A composition, nanoparticle, method of making and use for inhibiting ovarian cancer

By using a nanoparticle preparation method that combines bufotalin and niraparib, the problem of low response rate in niraparib treatment of ovarian cancer has been solved, achieving highly efficient tumor inhibition and reduced side effects.

CN119909081BActive Publication Date: 2025-12-05HUNAN XINHUI PHARMA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510083736.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2025-12-05
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

The application of niraparib in the treatment of ovarian cancer is limited due to its low response rate and high recurrence rate.

Method used

By combining bufotalin and niraparib and loading them onto a nanocarrier, and coating the nanoparticles with a membrane to connect nucleic acid aptamers, targeted nanoparticles were prepared, achieving efficient enrichment and sequential release of the drug at the tumor site.

Benefits of technology

It significantly improved the inhibitory effect of niraparib on ovarian cancer, reduced the dosage, enhanced the killing power against tumor cells, reduced toxic side effects, and achieved comprehensive killing of tumor cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119909081B_ABST
    Figure CN119909081B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of nanomedicine, and particularly relates to a composition for inhibiting ovarian cancer, nanoparticles, a preparation method and application, comprising bufalin and niraparib, wherein the molar ratio of the bufalin and the niraparib is 6.25-12.5:5000-10000, and the application can improve the inhibition effect on ovarian cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of nanomedicine technology, specifically relating to a composition, nanoparticles, preparation method, and application for inhibiting ovarian cancer. Background Technology

[0002] Ovarian cancer, a common gynecological malignancy, is currently the leading cause of cancer death among women worldwide. Although its incidence rate accounts for only 3.4% of all female malignancies, its mortality rate is the highest among female reproductive system malignancies. This is because ovarian cancer has an insidious onset, making accurate diagnosis difficult in its early stages. More than two-thirds of patients are diagnosed with advanced ovarian cancer after symptoms appear, resulting in a survival rate of less than 20%. Currently, clinical treatment for ovarian cancer primarily involves surgery and chemotherapy.

[0003] Niraparib (Nir) is an oral, potent, and highly selective PARP1 and PARP2 inhibitor with good solubility and high permeability. Clinical trial results have confirmed that niraparib can significantly prolong the median progression-free survival of patients with advanced ovarian cancer. Therefore, niraparib has become the first-line PARP inhibitor of choice for maintenance therapy in ovarian cancer. However, low clinical response rates and postoperative recurrence severely limit the use of niraparib. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a composition, nanoparticles, preparation method and application for inhibiting ovarian cancer, thereby improving the inhibitory effect on ovarian cancer.

[0005] This invention provides a composition for inhibiting ovarian cancer, comprising bufotalin and niraparib, wherein the molar ratio of bufotalin to niraparib is 6.25-12.5:5000-10000.

[0006] This invention provides a nanoparticle comprising a nanocarrier loaded with bufotalin and niraparib, the surface of the nanocarrier being coated with a membrane, the membrane being connected to a nucleic acid aptamer, and the molar ratio of bufotalin to niraparib being 0.2-0.5:2.5-5.

[0007] Preferably, the membrane is connected to a nucleic acid aptamer via a connecting material, wherein the connecting material is a functionalized phospholipid material connected to a cross-linking agent.

[0008] Preferably, the nanocarrier is polylactic acid-glycolic acid copolymer (i.e., PLGA).

[0009] Preferably, the nucleic acid aptamer is MUC1 aptamer, with the sequence SEQ ID NO.1, which is GGCTATAGCACATGGGTAAAACGACAAAAA, and more preferably HS-GGCTATAGCACATGGGTAAAACGACAAAAA.

[0010] Preferably, the membrane is a red blood cell membrane, a tumor cell membrane, or a macrophage membrane, more preferably a red blood cell membrane, abbreviated as M, and the particle size of the nanoparticles is 90-150 nm, preferably 90-120 nm.

[0011] This invention provides a method for preparing the aforementioned nanoparticles, comprising the following steps:

[0012] Bufotalin, niraparib, and nanocarriers were dissolved in an organic solvent and then treated to obtain nanocarriers loaded with bufotalin and niraparib.

[0013] The membrane solution and the nanocarrier loaded with bufotalin and niraparib were mixed (ultrasonic bath) and treated (squeezed through a 0.22 μm filter) to coat the surface of the nanocarrier with a membrane, thus obtaining a membrane-coated nanocarrier.

[0014] The functionalized phospholipid material and the crosslinking agent are mixed evenly (preferably in a buffer solution (more preferably Hepes solution (pH 7.4)), preferably in a water bath, preferably in the dark and allowed to stand, the water bath temperature is 4°C, the water bath time is 2-4 hours, preferably 2 hours) to obtain the bonding material;

[0015] The membrane-coated nanocarrier, the linker material, and the nucleic acid aptamer are mixed evenly (by stirring and sonicating at a speed of 400-600 rpm for 15-25 min, preferably 15 min) to obtain the nanoparticles.

[0016] Preferably, the nanocarrier is a polylactic acid-glycolic acid copolymer, the organic solvent is dimethyl sulfoxide, and a dispersant is also added when preparing the nanocarrier loaded with bufotalin and niraparib.

[0017] The functionalized phospholipid material is DSPE-PEG. 2000 -NH2, the crosslinking agent is sulfo-SMCC.

[0018] Preferably, the mass ratio of bufotalin, niraparib, and polylactic-co-glycolic acid copolymer is 1-2:1:2-100, more preferably 1:1:50. The mass ratio of the membrane solution to the nanocarrier is 2-4:1, more preferably 2:1.

[0019] The DSPE-PEG 2000The molar ratio of -NH2 to sulfo-SMCC is 1:5-10, preferably 1:10; the molar ratio of sulfo-SMCC to nucleic acid aptamer is 5-10:1, preferably 10:1; and the mass ratio of nucleic acid aptamer to nanocarrier is 0.5-1:5-50, preferably 1:10.

[0020] Preferably, bufotalin, niraparib, and the nanocarrier are dissolved in an organic solvent and processed by water bath sonication (sonication time 3-5 min), followed by stirring (stirring speed 400-600 rpm), and then added dropwise to a dispersant solution (preferably 1% PVA solution). After dialysis (dialysis bag molecular weight 1000 Da, dialysis time 12-24 h), nanocarriers loaded with bufotalin and niraparib are obtained.

[0021] Preferably, when the membrane solution is a red blood cell membrane, the preparation method of the membrane solution is as follows: blood is collected from mice through the orbital sinus, and the red blood cells are lysed on ice with PBS buffer after low-speed centrifugation (centrifugation speed of 800-1000 rpm) and washing with PBS. Then, the red blood cell membranes are collected by high-speed centrifugation (high-speed centrifugation speed of 12000-14000 rpm, more preferably 13000 rpm, centrifugation time of 20-40 min, preferably 30 min). The membranes are filtered sequentially with filters (preferably 0.45 and 0.22 μm filters) to dissolve the solution and obtain a uniformly dispersed red blood cell membrane solution.

[0022] This invention provides an application of the aforementioned composition or nanoparticles, wherein the composition or nanoparticles are used to prepare a drug for inhibiting ovarian cancer.

[0023] The beneficial effects of this invention are that by combining bufotalin and niraparib, it was found that the two have a synergistic effect, which can significantly improve the inhibitory effect of niraparib on ovarian cancer and significantly reduce the dosage of niraparib, showing good application prospects in the treatment of ovarian cancer.

[0024] The nanoparticles of this invention have good targeting, stability and dispersibility. The preparation method is simple and mild, low in energy consumption and easy to scale up. By utilizing their high targeting, the drugs can be efficiently enriched in the tumor site and released sequentially with bufotalin and niraparib. This effectively enhances the killing effect of chemotherapy drugs on tumor cells and causes DNA damage to tumor cells, achieving all-round killing of tumors while reducing the dosage to reduce toxic side effects. Attached Figure Description

[0025] Figure 1 This is a schematic diagram of the preparation process of MUC1-M@(PC+PN) in Example 2.

[0026] Figure 2TEM images of PLGA, PLGA@CS-5, and PLGA@Nir NPs provided in Example 1.

[0027] Figure 3 The ultraviolet absorption spectra of PLGA, PLGA@CS-5, and PLGA@Nir NPs provided in Example 1, and their loading capacities for bufotalin and niraparib are shown. (A) shows the ultraviolet absorption spectra of PLGA, PLGA@CS-5, and PLGA@Nir NPs; (B) shows the loading capacities for bufotalin and niraparib.

[0028] Figure 4 TEM images and particle size data of MUC1-M@(PC+PN) provided in Example 2 and Example 6. (A) is the TEM image; (B) is the particle size data.

[0029] Figure 5 Heatmaps of the combined use of CS-5 and Nir, PC and PN provided in Examples 3 and 6. (A) shows the cell viability after combined treatment of A2780 with CS-5 and Nir, (B) shows the synergistic index analysis of the combined use of CS-5 and Nir, (C) shows the cell viability after combined treatment of A2780 with PC and PN, and (D) shows the synergistic index analysis of the combined use of PC and PN.

[0030] Figure 6 Apoptosis graphs of PBS, CS-5, Nir, and MUC1-M@(PC+PN) provided in Example 4 and Example 6 are shown. (A) shows cell apoptosis detected by flow cytometry after different drug treatments, and (B) shows the quantification of cell apoptosis detected by flow cytometry after different drug treatments.

[0031] Figure 7 The figures show the relationship between body weight, tumor volume, and time in the four groups of mice in Experiment Example 5, as well as the actual images of mouse tumors and the relationship between average tumor weight and time. (A) represents the body weight of the four groups of mice, (B) represents the relationship between tumor volume and time, (C) represents the actual image of mouse tumors, and (D) represents the relationship between average tumor weight and time.

[0032] Figure 8 The images show the hemolysis, coagulation, and H&E staining results of normal mouse tissues from Experiment Example 5. (A) shows the hemolysis result, (B) shows the coagulation result, and (C) shows the H&E staining.

[0033] Figure 9 The images show the actual images of mice in the four relapse model groups in Experiment 6, the actual images of mouse tumors, and the average tumor weight. Among them, (A) is an image of the mouse, (B) is an image of the mouse tumor, and (C) is the average tumor weight.

[0034] In the above figures, polylactic acid-glycolic acid copolymer is denoted as PLGA, polylactic acid-glycolic acid copolymer loaded with bufotalin is denoted as PC, polylactic acid-glycolic acid copolymer loaded with niraparib is denoted as PN, and biomimetic nanoparticles targeted and loaded with bufotalin and niraparib are denoted as MUC1-M@(PC+PN). Detailed Implementation

[0035] The following will combine Figure 1-9 The present invention will be described in detail below. The illustrative embodiments and descriptions herein are used to explain the invention, but are not intended to limit the invention.

[0036] Example 1

[0037] This embodiment provides a method for preparing PLGA@CS-5 and PLGA@Nir, which are prepared according to the following steps:

[0038] (1) 100 μg of bufotalin (CS-5), 100 μg of niraparib (Nir) and 5 mg of PLGA (polylactic acid-glycolic acid copolymer) were dissolved in dimethyl sulfoxide and sonicated in a water bath for 3 min to obtain 1 mL of mixture. Using 5 mL of 1% PVA solution as the dissolving medium, the mixture was added dropwise with stirring at 400 rpm. After dialysis for 24 h, PLGA, PLGA@CS-5 and PLGA@Nir were collected.

[0039] The synthesized material was analyzed by transmission electron microscopy, and the particle size was analyzed by diluting it 100 times.

[0040] (2) The volumetric dialysis solution was adjusted, and the concentrations of bufotalin and niraparib in the solution were measured using a UV spectrophotometer. The loading efficiency (LC) and encapsulation efficiency (EE) of bufotalin and niraparib were calculated using the following formulas.

[0041] Where MT is the total mass of the drug added, MU is the mass of the unencapsulated drug, and MP is the mass of the nanocarrier.

[0042] like Figure 2 As shown, transmission electron microscopy (TEM) imaging analysis was performed on the polylactic acid-glycolic acid copolymer (PLGA), polylactic acid-glycolic acid copolymer-encapsulated bufotalin (PLGA@CS-5), and polylactic acid-glycolic acid copolymer-encapsulated niraparib (PLGA@Nir) prepared in this embodiment. The results showed that the PLGA was spherical with a size of about 100 nm. The antitumor composition was encapsulated on the PLGA, and the nanoparticles had uniform particle size and good dispersibility.

[0043] like Figure 3As shown in UV absorption spectrum A, the characteristic absorption peak of bufotalin is located around 295 nm. After demulsification of PLGA-loaded bufotalin nanoparticles, the absorption peak of bufotalin was detected. Simultaneously, the UV absorption peak of PLGA was around 310 nm. When PLGA included an antitumor composition, a slight shift in the UV absorption peak of PLGA was observed, with a typical nano-silver peak appearing around 300 nm. Furthermore, UV absorption peak measurements of the dialysis fluid showed that PLGA NPs could effectively load bufotalin and niraparib.

[0044] Example 2

[0045] This experimental example provides a nanoparticle with ovarian cancer targeting and recurrence inhibition functions, which is prepared using PLGA@CS-5 and PLGA@Nir provided in Example 1.

[0046] Blood was collected from mice via the orbital sinus. Red blood cells were lysed on ice with 0.25 × PBS (pH 7.4) after low-speed centrifugation (800 rpm) and washing with PBS (pH 7.4). The red blood cell membranes were then collected by high-speed centrifugation (13000 rpm) and filtered sequentially through 0.45 and 0.22 μm filters to obtain uniformly dispersed red blood cell membranes. 10 mg of the red blood cell membranes were sonicated with PLGA@CS-5 and PLGA@Nir in a water bath for 15 min, and then squeezed through a 0.22 μm filter to obtain nanocarriers loaded with bufotalin and niraparib.

[0047] Using Hepes solution (pH 7.4) as buffer, 20 μL of 0.05 mM DSPE-PEG2000-NH2 and 20 μL of 0.5 mM sulfo-SMCC were added to 960 μL of Hepes buffer to prepare a 1 mL system. After standing in the dark at 4 °C for 2 h, the volume was adjusted to 1.5 mL to obtain DSPE-PEG2000-NH-sulfo-SMCC with a concentration of 333 μM.

[0048] In a 100 μL system, 10 μL of 100 μM MUC1 nucleic acid aptamer, 3 μL of 333 μgM DSPE-PEG2000-NH-sulfo-SMCC, and nanocarriers loaded with bufotalin and niraparib were mixed and stirred at 400 rpm and 37 °C for 30 min to obtain MUC1-M@(PC+PN).

[0049] Transmission electron microscopy (TEM) imaging and particle size analysis were performed on MUC1-M@(PC+PN) to observe the morphology and nanoparticle size of MUC1-M@(PC+PN).

[0050] like Figure 4As shown, MUC1-M@(PC+PN) was successfully prepared in this embodiment. The particle size is uniform, and the electron micrograph shows a clear spherical structure with a film coating. The particle size is concentrated in the range of 90-120 nm, and the dispersion is good.

[0051] Example 3

[0052] A2780 cells were evenly seeded into 96-well plates, with 100 μL of cell suspension added to each well. After cell attachment, different concentrations of CS-5, Nir, PC, PN, and combination drugs prepared with 1% DMEM were added. After 24 h of treatment, the original culture medium was removed, and 100 μL of MTT solution was added for 1–2 h of incubation. The culture was then terminated, the original culture medium was aspirated from the wells, and 100–150 μL of LDMSO was added to each well. The plates were incubated at 37°C for 10 min, and the OD value was then measured at 490 nm using a microplate reader.

[0053] like Figure 5 As shown, CS-5, Nir, PC, and PN in this embodiment all have significant killing effects on A2780. Furthermore, according to the heatmap simulation, a combination score ≥10 indicates a synergistic effect between the two drugs. Figure 5 It is known that Nir at 5-10 μM and CS-5 at 6.25-12.5 nM have a synergistic effect, as do PC at 200-500 nM and PN at 2.5-5 μM. Through this combined effect, the therapeutic effect is improved, and the drug concentration is reduced, thereby reducing toxic side effects.

[0054] Example 4

[0055] A2780 cells were seeded in 6-well plates (1×10⁶ cells per well). 5 Cells were incubated in wells (1 cell / well) at 37°C and 5% CO2 for 24 h. Then, PBS, CS-5, Nir, and MUC1-M@(PC+PN) NPs were added and the cells were treated for 24 h. The treated cell suspensions were analyzed using the Annexin V-FITC / PI apoptosis detection kit and flow cytometry.

[0056] like Figure 6 As shown, the apoptosis rates of PBS, CS-5, Nir, and MUC1-M@(PC+PN) NPs were 2.51%, 19.96%, 20.28%, and 80.4%, respectively. Through the combination of two drugs and nanoparticles, MUC1-M@(PC+PN) NPs showed a killing effect that was more than twice as high as that of the other groups. This indicates that CS-5 and niraparib have an effective synergistic effect, and that biomimetic nanoparticles significantly enhance the therapeutic effect.

[0057] Example 5

[0058] Animal models were established and analyzed in accordance with ethical requirements for animal experiments. The mice used to establish the model were 4-6 week old female BALB / c mice, and 5 × 10⁵ gram (approximately 1000 mg / L) of the mouse mammary glands were inoculated in situ. 6 A2780 cells were first bred in mice to form cells with an average volume of 100 mm². 3 The tumor was targeted to ensure the formation of a hypoxic region within the tumor tissue. Mice were then randomly divided into four groups and treated intravenously after 10 days (Ⅰ: Control group; Ⅱ: CS-5; Ⅲ: Niraparib; Ⅳ: MUC1-M@(PC+PN) NPs group), with treatment administered every two days.

[0059] Tumor volume and body weight in mice were recorded during the observation period. Hemolysis and coagulation experiments were also performed using the composite system described in this invention. After the experiment, major organs from each treatment group were collected for H&E staining analysis. Figure 7 The results showed that the tumor growth rate was lowest after injection of the composite system of the present invention, and body weight returned to normal after treatment; furthermore, Figure 8 The H&E staining results of the tissues showed no abnormalities in any organs. Therefore, the composite biomimetic nanoparticles of this invention, which possess ovarian cancer targeting and recurrence inhibition functions, exhibit good safety while ensuring the efficacy of in situ tumor treatment.

[0060] Example 6

[0061] Animal models were established and analyzed in accordance with ethical requirements for animal experiments. The mice used to establish the model were 4-6 week old female BALB / c mice, and 2.5 × 10⁻⁶ ppm were inoculated into the mammary glands of the mice. 6 A2780 cells were first bred in mice to form cells with an average volume of 100 mm². 3 To ensure the formation of hypoxic regions within the tumor tissue, mice were randomly divided into four groups. Ten days later, each group received intravenous treatment (Group I: Control; Group II: CS-5; Group III: Niraparib; Group IV: MUC1-M@(PC+PN) NPs), administered every two days for a total of three treatments. The tumors that grew in the mice reached a size of 500-1000 mm². 3 The tumor was surgically removed, leaving a tumor in the mouse's body measuring 10-50 mm. 3 The mice were sutured with healing sutures, and then treated with medication every two days after the first two days. The weight of the mice and the growth of the tumors were recorded.

[0062] Tumor volumes in mice were recorded during the observation period. Figure 9It is evident that the recurrent tumor volume in the MUC1-M@(PC+PN) NPs group is significantly smaller than that in other components. The composite biomimetic nanoparticle of the present invention, which has ovarian cancer targeting and recurrence inhibition functions, has the characteristic of anti-tumor recurrence.

[0063] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of protection of this application is limited to these examples; within the framework of this application, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of different aspects of one or more embodiments of this application as described above, which are not provided in detail for the sake of brevity.

[0064] One or more embodiments in this application are intended to cover all such substitutions, modifications, and variations that fall within the broad scope of this application. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of one or more embodiments in this application should be included within the protection scope of this application.

Claims

1. A composition for inhibiting ovarian cancer, characterized in that, The composition comprises bufalin and niraparib at a molar ratio of 6.25-12.5:5000-10000.

2. A nanoparticle characterized by, The composition comprises nanocarriers loaded with bufalin and niraparib, the surface of the nanocarriers is coated with a membrane, the membrane is connected with aptamer, and the molar ratio of the bufalin and niraparib is 0.2-0.5:2.5-5.

3. The nanoparticles as described in claim 2, characterized in that, The membrane is connected with aptamer through a connecting material, and the connecting material is a functionalized phospholipid material connected with a crosslinking agent.

4. The nanoparticles as described in claim 2, characterized in that, The nanocarrier is polylactic acid-glycolic acid copolymer.

5. The nanoparticle of claim 2, wherein, The aptamer is MUC1 aptamer, and the sequence is SEQ ID NO.

1.

6. The nanoparticles as described in claim 2, characterized in that, The membrane is a red blood cell membrane, a tumor cell membrane or a macrophage membrane, and the particle size of the nanoparticle is 90-150 nm.

7. A method of producing nanoparticles as claimed in any one of claims 2 to 6, characterised in that, The composition comprises the following steps: Bufalin, niraparib and nanocarriers are dissolved in an organic solvent, and after treatment, nanocarriers loaded with bufalin and niraparib are obtained; The membrane solution and the nanocarriers loaded with bufalin and niraparib are mixed, and the surface of the nanocarriers is coated with a membrane to obtain nanocarriers coated with a membrane; The functionalized phospholipid material and the crosslinking agent are mixed uniformly to obtain a connecting material; The nanocarriers coated with a membrane, the connecting material and the aptamer are mixed uniformly to obtain the nanoparticle.

8. The production method according to claim 7, wherein The nanocarriers are polylactic-co-glycolic acid, the organic solvent is dimethyl sulfoxide; when preparing the nanocarriers loaded with bufadienolides and niraparib, a dispersing agent is further added; the functionalized phospholipid material is DSPE-PEG 2000 -NH2, and the crosslinking agent is sulfo-SMCC.

9. The production method according to claim 8, wherein The mass ratio of the bufalin, niraparib and polylactic acid-glycolic acid copolymer is 1-2:1:2-100; the mass ratio of the film solution and the nano-carrier is 2-4:1; the mass ratio of the DSPE-PEG 2000 The molar ratio of -NH2 and sulfo-SMCC is 1:5-10, the molar ratio of sulfo-SMCC and the nucleic acid aptamer is 5-10:1, and the mass ratio of the nucleic acid aptamer and the nano-carrier is 0.5-1:5-50.

10. Use of a composition according to claim 1, or of nanoparticles according to any one of claims 2 to 6, characterized in that, The composition or nanoparticle is used for preparing a drug for inhibiting ovarian cancer.

Citation Information

Patent Citations

  • Novel bufotalin functionalized bionic nano-composite preparation as well as preparation method and application thereof

    CN115624623A

  • Drug-loaded bionic nanoparticles as well as preparation method and application thereof

    CN117797119A