A molecular marker Lig1 related to the lignin content of alfalfa and its application

Abstract

The object of the present invention is to provide a new option for rapidly cultivating alfalfa materials with different lignin contents. The present invention belongs to the technical field of molecular biology, and specifically relates to a molecular marker Lig1 related to the lignin content of alfalfa and its application. The technical solution of the present invention is a molecular marker Lig1 that is closely linked to the lignin content of alfalfa, and its nucleotide sequence is shown in SEQ ID No.1 or SEQ ID No.2; SNP genotyping: G / A. The KASP primer combination developed by the present invention can directly distinguish and detect the A or G base at the SNP mutation site, and can simply and accurately realize the rapid screening of low-lignin alfalfa germplasm materials, which is of great significance for alfalfa quality breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker Lig1 related to the lignin content of alfalfa and its application. Background Art

[0002] Alfalfa is the leguminous forage with the largest cultivated area in the world. It has a high crude protein content and rich nutritional value, and is known as the "king of forages". The lignin content has an important impact on the nutritional quality of alfalfa. Lignin is an important component of the plant cell wall and is tightly combined with cellulose. It is difficult to be digested by livestock and will hinder the degradation of cellulose and hemicellulose, thereby reducing the digestibility of alfalfa. The higher the lignin content, the more difficult it is for livestock to digest alfalfa and the lower the nutrient absorption efficiency. For example, studies have shown that when the lignin content of alfalfa increases from 10% to 15%, its relative feed value (RFV) will decrease significantly, and the dry matter intake (DMI) of livestock will also decrease.

[0003] Breeding new varieties of alfalfa with low lignin content is one of the main measures to improve the quality of alfalfa. The traditional breeding of new varieties of alfalfa with low lignin content is based on single-plant selection according to the lignin content of breeding offspring. This method is time-consuming and laborious, and the accuracy is not high. Using the base differences existing in the target gene to develop specific molecular markers for assisted selection is the best method to improve the selection efficiency. The Kompetitive Allele-Specific PCR (KASP) molecular marker is a new type of SNP genotyping method based on allele-specific amplification (Amplification Refractory Mutation System, ARMS) and highly sensitive fluorescence detection. Its principle is to design two forward primers and a common reverse primer for the allele SNP site. Each forward primer has a specific sequence and can be combined with different fluorescent labels. The forward primers with sequences combined with different fluorescences and the common reverse primer are used to PCR amplify the DNA of the sample to be tested, and its allelic variation can be reflected by different fluorescent signals (He C L, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145: 75 - 86).

[0004] Therefore, developing KASP markers tightly linked to the lignin content of alfalfa for early breeding selection is crucial for reducing the breeding workload and accelerating the quality breeding of alfalfa, and at the same time, the economic benefits are obvious. Summary of the Invention

[0005] The objective of the present invention is to provide a new option for rapidly cultivating alfalfa materials with different lignin contents.

[0006] The technical solution of the present invention is a molecular marker Lig1 related to the lignin content of alfalfa, and the specific information is as follows: chromosome: chr1; position: 16779657; SNP typing: G / A.

[0007] Furthermore, the nucleotide sequence of the molecular marker Lig1 is as shown in SEQ ID No.1 or SEQ ID No.2.

[0008] The present invention also provides a primer combination for amplifying the molecular marker Lig1, and its nucleotide sequence is as shown in SEQ ID No.3 - 5.

[0009] The present invention also provides a molecular marker detection kit, including the primers shown in SEQ ID No.3 - 5.

[0010] The present invention also provides a molecular marker chip, including the primers shown in SEQ ID No.3 - 5.

[0011] The present invention also provides the application of the molecular marker Lig1, the primer combination for amplifying the molecular marker Lig1, the kit and / or the molecular marker chip in any one of the following:

[0012] a. Predicting the lignin content of alfalfa;

[0013] b. Identifying and screening alfalfa with different lignin contents;

[0014] c. Breeding alfalfa with low lignin content;

[0015] d. Molecular marker-assisted breeding of alfalfa;

[0016] e. Breeding of alfalfa;

[0017] f. Preparing products for alfalfa breeding.

[0018] The present invention also provides a method for screening alfalfa materials with different lignin contents, including the following steps: extracting the genomic DNA of the alfalfa material to be tested, amplifying the molecular marker Lig1 using the primers described in SEQ ID No.3 - 5, sequencing the amplification product, and performing typing and screening.

[0019] Specifically, the amplification program is as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

[0020] Specifically, the criteria for classification screening are as follows: If the classification result is AA, it is a low lignin material; if the classification result is GA or GG, it is a high lignin material.

[0021] Advantages of the present invention: The present invention screens a KASP marker Lig1 related to the lignin content of alfalfa; and develops a primer combination for this marker. The primer combination can directly and specifically distinguish and detect the A or G base at the SNP mutation site, and can simply and accurately realize the rapid screening of low lignin alfalfa germplasm materials, which is of great significance for the quality breeding of alfalfa. The molecular marker of the present invention has good application value, can realize the pre-selection and molecular assisted breeding of the lignin content trait of alfalfa, and has important theoretical and practical significance for accelerating the genetic improvement process of lignin content breeding and improving the selection efficiency. Description of the Drawings

[0022] Figure 1 The GWAS found that the Lig1 locus was significantly associated with the lignin content.

[0023] Figure 2 The KASP marker typing results, red represents the GG genotype, purple represents the AG genotype, and blue represents the AA genotype.

[0024] Figure 3 Comparison of lignin content among materials with different genotypes. Detailed Embodiments

[0025] The present invention obtained the Lig1 locus near 16.8 Mb on chromosome Chr1 of the alfalfa genome through sequencing and analysis of 150 alfalfa germplasm materials, and designed detection primers for this locus. According to the designed primers, the inventor detected 85 materials, and the results showed that there were significant differences in the lignin content of materials with different genotypes.

[0026] Example 1 Discovery of the Lig1 Locus

[0027] The experimental population consisted of 150 alfalfa germplasm materials, including core germplasm, germplasm from different regions with different phenotypes. Considering the differences among individual plants within the same alfalfa variety, branches were cut from the germplasm nursery in 2021 and cuttings were taken in the greenhouse. After successful rooting of the cuttings, these germplasm materials were transplanted into experimental fields located in Langfang, Hebei and Changping, Beijing. In these experimental fields, the experimental population was established using a randomized block design with three replicates, and each replicate contained 10 cuttings. To ensure sufficient growth space, the interval between replicates was 150 cm, and the distances between rows and between plants were set at 150 cm and 60 cm, respectively. During the growth period, no fertilization or irrigation measures were taken, and only manual weeding was carried out. To help the plants overwinter, winter water was irrigated.

[0028] Alfalfa at the early flowering stage was harvested in the two experimental fields respectively. After harvesting, the whole alfalfa plants were put into a nylon net belt and air-dried in a ventilated and shaded greenhouse, avoiding direct sunlight, until their branches became brittle and easy to break. Then, these samples were placed in a constant temperature oven and dried thoroughly at 60 °C for 6 hours. After drying, they were crushed using a cyclone mill to a particle size that could pass through a 40-mesh sieve, packaged in a self-sealing bag (kept dry and avoiding direct sunlight) for subsequent determination, and then the lignin content was determined using a Foss near-infrared analyzer NIRS D2500F (FOSS, Denmark) (with three technical replicates and the average value taken).

[0029] 100 mg of young alfalfa leaves were selected, quickly frozen in liquid nitrogen and stored. Subsequently, the total plant DNA was extracted using a CWBIO plant genomic DNA extraction kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions, and the concentration and quality of the total DNA were detected using a micro-spectrophotometer (Nano Photometer NP80, Germany). Subsequently, sequencing was carried out on the BGI DNBSEQ second-generation sequencing platform (BGI, Shenzhen, China).

[0030] Approximately 36 GB of raw data was obtained for each material. The raw sequencing data was processed by Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove adapters and filter out low-quality base sequences. Subsequently, the cleaned sequencing data was aligned to the haplotype reference genome of Medicago sativa 'Zhongmu No. 1' using BWA-MEM. SAMtools (version 1.13) was used to filter out multiple alignments and low-quality sequences, resulting in a filtered BAM file that was sorted. The Mark Duplicates function in the Picard toolkit (version 2.23.0) was used to mark PCR duplicates. Finally, the processed BAM file was used for variant detection with GATK Haplotype Caller (version 4.2.3.062). In the filtering strategy for SNPs, the following parameters were set as screening criteria: Qual By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, Strand Odds Ratio (SOR) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the screening conditions for a subset of Medicago sativa SNP markers were defined, including: (1) removing SNP markers with a missing rate greater than 20% and a Minor Allele Frequency (MAF) less than 0.05% using VCFtools (version 0.1.16) to create a basic SNP set containing only biallelic SNP markers; (2) performing Linkage Disequilibrium (LD)-based filtering on this basic SNP set using Plink (version 1.90b6.21), setting the window size for LD filtering to 100 SNPs, the window step size to 50 SNPs, and the r2 threshold to 0.2 to obtain a core SNP marker set. Missing genotypes in the SNP marker set after LD filtering were imputed using Beagle software with default parameters. Similarly, Indel markers were filtered using VCFtools, retaining only biallelic markers with a missing rate less than 20% and a MAF greater than 0.05%.

[0031] GWAS analysis was performed using 1,303,375 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, multiple software and statistical models were employed: TASSEL 5.0 (GLM and MLM) (Bradbury P J et al., 2007), BLINK (v1.01) (Huang et al., 2019). The Q-Q plot (quantile-quantile plot) was used to measure the reliability of the model. By comparing the Q-Q plots generated by different models, it was found that the GLM model in TASSEL 5.0 performed relatively well. Therefore, the GLM model of TASSEL 5.0 was selected to display the final results. Principal component analysis was performed on the SNP data, and the first three principal component variables were used as covariates to correct the population structure. The Manhattan plot was visualized using the R package CMplot (Yin et al., 2021). Association SNP linkage disequilibrium (LD) analysis was calculated using LDBlockShow (Dong et al., 2021) and the data was visualized. A locus significantly associated with lignin content was found on chromosome 1, with an LOD value of 6.5 and a phenotypic contribution rate of 10.15% that could be explained. It was named Lig1 ( Figure 1 ).

[0032] Example 2 Development of Lig1 KASP markers

[0033] Lig1 is located near 16.8 Mb on chromosome Chr1 of the alfalfa genome. The upstream and downstream reference sequences are shown as SEQ ID No.1 and SEQ ID No.2. The specific information of the Lig1 locus is as follows: chromosome: chr1; position: 16779657; SNP typing: G / A.

[0034] SEQ ID No.1, where lowercase letters represent the SNP locus;

[0035] GTGGTGGAGCTTGTCTTGTTTCTTTGAGGGGGCCATAGCTACGTAATATGTTTCATTTGTGTAATGTAAATATAAGTTTGGCATTGAGGTGAAGCAGTAAAAAATAAAAACCATTTTTTATATCAAGAACCGAGTTCGACACACTGAAGACACTTTAGTAACATTTTGTGCAATTATTCAATGTTGAATTGCAAAATCGAATACCGTCGGAATCgATACCAAAACCTAGCAGCAGTTGCAAAATTAACATTTTGCTGGTGCGTCACTTGCTTGATATGATAAATCAATGTTAAACATCATATATATTCCTAATATTTTAATAAAACTGGTGGAATAAAGACTCCCCATATCATTGAGAAGCTCTGTCAGTGATTACAGCCGCACCATGAAACTTTTACACGACATACATGTAAGAAGTGTCACAAATAATGGCTTAAT;

[0036] SEQ ID No.2, where the lowercase letters represent SNP sites;

[0037] GTGGTGGAGCTTGTCTTGTTTCTTTGAGGGGGCCATAGCTACGTAATATGTTTCATTTGTGTAATGTAAATATAAGTTTGGCATTGAGGTGAAGCAGTAAAAAATAAAAACCATTTTTTATATCAAGAACCGAGTTCGACACACTGAAGACACTTTAGTAACATTTTGTGCAATTATTCAATGTTGAATTGCAAAATCGAATACCGTCGGAATCaATACCAAAACCTAGCAGCAGTTGCAAAATTAACATTTTGCTGGTGCGTCACTTGCTTGATATGATAAATCAATGTTAAACATCATATATATTCCTAATATTTTAATAAAACTGGTGGAATAAAGACTCCCCATATCATTGAGAAGCTCTGTCAGTGATTACAGCCGCACCATGAAACTTTTACACGACATACATGTAAGAAGTGTCACAAATAATGGCTTAAT。

[0038] The KASP primers were designed for the Lig1 locus and its flanking sequences using the Bacthprimer 3 software. Each set of KASP markers consists of 2 specific primers and 1 universal primer. Fluorescent linker sequences were attached to the 5'-ends of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent linker sequence).

[0039] Specific primer 1 (SEQ ID No.3): GAAGGTGACCAAGTTCATGCTGCAACTGCTGCTAGGTTTTGGTATC;

[0040] Specific primer 2 (SEQ ID No.4): GAAGGTCGGAGTCAACGGATTGCAACTGCTGCTAGGTTTTGGTATT;

[0041] Universal primer (SEQ ID No.5): CCGAGTTCGACACACTGAAGACACTT.

[0042] Application of the Lig1 Locus in Example 3

[0043] In addition, 85 alfalfa germplasm materials were selected for planting (the planting method was the same as in Example 1). Then, 100 mg of young alfalfa leaves were selected, quickly frozen in liquid nitrogen, and subsequently, the total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (CowinBiosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro-spectrophotometer (Nano Photometer NP80, Germany).

[0044] The verification and detection of KASP markers were performed using the Array Tape genotyping system from Douglas Scientific. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0045] The PCR system was assembled using NEXAR, and the PCR reaction system is shown in Table 1.

[0046] Table 1 KASP Reaction System

[0047] PCR amplification was performed using SOELLEX, and the Touch down PCR amplification conditions were as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, for 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 sec, 57°C for 60 sec, for 30 cycles.

[0048] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then data analysis and genotype typing were performed using INTELLICS. The marker typing is shown in Figure 3, where red represents that the sample is of the GG allele genotype at this locus, blue represents the AA allele genotype, and purple represents the G / A heterozygous type. The allele types of 85 germplasm materials at this locus are shown in Table 2.

[0049] After that, the lignin content of materials with three allele types was statistically analyzed using the t - test method (the method for measuring lignin content is the same as that in Example 1), and it was found that the lignin content of the AA allele genotype was significantly lower than that of the G / A and GG type materials (P < 0.01) (see Figure 3 ).

[0050] Table 2 Allele types of 85 germplasm materials at this locus

Claims

1. An SNP molecular marker Lig1 related to the lignin content of alfalfa, characterized in that: The nucleotide sequence of the SNP molecular marker Lig1 is shown in SEQ ID No.1 and SEQ ID No.

2.

2. The primer combination for detecting the SNP molecular marker Lig1 as claimed in claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID No.3 - 5.

3. A detection kit for the SNP molecular marker Lig1 described in claim 1, characterized in that: It includes the primers shown in SEQ ID No.3 - 5.

4. The application of the primer combination according to claim 2 and / or the kit according to claim 3 in any one of the following, characterized in that: a. Predicting the lignin content of alfalfa; b. Identifying and screening alfalfa with different lignin contents; c. Breeding alfalfa with low lignin content; d. Molecular marker-assisted breeding of alfalfa with different lignin contents; e. Preparing products for molecular marker-assisted breeding of alfalfa with different lignin contents; In the above application, the SNP molecular marker Lig1 described in claim 1 is detected using the primers shown in SEQ ID No.3 - 5, and gene typing is performed according to the detection results. If the typing result is AA, it is a low-lignin material; if the typing result is GA or GG, it is a high-lignin material.

5. A method for screening alfalfa materials with different lignin contents, characterized in that: It includes the following steps: Extracting the genomic DNA of the alfalfa material to be tested, detecting the SNP molecular marker Lig1 described in claim 1 using the primers shown in SEQ ID No.3 - 5, and performing gene typing according to the detection results. If the typing result is AA, it is a low-lignin material; if the typing result is GA or GG, it is a high-lignin material.

6. The method according to claim 5, wherein: The detection procedure is as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

Images