Use of beta-hydroxybutyric acid for the preparation of a medicament for the prevention and / or treatment of osteoporosis

By using β-hydroxybutyric acid (BHB) to prepare a drug formulation that inhibits osteoclast differentiation, the shortcomings of existing technologies in the prevention and treatment of osteoporosis with β-hydroxybutyric acid are overcome, and the effects of increasing bone density and improving bone microstructure are achieved.

CN119909054BActive Publication Date: 2026-04-07THE AFFILIATED HOSPITAL OF SOUTHWEST MEDICAL UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510143653.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-10
Publication Date
2026-04-07
Estimated Expiration
2045-02-10

AI Technical Summary

Technical Problem

The role of β-hydroxybutyrate (BHB) in regulating osteoclasts (OCs) in preventing and treating bone loss in estrogen-deficient postmenopausal osteoporosis and diabetic osteoporosis has not yet been clarified by current technology.

Method used

β-hydroxybutyric acid (BHB) was used as the active ingredient to prepare a drug formulation to inhibit osteoclast differentiation or formation. The inhibitory effect on osteoclasts was verified in vitro and in vivo through mouse models treated with different concentrations.

Benefits of technology

BHB significantly reduces osteoclast count, improves bone microstructure, increases bone density, reduces bone loss, improves glucose metabolism and insulin resistance, and provides a new target for the prevention and treatment of osteoporosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119909054B_ABST
    Figure CN119909054B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of medicine, and more particularly to the application of beta-hydroxybutyric acid in the preparation of a drug for preventing and / or treating osteoporosis, including postmenopausal osteoporosis due to estrogen deficiency and diabetic osteoporosis, wherein the concentration of the beta-hydroxybutyric acid is 150 mM, the application of beta-hydroxybutyric acid in the preparation of a drug for inhibiting the differentiation of osteoclasts or inhibiting the formation of osteoclasts, wherein the beta-hydroxybutyric acid inhibits the differentiation of osteoclast precursor cells into osteoclasts, and the concentration of the beta-hydroxybutyric acid is 10 mM; the present application proves that beta-hydroxybutyric acid improves the bone microstructure of OVX mice and db / db mice, inhibits the differentiation of osteoclasts, and reduces bone resorption, thereby providing a new target for the prevention and treatment of osteoporosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, and in particular to the use of β-hydroxybutyric acid in the preparation of drugs for the prevention and / or treatment of osteoporosis. Background Technology

[0002] With an aging population and changing lifestyles, osteoporosis (OP) has become a global public health problem, characterized by decreased bone mass and damage to bone microstructure. OP is divided into two categories: primary and secondary. Postmenopausal osteoporosis (PMOP) is one of the most common forms of primary OP, caused by increased bone resorption due to estrogen deficiency, disrupting normal bone remodeling. Epidemiological data show that diabetic patients, due to long-term exposure to a high-sugar environment, experience skeletal damage and an increased risk of fractures. Therefore, there is an urgent need for alternative methods to promote bone health.

[0003] The ketogenic diet (KD), as a therapeutic diet, is characterized by restricting carbohydrate intake and increasing fat intake. Ketone bodies replace glucose to provide energy for the body, effectively reducing weight, lowering blood sugar, and improving insulin resistance. Its effects on bone health are currently controversial. Beta-hydroxybutyrate (BHB) is the main component of ketone bodies. In insulin deficiency, excessive BHB production can induce ketoacidosis in diabetic patients. However, appropriate BHB supplementation or fasting-induced increases in BHB levels have a protective effect on the body.

[0004] However, there are currently no studies reporting whether BHB acts on osteoclasts (OCs) to regulate PMOP and bone loss in diabetic osteoporosis (DOP). Summary of the Invention

[0005] To address the aforementioned technical problems, embodiments of the present invention provide the use of β-hydroxybutyric acid in the preparation of drugs for the prevention and / or treatment of osteoporosis.

[0006] To achieve the above objectives, the embodiments of the present invention adopt the following technical solutions:

[0007] On the one hand, β-hydroxybutyric acid is used in the preparation of drugs for the prevention and / or treatment of osteoporosis.

[0008] In some embodiments, the osteoporosis includes postmenopausal osteoporosis due to estrogen deficiency and diabetic osteoporosis.

[0009] In some embodiments, the concentration of β-hydroxybutyric acid administered is 150 mM.

[0010] On the other hand, the present invention provides the use of β-hydroxybutyric acid in the preparation of drugs that inhibit osteoclast differentiation or osteoclast formation.

[0011] In some embodiments, the β-hydroxybutyric acid inhibits the differentiation of osteoclast precursor cells (RAW264.7 cells) into osteoclasts.

[0012] In some embodiments, the β-hydroxybutyric acid is administered at a concentration of 10 mM.

[0013] In some embodiments, the above-mentioned drug comprises a pharmaceutical preparation made of an effective amount of β-hydroxybutyric acid as the active ingredient, plus a pharmaceutically acceptable carrier and / or excipients.

[0014] An effective amount refers to the amount of a drug, compound, or pharmaceutical composition necessary to achieve any one or more beneficial or desired therapeutic outcome. Beneficial or desired outcomes include: clinical improvement (e.g., reduced morbidity, reduced mortality, improvement of one or more symptoms), reduction of severity, and delay of disease onset (including the disease or its complications, intermediate pathological phenotypes, biochemical, histological, and / or behavioral symptoms present during disease development). Formulations may be injections, sprays, aerosols, nasal drops, oral preparations, or formulations suitable for mucosal application. Routes of administration to subjects include, but are not limited to: intramuscular, intravenous, subcutaneous, intradermal, oral, intranasal, respiratory, transmucosal, sublingual, and parenteral.

[0015] The present invention has the following advantages over the prior art:

[0016] (1) In this invention, a PMOP mouse model of estrogen deficiency was constructed using bilateral ovariectomy (OVX) and a DOP mouse model was replicated using db / db male mice. From the different OP models, it was confirmed that BHB intervention reduced fasting blood glucose and insulin levels in db / db mice, improved glucose metabolism and insulin resistance; it significantly increased the levels of type I procollagen N-terminal propeptide (PINP) and bone-specific alkaline phosphatase (BALP) in OVX mice and db / db mice, and decreased the levels of tartrate-resistant acid phosphatase 5b (TRACP 5b) and type I collagen C-terminal peptide (CTX-I). The results indicate that BHB upregulated bone formation and downregulated bone resorption. The mice in the drug-treated group showed increased bone density, more regular trabecular arrangement, improved fracture defects, reduced number of OCs, and decreased expression of OC differentiation-related markers NFACTc1, c-Fos, MMP-9, CTSK, and TRAP. This indicates that BHB improves the skeletal microstructure and reduces bone loss in OVX and db / db mice by inhibiting OC generation.

[0017] (2) In vitro experiments further confirmed that BHB inhibited the expression of OC differentiation-related marker proteins and mRNAs, inhibited the differentiation of RAW264.7 cells into OCs and the formation of F-actin loops, and reduced the nuclear translocation of NFATc1, indicating that BHB has the activity of inhibiting OC bone resorption in vitro.

[0018] In summary, this invention demonstrates that BHB improves bone microstructure in db / db mice and OVX mice, inhibits OC differentiation, and reduces bone resorption, providing a new target for the prevention and treatment of OP. Attached Figure Description

[0019] Figure 1 A DXA analysis result of bilateral femurs in OVX mice after BHB administration, provided in an embodiment of this application.

[0020] Figure 2 The following images are provided for the embodiments of this application: 3D reconstructed images of trabecular bone in OVX mice after BHB administration, coronal CT images of the femur, transverse CT images of the distal femur, and quantitative analysis diagrams of trabecular bone-related parameters.

[0021] Figure 3 The image shows the results of ELISA detection of serum bone formation markers (PINP, BALP) and bone resorption markers (TRACP 5b, CTX-I) in OVX mice after BHB administration, provided in the embodiments of this application.

[0022] Figure 4 Figure 1 shows the results of HE staining and TRAP staining analysis of the distal femur of OVX mice after BHB administration, as provided in the embodiments of this application.

[0023] Figure 5 This is a schematic diagram showing the results of Western Blot detection of protein expression levels of NFACTc1, c-Fos, MMP-9, CTSK, and TRAP, which are markers related to OC differentiation in bone tissue of OVX mice after BHB administration, provided in an embodiment of this application.

[0024] Figure 6 A graph showing the comparison of fasting blood glucose and insulin levels in db / db mice after BHB administration, provided in an embodiment of this application.

[0025] Figure 7 A DXA analysis result of bilateral femurs in db / db mice after BHB administration, provided in an embodiment of this application;

[0026] Figure 8 The following images are provided for embodiments of this application: 3D reconstructed images of trabecular bone in db / db mice after BHB administration, coronal CT images of the femur, transverse CT images of the distal femur, and quantitative analysis diagrams of trabecular bone-related parameters.

[0027] Figure 9 The image shows the results of ELISA detection of serum bone formation markers (PINP, BALP) and bone resorption markers (TRACP 5b, CTX-I) in db / db mice after BHB administration, provided for embodiments of this application.

[0028] Figure 10 Figure 1 shows the results of HE staining and TRAP staining analysis of the distal femur of db / db mice after BHB administration, as provided in the embodiments of this application.

[0029] Figure 11 The CCK-8 assay provided in this application was used to detect the effect of different concentrations of BHB on the viability of RAW264.7 cells.

[0030] Figure 12 This is a diagram showing the results of TRAP staining to detect the formation of OCs after BHB intervention, provided in an embodiment of this application.

[0031] Figure 13 A schematic diagram showing the results of Western Blot and qRT-PCR detection of the protein and mRNA expression levels of OCs differentiation-related markers NFACTc1, c-Fos, MMP-9, CTSK, and TRAP after BHB intervention, provided in the embodiments of this application;

[0032] Figure 14 The image shows the results of phalloidin staining and immunofluorescence detection of F-actin ring formation and NFATc1 nuclear translocation after BHB intervention, provided in the embodiments of this application. Detailed Implementation

[0033] The technical solutions in some embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this disclosure, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments provided in this disclosure are within the scope of protection of this disclosure.

[0034] Unless otherwise specified, all raw materials, reagents, instruments, and equipment used in this application are commercially available or can be prepared using existing methods. Sodium 3-hydroxybutyrate was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. (Cat#BD13033) and dissolved in double-distilled water to obtain an aqueous solution containing BHB.

[0035] I. Experimental Methods

[0036] Example 1: BHB can improve bone loss in two osteoporosis mouse models.

[0037] All laboratory mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., and were housed in an SPF-grade animal laboratory. They had free access to water and food, and were maintained under normal conditions: temperature 22±2℃, relative humidity 55±5%, and a 12-hour light / dark cycle. After 7 days of acclimatization, they were grouped for experiments. The 60kcal% high-fat diet used in the experiments was purchased from Research Diets, and the regular diet was purchased from Chengdu Dashuo Company.

[0038] 1. Establishment of a mouse ovariectomy (OVX) model

[0039] Fifteen healthy 10-week-old female C57BL / 6 mice were fasted and deprived of water for 4 hours before surgery. They were anesthetized by intraperitoneal injection of 1% sodium pentobarbital solution at a dose of 50 mg / kg and randomly divided into three groups of five mice each: sham surgery group (Sham), OVX group (OVX), and OVX+β-hydroxybutyrate group (OVX+BHB). The mice were placed in a prone position, limbs were fixed, and hair was removed from both sides of the back. The area was disinfected with iodine and draped with a sterile drape. A 1-2 cm incision was made along both sides of the back at the costovertebral angle. The skin, fascia, and muscle were sequentially cut or bluntly dissected. After separating the fat pads, glucose-red tissue was visible, which was the ovary. The connection between the fallopian tube and ovary was ligated, and the ovary was removed. In the Sham group, adipose tissue of similar weight to the ovary was removed. After ovarian removal and sham surgery, the remaining tissue was returned to its original position, and the surgical area was sutured in layers and disinfected. The mice were placed in a warm and comfortable environment after surgery to await recovery. After the mice recovered, they were returned to their cages, and penicillin was administered to prevent infection depending on the condition of the incision. Drug intervention began one week post-surgery, with the OVX+BHB group receiving free access to a BHB solution containing a final concentration of 150 mM. The intervention continued for 16 weeks, with each group of mice fed a normal diet.

[0040] 2. Establishment of a mouse model of diabetic osteoporosis (DOP)

[0041] Ten healthy 8-week-old male db / db mice were used to establish a dopamine-induced dysplasia (DOP) model by feeding them a high-fat diet. They were randomly divided into two groups of five mice each: the DOP group and the DOP+BHB group. Mice in the DOP+BHB group had free access to a 150 mM BHB solution. This intervention lasted for 12 weeks. Five littermate wild-type mice served as the normal control group (NC group) and were fed a standard diet. After the drug intervention ended, fasting blood glucose levels were measured by collecting blood from the tail vein.

[0042] Following the intervention in Example 1, the following post-treatment procedures were performed:

[0043] Mice were anesthetized by intraperitoneal injection of 50 mg / kg of 1% sodium pentobarbital solution, followed by bilateral femoral DXA detection. After scanning, blood was collected via the orbital cavity, and mice were euthanized by cervical dislocation. Fresh blood was allowed to stand for 1 hour until coagulation, then centrifuged to separate serum (3000 rpm / min, 10 min). The serum was aliquoted into new EP tubes and stored at -80℃ for later use. ELISA kits from Andygene (Beijing, China) were used to detect TRACP 5b, CTX-I, BALP, PINP, and insulin levels. The hind limbs of the mice were dissected, and soft tissues such as muscles on the femoral surface were removed. The left femur was preserved in liquid nitrogen for Western blotting experiments; the right femur was fixed in 4% paraformaldehyde solution for 24 hours, and then preserved in 70% alcohol for micro-CT scanning of distal femoral microstructural changes. After completing the micro-CT scan, the sample was placed in 10% EDTA solution and decalcified on a shaker at room temperature for 10-12 weeks to prepare paraffin-embedded specimens for HE and TRAP staining.

[0044] Bilateral femoral DXA bone mineral density testing

[0045] Mice were anesthetized, and their limbs and tails were fixed with titanium alloy splints. The region of interest (ROI) was adjusted and fixed using infrared light. The scanning program was set to small animal whole-body scan mode, and the bilateral femurs (including Ward's triangle) were selected as the ROI for data analysis. The mean value obtained was the bone mineral density (BMD) value of the mouse.

[0046] Micro-CT scan of the distal femur

[0047] Scanning was performed using a SCANCO MEDICAL AGμCT50 scanner with parameters set to 15μm resolution, 70kVp, 200μA, and a scan speed of 1*300ms. The scanner's dedicated program, SCANCO Medical Evaluation, was used to locate and analyze the distal femur, with 1800-2000 layers of bone tissue as the region of interest (ROI) of cancellous bone. Analysis of the VOI of 29×29×29μm³ bone tissue yielded the following results: bone volume / total volume (BV / TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular spacing (Tb.Sp). 3D-Display reconstruction of the bone microstructure was then performed.

[0048] HE staining

[0049] (1) Tissue sectioning: The paraffin block of the femur was continuously sectioned with a thickness of 4μm and placed in a constant temperature oven at 37℃ overnight.

[0050] (2) Dewaxing: Place the slices in an environmentally friendly transparent dewaxing solution for 30 minutes.

[0051] (3) Hydration: Gradient alcohol hydration, with concentrations of 100% → 95% → 90% → 80% in sequence, for 10 minutes each time, followed by thorough rinsing with tap water.

[0052] (4) Staining: Hematoxylin staining for 5 min → rinse with tap water for 5 min → differentiate with 1% saline alcohol for 10 s → rinse with tap water for 5 min → stain cytoplasm with eosin for 5 min → rinse with tap water for 5 min.

[0053] (5) Dehydration: 80% alcohol for 2 min → 90% alcohol for 2 min → 95% alcohol for 2 min → 100% alcohol for 2 min → 100% alcohol for 5 min → xylene I for 5 min → xylene II for 5 min.

[0054] (6) Mounting and photographing: After the sections are dried, they are mounted with neutral resin, and the staining results are observed and photographed under a microscope.

[0055] Tissue TRAP staining

[0056] (1) The steps of tissue sectioning, dewaxing, and hydration are the same as those for HE staining.

[0057] (2) Cover the tissue with double-distilled water and incubate in a 37°C oven for 2 hours.

[0058] (3) After incubation, pour off the double-distilled water, add the prepared TRAP staining working solution to cover the tissue, and continue to react in a 37°C oven in the dark for 30 minutes.

[0059] (4) Discard the TRAP staining working solution, rinse with tap water, stain the nucleus with hematoxylin for 2 min, and rinse repeatedly with tap water; differentiate with 1% hydrochloric acid alcohol for 2-3 s, saturate with lithium carbonate solution for 1 min, and rinse repeatedly with tap water; dehydrate with gradient alcohol in sequence (concentrations are 80% 2 min → 85% 2 min → 90% 2 min → 95% 2 min → 100% 2 min → 100% 5 min).

[0060] (5) Mounting and photographing: After the sections are dried, they are mounted with neutral resin, and the staining results are observed and photographed under a microscope.

[0061] Tissue protein extraction and Western Blot experiments:

[0062] Tissue homogenization was performed using 100 mg + 1000 μL LIPA lysis buffer (containing 1% PMSF) (P0013B, Shanghai Beyotime Biotechnology Co., Ltd.), centrifuged at 12000 rpm for 15 min, the supernatant was collected and 5X loading buffer was added, and the protein was denatured by heating at 100℃ for 10 min.

[0063] After electrophoresis on a 12.5% ​​SDS-PAGE gel, the PVDF membrane was transferred and blocked with 5% BSA at room temperature for 2 hours. The membrane was then incubated overnight at 4°C with primary antibodies (catalog numbers: NFATC1 (SC-7294, Santa Cruz, USA), c-Fos (AF6489, Beyotime, China), TRAP (ab191406, abcam, USA), CTSK (AF6597, Beyotime, China), and MMP-9 (ab283575, abcam, USA). The membrane was then washed three times with PBST, followed by the corresponding species-specific secondary antibody. After 1 hour at room temperature, the membrane was washed again with PBST and developed. It was then immersed in a dark chamber containing chemiluminescence buffer for 1-2 minutes before being developed using a chemiluminescence analyzer. Images were collected and saved, and protein expression quantification was performed using ImageJ software.

[0064] Example 2: BHB can inhibit osteoclast differentiation

[0065] 1. Cell viability assay

[0066] RAW264.7, a mouse precursor osteoclast cell line, was seeded at 5000 cells / well in 96-well plates containing 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, and DMEM medium. The plates were incubated at 37°C in a 5% CO2 incubator, with the medium changed daily. After cell adhesion, different concentrations of BHB (0, 2, 4, 6, 8, 10, 12, 14, and 16 mM) were added to the experimental groups, and blank wells (containing no cells) were included. 100 μL of sterile PBS was added to each well to prevent evaporation. The plates were cultured for another 5 days, and then 10 μL of CCK8 solution was added to each well before incubation for 4 hours. After incubation, the OD values ​​of each well were measured at 450 nm using a microplate reader, and cell viability was calculated using a formula.

[0067] 2. Cell protein extraction and Western blot analysis

[0068] RAW264.7 cells (passage 10 or less), round and translucent, with good refractive index and no pseudopodia, were selected and seeded at 50,000 cells / well in 6-well plates and incubated overnight until cell attachment. Groups were established: negative control (MEM Alpha complete medium), positive control (MEM Alpha complete medium + 100 ng / mL RANKL), and drug treatment group (MEM Alpha complete medium + 100 ng / mL RANKL + 10 mM BHB). Medium was changed every other day, and samples were collected after 5 days. The medium was aspirated, and the cells were washed three times with PBS. RIPA lysis buffer containing 1% PMSF was added, and cells were scraped off with a cell scraper, sonicated, and lysed on ice for 20 min. The cells were centrifuged at 12,000 rpm / min for 10 min at 4°C, and the supernatant was collected into EP tubes. 5× loading buffer was added, and the cells were heated at 100°C for 10 min to denature proteins. The remaining steps were the same as for tissue SDS-PAGE electrophoresis.

[0069] 3. Cell RNA extraction and RT-qPCR detection

[0070] Total RNA was extracted from OCs, the culture medium was aspirated, and the cells were washed three times with PBS. Following the kit instructions, 1000 μL of Trizol (15596018CN, Thermo Fisher Scientific, USA) was added, and the cells were repeatedly pipetted to lyse them (until the cells were clear). The RNA was reverse transcribed into cDNA. RT-qPCR was used to determine the expression of OC differentiation-related genes. The specific primers used for OC-related genes in this experiment are listed below:

[0071] Gene ForwardPrimer ReversePrimer GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA NFATc1 GGTGCCTTTTGCGAGCAGTATC CGTATGGACCAGAATGTGACGG c-Fos GGGAATGGTGAAGACCGTGTCA GCAGCCATCTTATTCCGTTCCC MMP-9 GCTGACTACGATAAGGACGGCA TAGTGGTGCAGGCAGAGTAGGA CTSK AGCAGAACGGAGGCATTGACTC CCCTCTGCATTTAGCTGCCTTTG TRAP GCGACCATTGTTAGCCACATACG CGTTGATGTCGCACAGAGGGAT

[0072] 4. Cellular TRAP staining and phalloidin staining

[0073] RAW264.7 cells were seeded at 10,000 cells / well in 24-well plates and incubated overnight until cell attachment. Cells were divided into groups with three replicates per group. After 5 days, the cell culture medium was aspirated, and the cells were fixed with 4% paraformaldehyde for 15 min, followed by three washes with distilled water. Cells were then permeabilized by covering them with 0.2% Triton X-100 solution for 20 min, followed by three washes with distilled water. TRAP working solution was added to the wells to cover the cells, and the plates were incubated at 37°C in the dark for 30 min. After three washes with distilled water, the cells were observed and photographed under a microscope.

[0074] After cell intervention, the cells were fixed and perforated according to the TRAP staining procedure, and then washed three times with PBS. Phalloidin staining reagent was added to each slide, and the slides were incubated at room temperature in the dark for 1 hour. After washing three times with PBS, DAPI containing an anti-fluorescence quencher was added for counterstaining, and the slides were mounted. After air-drying in the dark, the slides were observed and photographed under a microscope.

[0075] 5. Immunofluorescence detection of NFATC1 expression

[0076] Cell slides were placed in 24-well plates, grouped, and stimulated for 48 hours. After fixation and membrane perforation, the slides were washed three times with PBS. 10% goat serum was added, and the slides were blocked at room temperature for 2 hours. Primary antibody was added, and the slides were incubated overnight at 4°C. The next day, the slides were washed three times with PBS, and fluorescent secondary antibody was added, incubating at room temperature in the dark for 1 hour. After washing three times with PBS, the slides were counterstained with DAPI containing an anti-fluorescence quencher and mounted. After air-drying in the dark, the slides were observed and photographed under a microscope.

[0077] 6. Statistical methods

[0078] Data were analyzed using GraphPadPrism 8.0.2 software, and are expressed as mean ± standard deviation (mean ± SD). One-way ANOVA was used to compare differences between groups, with p < 0.05 indicating statistical significance.

[0079] II. Experimental Results

[0080] 1. BHB increases BMD in OVX and db / db mice and improves skeletal microstructure.

[0081] To clarify the effect of bone fibroblast bone (BHB) on whole-body bone mass in OVX and db / db mice, bone mineral density (BMD) of the femur was measured using DXA, microCT scans, and three-dimensional reconstruction, and skeletal microstructural parameters were analyzed. DXA results indicated that BMD increased in both OVX and db / db mice after BHB administration. Figure 1 , Figure 7 Bilateral femoral bone loss was improved. Micro-CT 2D / 3D reconstructed images showed that after BHB administration, the number of trabeculae in OVX and db / db mice increased, and the structure became more compact. Figure 2 , Figure 8 Further analysis of bone microstructural parameters revealed that, compared to the model group, BHB intervention increased BV / TV, Tb.N, and Tb.Th, while decreasing Tb.Sp. Figure 2 , Figure 8 The above results indicate that BHB can lead to increased bone mass and improved skeletal microstructure in mice.

[0082] 2. Effects of BHB on glucose metabolism in db / db mice and on bone turnover markers in OVX and db / db mice

[0083] The serum levels of PINP, BALP, TRACP 5b, and CTX-I in OVX mice after 16 weeks of drug administration and db / db mice after 12 weeks of drug administration were detected by ELISA. The results showed that the expression levels of bone formation markers PINP and BALP in serum were significantly higher than those in the model group, while the expression levels of bone resorption markers TRACP 5b and CTX-I were significantly lower than those in the model group. Figure 3 , Figure 9 The fasting blood glucose and insulin levels of db / db mice were also measured, and BHB treatment significantly reduced both blood glucose and insulin levels. Figure 6 These results suggest that BHB upregulates bone formation, downregulates bone resorption, and improves glucose metabolism and insulin resistance.

[0084] 3. BHB can prevent trabecular bone loss and inhibit osteoclast formation in OVX and db / db mice.

[0085] Further investigation was conducted on the effects of BHB on the femoral pathological morphology of OVX and db / db mice. HE staining showed that, compared with the model group, the BHB-treated group had an increased number of trabeculae, more regular arrangement, and improved fracture defects, while the number of adipocytes did not increase. Figure 4 , Figure 10 This improved bone loss. TRAP staining results showed that the number of OCs in mice treated with BHB was reduced. Figure 4 , Figure 10 Western blot analysis further confirmed that BHB significantly downregulated the expression of OC differentiation-related markers NFACTc1, c-Fos, MMP-9, CTSK, and TRAP. Figure 5 The above results suggest that BHB intervention can reduce the number of OCs, which may be related to BHB alleviating bone loss in OVX and db / db mice.

[0086] 4. Cell proliferation function detection

[0087] CCK-8 assay results showed that, compared with the blank control group, BHB concentrations of 1–10 mM had no significant effect on cell viability; however, at a concentration of 12 mM, cell viability was significantly reduced, and the difference was statistically significant. Figure 11 Therefore, 10 mM was chosen as the optimal intervention concentration.

[0088] 5. BHB inhibits RANKL-mediated osteoclastogenesis in vitro.

[0089] RANKL was used to induce RAW264.7 cells to establish an in vitro OC differentiation system. TRAP staining showed that BHB inhibited the differentiation of RAW264.7 cells into OCs, and the number of OCs was significantly reduced. Figure 12 Western blot and qRT-PCR analysis revealed that BHB intervention significantly inhibited the expression of OC differentiation-related markers NFATc1, c-Fos, MMP-9, CTSK, and TRAP proteins and mRNAs. Figure 13 Furthermore, fluorescent staining also showed that BHB inhibited the formation of the F-actin ring and reduced the nuclear translocation of NFATC1. Figure 14 ).

[0090] In summary, BHB can improve bone microstructure in ovariectomized postmenopausal osteoporosis mice and diabetic osteoporosis mice by increasing bone mineral density in the femur and regulating bone parameters such as BV / TV, Tb.N, Tb.Th, and Tb.Sp. Furthermore, BHB significantly inhibited the in vitro transcription of NFATc1 and c-Fos, reduced the expression of osteoclast-specific genes MMP-9, CTSK, and TRAP, inhibited the transformation of RAW264.7 cells into osteoclasts, and effectively suppressed osteoclast fusion and bone resorption. Therefore, BHB has great potential as an effective drug for inhibiting osteoclasts in the prevention and treatment of osteoporosis.

[0091] In the description of this specification, specific features, structures, materials, or characteristics may be combined in any suitable manner in one or more embodiments or examples.

[0092] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. The use of β-hydroxybutyric acid in the preparation of drugs for the prevention and / or treatment of osteoporosis, characterized in that, The dosage of β-hydroxybutyric acid is 150 mM; the osteoporosis is diabetic osteoporosis.

Citation Information

Patent Citations

  • 3-hydroxy butanoic acid and novel use of derivative thereof

    CN1729965A