049] 1. Transfection of sheep fibroblasts

[0050] The sgRNA-S1 expression vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1 and the AncBE4max plasmid were co-transfected into sheep fibroblasts by electroporation. The electroporated cells were seeded into 6-well cell culture plates. After 6 hours, the medium was changed. When the cell density reached about 80%, purine toxin was added for drug screening. After 3 days of drug screening, the cells were digested with trypsin, and a portion was harvested to extract DNA. The remaining cells were then screened for drug screening again.

[0051] 2. DNA extraction and PCR detection from transfected fibroblasts

[0052] DNA was extracted from a subset of cells obtained in step 1 using the conventional phenol / chloroform method. PCR was performed using primers (SOCS2-F: GTAACTGGATGCTCGGGGTT, SEQ ID NO.10; SOCS2-R: GGAGTCCCTCAGGAACCACT, SEQ ID NO.11) to amplify a portion (1523-2203 nt) of the SOCS2 gene (Gene ID: 101115017) in sheep fibroblasts, with an expected amplification length of 681 bp. The PCR amplified bands were cut, recovered, and sequenced by Sanger sequencing. The results showed that pGL3-U6-sgRNA-PGK-puromycin-sg-S1 and AncBE4max could achieve base editing of the sheep SOCS2 gene in sheep fibroblasts.

[0053] 3. Screening of monoclonal cell lines

[0054] The mixed cell populations identified as editing-positive in step 2 were further screened with puromycin for 4 days. After screening, the cells were digested and counted. The cells were then evenly seeded into 6-well cell culture plates at a ratio of 100 cells / well. Once clones were formed, the monoclonal cell clusters were separated using clonal cyclic trypsin digestion and transferred to 96-well cell culture plates. When the cell confluence reached about 90%, the cells were gradually transferred to 48-well and 12-well cell culture plates for expansion culture until they reached confluence in 6-well cell culture plates. A portion of the cells were frozen, and a small portion was used for DNA extraction and identification of the editing type.

[0055] 4. Identification of editing types in monoclonal cell lines

[0056] DNA was extracted from the monoclonal cell clusters using the method described in step 2. PCR amplification was performed using the aforementioned SOCS2-F and SOCS2-R primer pairs to identify the editing type of the monoclonal cell clusters. A total of 20 monoclonal cell lines were obtained. Identification revealed that 4 lines were homozygous SOCS2 gene editing cells, 13 lines were heterozygous SOCS2 gene editing cells, and the remaining 3 lines did not show any editing. Figure 1 The editing efficiency is 85%, of which the efficiency of pure syntactic editing is 20%.

[0057] Example 3: Application of sgRNA-S1 in editing the SOCS2 gene in Hu sheep

[0058] 1. Superovulation and microinjection in Hu sheep

[0059] Following the method described by Guo et al. (2023), superovulation and estrus synchronization were performed on three donor ewes using oviduct flushing. Fertilized oocytes were injected cytoplasm with a mixture of sgRNA-S1 (SEQ ID NO.5) and a multi-gene fusion mRNA containing Cas9, cytosine deaminase, uracil glycosidase inhibitor, and nuclear signaling genes from AncBE4max (the final concentration of each substance in the mixture was 50 ng / μL sgRNA-S1 and 100 ng / μL AncBE4max mRNA, i.e., Cas9, cytosine deaminase, uracil glycosidase inhibitor, and nuclear signaling genes from AncBE4max). The amount of mixture injected into each embryo was approximately 5 pL. After injection, the embryos were cultured in G-1plus medium for 1 hour. Twenty-six well-developed embryos were selected and transferred to the oviducts of six recipient ewes in estrus synchronization. The lambs born five months later were identified.

[0060] 2. Genome extraction from newborn lambs

[0061] Four recipient ewes successfully conceived and gave birth to a total of five lambs. Ear tissue was collected from the lambs two weeks after birth, and DNA was extracted using the standard phenol / chloroform method.

[0062] 3. PCR detection

[0063] Using DNA from five lambs as templates, PCR reactions were performed using primers (SOCS2-F and SOCS2-R primers) for detecting monoclonal sheep fibroblast cell lines to identify the editing efficiency of the target sites.

[0064] Sequencing of PCR amplification products revealed that 4 out of 5 lambs underwent editing at the target site, while 1 did not, resulting in an editing efficiency of 80%. Of the 4 edited lambs, 1 underwent heterozygous editing, and 3 underwent homozygous editing at the target site. Figure 2 ).

[0065] 4. SOCS2 gene-edited sheep protein expression detection

[0066] To investigate protein expression in SOCS2 gene-edited Hu sheep, hindquarter muscle tissue was surgically collected from both SOCS2 gene-edited and wild-type Hu sheep, and Western blotting was used for identification. The results are as follows: Figure 3 As shown. The results indicate that SOCS2 - / - SOCS2 protein was knocked out in all Hu sheep. + / - SOCS2 protein expression was reduced in Hu sheep.

[0067] 5. Weight analysis of SOCS2 gene-edited sheep

[0068] To analyze the body weight of SOCS2 gene-edited sheep, the birth weight, 2-month-old, 4-month-old, and 6-month-old body weights of all SOCS2 gene-edited Hu sheep (referred to as the SOCS2 gene-edited Hu sheep group) and wild-type Hu sheep (referred to as the control Hu sheep group) were statistically analyzed. The results are as follows: Figure 4 As shown in the figure. The results showed that the birth weight, 2-month-old weight, 4-month-old weight, and 6-month-old weight of SOCS2 gene-edited sheep were all higher than those of wild-type sheep.

[0069] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Use of the composition in any of the following: (1) Prepare products for sheep SOCS2 gene editing; (2) Preparation of SOCS2 gene-edited sheep; (3) Sheep molecular breeding; The composition comprises an sgRNA-S1 system and a cytosine base editing system, wherein the sgRNA system comprises the sgRNA-S1 or biological material containing sgRNA-S1; the nucleotide sequence of the sgRNA-S1 is shown in SEQ ID NO. 5; the cytosine base editing system comprises a fusion protein consisting of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal, biological material expressing the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal, or mRNA expressing the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal; the biological material comprises a recombinant expression vector or expression cassette.

2. A method for editing the sheep SOCS2 gene, characterized in that, The method includes any one of method (a), method (b), and method (c); The method (a) includes the following steps: introducing biological materials expressing sgRNA-S1 and biological materials expressing fusion proteins into sheep cells to edit the sheep SOCS2 gene; the biological materials include recombinant expression vectors or expression cassettes; Method (b) includes the following steps: introducing sgRNA-S1 and the fusion protein into sheep cells to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into sheep cells to edit the sheep SOCS2 gene; The method (c) includes the following steps: introducing sgRNA-S1 and the fusion protein into a sheep embryo to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into a sheep embryo to edit the sheep SOCS2 gene; The fusion protein consists of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor, and nuclear entry signal; the nucleotide sequence of the sgRNA-S1 is shown in SEQ ID NO.

5.

3. The method according to claim 2, characterized in that, In methods (b) and (c), the mass ratio of sgRNA-S1 to the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear signal is 1:2, and the mass ratio of sgRNA-S1 to the mRNA of the fusion protein expressing Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear signal is 1:2.