High throughput single cell sequencing with reduced amplification bias

Abstract

Provided herein are methods for preparing a sequencing library comprising nucleic acids from a plurality of single cells. In one embodiment, the method includes linear amplification of a nucleic acid. In one embodiment, a sequencing library includes whole genome nucleic acids from a plurality of single cells. In one embodiment, a nucleic acid comprises three index sequences. Also provided herein are compositions, such as compositions comprising nucleic acids having three index sequences.

Description

[0001] This application is a divisional application of Chinese invention patent application No. 201980003422.5, with an application date of May 17, 2019 and an invention name of “High-throughput single-cell sequencing with reduced amplification bias”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application Serial No. 62 / 673,023, filed May 17, 2018, and U.S. Provisional Application Serial No. 62 / 821,864, filed March 21, 2019, each of which is incorporated herein by reference in its entirety.

[0004] Government support

[0005] This invention was made with government support under Grant No. DP1 HG007811 awarded by the National Institutes of Health. The government has certain rights in this invention. Technical Field

[0006] Embodiments of the present disclosure relate to nucleic acid sequencing. In particular, embodiments of the methods and compositions provided herein relate to generating an indexed single-cell sequencing library and obtaining sequence data for characterizing rare events (including crossover and chromosome missegregation events) therefrom. In some embodiments, the method relates to parsing cancer heterogeneity at the single-cell level. Background Art

[0007] Contemporary single-cell genome sequencing technologies have two major limitations. First, most methods require compartmentalization of individual cells, which can limit throughput. Second, most amplification methods are PCR-based and therefore have exponential amplification bias. To address the first problem, we and colleagues developed single-cell combinatorial indexing ("sci-"), in which several rounds of split-merge barcoding are performed to uniquely mark the nucleic acid content of single cells, thereby achieving an exponential increase in throughput with each successive indexing round. Sci-methods have been successfully developed to analyze chromatin accessibility (sci-ATAC-seq), transcriptome (sci-RNA-seq), genome (sci-DNA-seq), methylome (sci-MET), and chromosome conformation (sci-Hi-C) in large numbers of single cells (Cao et al., 2017, Science 357:661–667; Cusanovich et al., 2015, Science, 348:910-914; Mulqueen et al., 2018, Nat. Biotechnol. 36:428-431; Ramani et al., 2017, Nat. Methods 14:263-266; Vitak et al., 2017, Nat. Methods 14:302-308). To address the second problem, a possible solution is provided by linear amplification based on T7 transcription, which has been previously used in the context of single-cell analysis (Eberwine et al., 1992; Proceedings of the National Academy of Sciences 89:3010-3014; Hashimshony et al., 2012, Cell Rep. 2:666-673; Sos et al., 2016, Genome Biolol., 17:20). For example, recently, Chen et al. developed linear amplification by transposon insertion ("LIANTI"), which uses Tn5 transposon to fragment the genome and simultaneously inserts a T7 RNA promoter for in vitro transcription (IVT). The RNA copies generated from the DNA template cannot be used as templates for further amplification. Therefore, all copies are directly derived from the original DNA template. By avoiding exponential amplification, LIANTI maintains uniformity and minimizes sequence errors. However, this method is low-throughput because it requires preparation of serial libraries from each single cell (Chen et al., 2017, Science 356:189-194). Summary of the invention

[0008] This article describes a method for integrating single-cell combinatorial indexing and linear amplification to minimize amplification bias while achieving an exponential increase in throughput. Through multiple rounds of molecular barcoding, this method increases the throughput of each experiment to at least thousands and possibly millions of cells, while retaining the advantages of linear amplification. The inventors demonstrated the general applicability of this method through a proof-of-concept demonstration of single-cell whole genome sequencing ("sci-L3-WGS"), targeted genome sequencing ("sci-L3-target-seq"), and co-analysis of genomes and transcriptomes ("sci-L3-RNA / DNA"). As a further demonstration, single-cell whole genome sequencing was applied to locate an unprecedented number of meiotic exchanges and rare chromosome mis-segregation events in immature and mature male germ cells from infertile, interspecies (B6 x Spretus) F1 male mice and fertile, intraspecies (B6 x Cast) F1 male mice.

[0009] In particular, the present invention relates to the following:

[0010] 1. A method for preparing a sequencing library, wherein the sequencing library comprises nucleic acids from a plurality of single nuclei or a single cell, the method comprising:

[0011] providing a plurality of isolated nuclei or cells in a first plurality of compartments,

[0012] where each compartment contains a separate nucleus or subset of cells, and

[0013] wherein the nucleus or cell comprises a nucleic acid fragment;

[0014] introducing a linear amplification mediator into the cell or cell nucleus;

[0015] amplifying the nucleic acid fragment by linear amplification;

[0016] processing each subset of nuclei or cells to generate indexed nuclei or cells,

[0017] wherein the processing comprises adding a first compartment-specific index sequence to nucleic acid fragments present in the isolated cell nucleus or cell to produce indexed nucleic acids present in the isolated cell nucleus or cell,

[0018] wherein the processing comprises ligation, primer extension, hybridization, amplification or transposition;

[0019] The indexed nuclei or cells are combined to produce merged indexed nuclei or cells, thereby producing a sequencing library from the plurality of nuclei or cells.

[0020] 2. The method of item 1, wherein the amplification occurs prior to the treatment.

[0021] 3. The method of item 1, wherein the treating occurs before the amplifying.

[0022] 4. A method for preparing a sequencing library, the sequencing library comprising nucleic acids from a plurality of single nuclei or a single cell, the method comprising:

[0023] Providing multiple isolated nuclei or cells,

[0024] wherein the nucleus or cell contains a nucleic acid fragment;

[0025] introducing a linear amplification mediator into the isolated nuclei or cells;

[0026] distributing the separated nuclei or cells into a first plurality of compartments,

[0027] Each of these compartments contains a separate subset of nuclei or cells;

[0028] amplifying the nucleic acid fragment by linear amplification;

[0029] processing each subset of isolated nuclei or cells to generate indexed nuclei or cells,

[0030] wherein the processing comprises adding a first compartment-specific index sequence to nucleic acid fragments present in the isolated cell nucleus or cell to produce indexed nucleic acids present in the isolated cell nucleus or cell,

[0031] wherein the processing comprises ligation, primer extension, amplification or transposition;

[0032] The indexed nuclei are combined to produce merged indexed nuclei or cells, thereby producing a sequencing library from the plurality of nuclei or cells.

[0033] 5. A method for preparing a sequencing library, the sequencing library comprising nucleic acids from a plurality of single nuclei or a single cell, the method comprising:

[0034] providing a plurality of isolated nuclei or cells in a first plurality of compartments,

[0035] where each compartment contains a separate nucleus or subset of cells, and

[0036] wherein the nucleus or cell contains a nucleic acid fragment;

[0037] processing each subset of nuclei or cells to generate indexed nuclei or cells,

[0038] wherein the processing comprises adding (i) a first compartment-specific index sequence to the nucleic acid fragments present in the isolated cell nucleus or cell to generate an indexed nucleic acid present in the isolated cell nucleus or cell and (ii) a nucleotide sequence recognized by a linear amplification mediator,

[0039] wherein the processing comprises ligation, primer extension, hybridization, amplification or transposition;

[0040] introducing a linear amplification mediator into the cell or cell nucleus;

[0041] amplifying the nucleic acid fragment by linear amplification;

[0042] The indexed nuclei or cells are combined to produce merged indexed nuclei or cells, thereby producing a sequencing library from the plurality of nuclei or cells.

[0043] 6. The method according to any one of items 1, 4 or 5, wherein the linear amplification mediator comprises a bacteriophage RNA polymerase or a linear amplification primer.

[0044] 7. The method according to item 6, wherein the nucleic acid fragment comprises a T7 promoter, and the bacteriophage RNA polymerase comprises a T7 RNA polymerase.

[0045] 8. The method according to item 6, wherein introducing the linear amplification mediator comprises adding the linear amplification mediator to the nucleic acid fragments present in the isolated cell nucleus or cell.

[0046] 9. The method according to item 1 or 5, further comprising exposing the plurality of isolated nuclei or cells of each compartment to predetermined conditions.

[0047] 10. The method of item 9, further comprising isolating cell nuclei from the plurality of cells after the exposing.

[0048] 11. The method according to item 4, further comprising exposing the plurality of isolated cell nuclei or cells to predetermined conditions.

[0049] 12. The method of any one of clauses 1, 4 or 5, further comprising subjecting the isolated cell nucleus to conditions that produce a nucleosome-depleted nucleus while maintaining the integrity of the isolated cell nucleus.

[0050] 13. The method according to any one of clauses 1, 4 or 5, wherein the processing comprises:

[0051] Each subset is brought into contact with the transposome complex,

[0052] wherein in each compartment the transposome complex comprises the first indexing sequence which is different from the first indexing sequences in the other compartments; and

[0053] The nucleic acids in the subset are fragmented into a plurality of nucleic acids, and the first index sequence is incorporated into at least one strand of the nucleic acids to produce the indexed nuclei or cells comprising the indexed nucleic acids.

[0054] 14. The method according to any one of clauses 1, 4 or 5, wherein the processing comprises:

[0055] Each subset is contacted with a reverse transcriptase and primers that anneal to RNA molecules in the isolated cell nuclei, wherein the primers in each compartment contain the first index sequence that is different from the first index sequences in other compartments, to generate the indexed cell nuclei or cells containing the indexed nucleic acids.

[0056] 15. The method of item 14, wherein the contacting further comprises a target-specific primer that anneals to a specific nucleotide sequence.

[0057] 16. A method according to any one of items 1, 4 or 5, wherein the process of adding the first compartment-specific index sequence comprises a two-step process of adding a nucleotide sequence comprising a universal sequence to the nucleic acid fragment and then adding the first compartment-specific index sequence to the nucleic acid fragment.

[0058] 17. The method according to item 16, wherein the adding comprises a transposome complex comprising a universal sequence.

[0059] 18. A method according to any one of items 1, 4 or 5, wherein the processing comprises adding a first index to a DNA nucleic acid present in the isolated cell nucleus or cell, adding a first index to an RNA nucleic acid present in the isolated cell nucleus or cell, or a combination thereof.

[0060] 19. The method of item 18, wherein adding a first index sequence to the RNA nucleic acid comprises:

[0061] exposing each subset to a reverse transcriptase and primers that anneal to RNA molecules in the isolated nuclei or cells,

[0062] wherein said primers in each compartment comprise said first compartment-specific index sequence to produce said indexed nuclei or cells comprising said indexed nucleic acid.

[0063] 20. The method of item 18, wherein adding a first index sequence to the DNA nucleic acid comprises:

[0064] Each subset is brought into contact with the transposome complex,

[0065] wherein the transposome complex in each compartment comprises the first compartment-specific index sequence; and

[0066] The nucleic acids in the subset are fragmented into a plurality of nucleic acids, and the first compartment-specific index sequence is incorporated into at least one strand of the nucleic acids to generate the indexed nuclei or cells comprising the indexed nucleic acids.

[0067] 21. The method of item 19, wherein the first index sequence added to the DNA nucleic acid and the first index sequence added to the RNA nucleic acid in each compartment are the same.

[0068] 22. The method of item 19, wherein the first index sequence added to the DNA nucleic acid and the first index sequence added to the RNA nucleic acid in each compartment are different.

[0069] 23. The method of any one of clauses 1, 4 or 5, further comprising exponential amplification of the nucleic acid fragments, wherein the exponential amplification comprises target-specific primers that anneal to specific nucleotide sequences.

[0070] 24. The method according to any one of items 1, 4 or 5, further comprising after said combining:

[0071] distributing the merged, indexed subset of nuclei or cells into a second plurality of compartments; and

[0072] introducing a second compartment-specific indexing sequence into the indexed nucleic acid to generate a dual-indexed nucleus or cell comprising the dual-indexed nucleic acid,

[0073] The introducing comprises ligation, primer extension, amplification or transposition.

[0074] 25. The method according to item 24, further comprising

[0075] combining the dual-indexed nuclei to generate merged dual-indexed nuclei or cells,

[0076] distributing a subset of the merged dual-indexed nuclei or cells into a third plurality of compartments; and

[0077] introducing a third compartment-specific indexing sequence into the indexed nucleic acid to generate a triply-indexed nucleus or cell comprising the triply-indexed nucleic acid,

[0078] The introducing comprises ligation, primer extension, amplification or transposition.

[0079] 26. The method of any one of clauses 1, 4 or 5, further comprising processing the indexed nuclei or cells for methylation analysis to generate nucleic acid fragments suitable for methylation analysis.

[0080] 27. The method of any one of clauses 1, 4 or 5, further comprising subjecting the indexed nuclei or cells to proximity ligation to generate nucleic acid fragments suitable for analyzing chromatin conformation.

[0081] 28. The method according to any one of items 1, 4 or 5, further comprising amplifying the nucleic acid fragments of the sequencing library to produce DNA nanoballs.

[0082] 29. The method of any one of items 1-28, wherein the compartment comprises a well or a droplet.

[0083] 30. The method of any one of items 1-29, wherein each compartment of the first plurality of compartments comprises 50 to 100,000,000 nuclei or cells.

[0084] 31. The method of any one of items 1-29, wherein each compartment of the second plurality of compartments comprises 50 to 100,000,000 nuclei or cells.

[0085] 32. The method according to any one of items 1 to 31, further comprising:

[0086] providing a surface comprising a plurality of amplification sites,

[0087] wherein the amplification site comprises at least two populations of attached single-stranded capture oligonucleotides having free 3' ends, and

[0088] A surface comprising amplification sites is contacted with the indexed fragments under conditions suitable for generating a plurality of amplification sites, each of which comprises a clonal population of amplicons from a single fragment containing the plurality of indexes.

[0089] 33. A method for preparing a sequencing library comprising nucleic acids from a plurality of single cells, the method comprising:

[0090] (a) providing isolated cell nuclei from a plurality of cells;

[0091] (b) chemically treating the isolated cell nucleus to produce a nucleosome-depleted cell nucleus while maintaining the integrity of the isolated cell nucleus;

[0092] (c) distributing subsets of the nucleosome-depleted nuclei into a first plurality of compartments and contacting each subset with a transposome complex, wherein the transposome complex in each compartment comprises a transposase and a first index sequence that is different from first index sequences in other compartments;

[0093] (d) fragmenting the nucleic acid in the subset of the nucleosome-depleted nuclei into a plurality of nucleic acid fragments and incorporating the first index sequence into at least one strand of the nucleic acid fragments to generate indexed nuclei comprising indexed nucleic acid fragments, wherein the indexed nucleic acid fragments remain attached to the transposase;

[0094] (d) combining the indexed nuclei to generate merged indexed nuclei;

[0095] (e) distributing subsets of the merged indexed nuclei into a second plurality of compartments and contacting each subset with a hairpin ligated duplex under conditions suitable for ligation of the hairpin ligated duplex to one or both ends of the indexed nucleic acid fragments to produce dual-indexed nucleic acid fragments, wherein the hairpin ligated duplex comprises a second index sequence that is different from the second index sequence in the other compartments;

[0096] (f) combining the dual-indexed nuclei to generate merged indexed nuclei;

[0097] (g) distributing a subset of the merged dual-indexed nuclei into a third plurality of compartments;

[0098] (h) lysing the dual-indexed cell nuclei;

[0099] (i) processing the dual-indexed nucleic acid fragments to include a third index sequence that is different from the third index sequence in the other compartment; and

[0100] (j) combining the three indexed fragments to generate a sequencing library comprising whole genome nucleic acids from the plurality of single cells.

[0101] definition

[0102] Unless otherwise specified, the terms used herein should be understood to have ordinary meanings in the relevant art. This article lists several terms used herein and their meanings.

[0103] As used herein, the terms "organism", "subject" are used interchangeably and refer to microorganisms (eg, prokaryotic or eukaryotic), animals, and plants. An example of an animal is a mammal, such as a human.

[0104] As used herein, the term "cell type" is intended to identify a cell based on morphology, phenotype, developmental origin, or other known or identifiable distinguishing cellular characteristics. A variety of different cell types can be obtained from a single organism (or from organisms of the same species). Exemplary cell types include, but are not limited to, gametes (including female gametes, such as eggs or ova, and male gametes, such as sperm), ovarian epithelium, ovarian fibroblasts, testes, bladder, immune cells, B cells, T cells, natural killer cells, dendritic cells, cancer cells, eukaryotic cells, stem cells, blood cells, muscle cells, fat cells, skin cells, neural cells, bone cells, pancreatic cells, endothelial cells, pancreatic epithelial cells, pancreatic alpha, pancreatic beta, pancreatic endothelial cells, bone marrow lymphoblasts, bone marrow B lymphoblasts, bone marrow macrophages, bone marrow erythroblasts, bone marrow dendritic cells, bone marrow adipocytes, bone marrow osteocytes, bone marrow chondrocytes, promyelocytes, bone marrow promegakaryocytes, bladder, brain B lymphocytes, brain glial cells, neurons, brain astrocytes, neuroectoderm, brain macrophages, brain microglia, brain epithelium, cortical neurons, brain fibroblasts, breast Epithelium, colon epithelium, colon B lymphocytes, mammary epithelium, mammary myoepithelial cells, mammary fibroblasts, colon enterocytes, cervical epithelium, mammary duct epithelium, tongue epithelium, tonsillar dendritic cells, tonsillar B lymphocytes, peripheral blood lymphoblasts, peripheral blood T lymphoblasts, peripheral blood skin T lymphocytes, peripheral blood natural killer cells, peripheral blood B lymphoblasts, peripheral blood monocytes, peripheral blood myoblasts, peripheral blood mononuclear cells cells, peripheral blood promyelocytes, peripheral blood macrophages, peripheral blood basophils, liver endothelium, liver hypertrophy, liver epithelium, liver B lymphocytes, spleen endothelium, spleen epithelium, spleen B lymphocytes, liver hepatocytes, liver, fibroblasts, lung epithelium, bronchial epithelium, lung fibroblasts, lung B lymphocytes, lung Schwann cells, lung squamous cells, lung macrophages, lung osteoblasts, neuroendocrine, alveolar, gastric epithelium and gastric fibroblasts.

[0105] As used herein, the term "tissue" is intended to represent a collection or aggregate of cells that work together to perform one or more specific functions in an organism. Cells may optionally be similar in morphology. Exemplary tissues include, but are not limited to, embryos, epididymis, eyes, muscles, skin, tendons, veins, arteries, blood, heart, spleen, lymph nodes, bones, bone marrow, lungs, bronchi, trachea, intestines, small intestines, large intestines, colon, rectum, salivary glands, tongue, gallbladder, appendix, liver, pancreas, brain, stomach, skin, kidneys, ureters, bladder, urethra, gonads, testicles, ovaries, uterus, fallopian tubes, thymus, pituitary, thyroid, adrenal glands or parathyroid glands. Tissue may be derived from any of the various organs of humans or other organisms. Tissue may be healthy tissue or unhealthy tissue. Examples of unhealthy tissue include, but are not limited to, malignant tumors of reproductive tissue, lungs, breasts, colorectum, prostate, nasopharynx, stomach, testicles, skin, nervous system, bones, ovaries, liver, blood tissue, pancreas, uterus, kidneys, lymphoid tissue, etc. Malignancies can be of various histologic subtypes, such as carcinoma, adenocarcinoma, sarcoma, fibroadenocarcinoma, neuroendocrine, or undifferentiated.

[0106] As used herein, the term "nucleosome" refers to the basic repeating unit of chromatin. The human genome consists of several meters of DNA compacted in a nucleus with an average diameter of about 10 μm. In the nucleus of eukaryotic cells, DNA is packaged into a nucleoprotein complex called chromatin. Nucleosomes (the basic repeating unit of chromatin) typically include about 146 base pairs of DNA, which wrap around the core histone octamer about 1.7 times. The histone octamer consists of two copies of each of histones H2A, H2B, H3 and H4. Nucleosomes are regularly spaced along DNA in the form of beads on a string.

[0107] As used herein, the term "compartment" is intended to mean an area or volume that separates or isolates something from other things. Exemplary compartments include, but are not limited to, vials, tubes, holes, droplets, boluses, beads, containers, surface features, or areas or volumes separated by physical forces such as fluid flow, magnetism, electric current, etc. In one embodiment, the compartment is a hole in a multi-well plate, such as a 96 or 384-well plate. As used herein, the droplets may include hydrogel beads, which are beads for encapsulating one or more nuclei or cells, and include hydrogel compositions or droplet-based microfluidic devices. In some embodiments, the droplets are homogeneous droplets of hydrogel material or hollow droplets with a polymer hydrogel shell. Whether homogeneous or hollow, the droplets may be able to encapsulate one or more nuclei or cells.

[0108] As used herein, "transpososome complex" refers to an integrase and a nucleic acid including an integration recognition site. A "transpososome complex" is a functional complex formed by a transposase and a transposase recognition site that is capable of catalyzing a transposition reaction (see, e.g., Gunderson et al., WO 2016 / 130704). Examples of integrase include, but are not limited to, integrase or transposase. Examples of integration recognition sites include, but are not limited to, transposase recognition sites.

[0109] As used herein, the term "nucleic acid" is intended to be consistent with its use in the art, and includes naturally occurring nucleic acids or functional analogs thereof. Particularly useful functional analogs can hybridize with nucleic acids in a sequence-specific manner, or can be used as a template for replicating a specific nucleotide sequence. Naturally occurring nucleic acids generally have a backbone comprising a phosphodiester bond. Analog structures can have alternative backbone connections, including any of a variety of backbones known in the art. Naturally occurring nucleic acids generally have deoxyribose (e.g., found in deoxyribonucleic acid (DNA)) or ribose (e.g., found in ribonucleic acid (RNA)). Nucleic acids can include any of a variety of analogs of these sugar moieties known in the art. Nucleic acids can include natural or non-natural bases. In this regard, natural deoxyribonucleic acids can have one or more bases selected from adenine, thymine, cytosine or guanine, and ribonucleic acids can have one or more bases selected from adenine, uracil, cytosine or guanine. Useful non-natural bases that can be included in nucleic acids are known in the art. Examples of unnatural bases include locked nucleic acids (LNA), bridge nucleic acids (BNA), and pseudo-complementary bases (Trilink Biotechnologies, San Diego, CA). LNA and BNA bases can be incorporated into DNA oligonucleotides and increase the strength and specificity of oligonucleotide hybridization. LNA and BNA bases and the use of such bases are known to those skilled in the art and are routine.

[0110] As used herein, the term "target" when used to refer to nucleic acid is intended to be a semantic identifier of nucleic acid in the context of the methods or compositions proposed herein, and does not necessarily limit the structure or function of nucleic acid beyond the scope of other explicit indications. Target nucleic acid can be basically any nucleic acid of known or unknown sequence. For example, it can be a fragment of genomic DNA (e.g., chromosomal DNA), extrachromosomal DNA (such as plasmid), cell-free DNA, RNA (e.g., RNA or non-coding RNA), protein (e.g., cell or cell surface protein) or cDNA. Sequencing can lead to determining the sequence of all or part of the target molecule. The target can be derived from a primary nucleic acid sample, such as a cell nucleus. In one embodiment, the target can be processed into a template suitable for amplification by placing a universal sequence on one or both ends of each target fragment. The target can also be obtained from a primary RNA sample by reverse transcription into cDNA. In one embodiment, the target is used to refer to a subset of DNA, RNA or protein present in a cell. Targeted sequencing is usually performed by PCR amplification (e.g., region-specific primers) or hybridization-based capture methods (e.g., using capture probes) or antibodies to use the selection and separation of target genes or regions or proteins. Targeted enrichment can occur at various stages of the method. For example, target RNA representation can be obtained using target-specific primers in the reverse transcription step or using hybridization-based enrichment of subsets from more complex libraries. An example is exome sequencing or L1000 analysis (Subramanian et al., 2017, Cell, 171; 1437-1452). Targeted sequencing can include any enrichment process known to those of ordinary skill in the art.

[0111] As used herein, the term "universal" when used to describe a nucleotide sequence refers to a sequence region common to two or more nucleic acid molecules, wherein the molecules also have sequence regions that are different from each other. Universal sequences present in different members of a molecular set can allow a population of universal capture nucleic acids to capture multiple different nucleic acids, such as capturing oligonucleotides complementary to a portion of a universal sequence (e.g., a universal capture sequence). Non-limiting examples of universal capture sequences include sequences identical or complementary to P5 and P7 primers. Similarly, universal sequences present in different members of a molecular set can allow a population of universal primers complementary to a portion of a universal sequence (e.g., a universal anchor sequence) to replicate (e.g., sequence sequencing) or amplify multiple different nucleic acids. Non-limiting examples of universal anchor sequences include sequences identical or complementary to spacers such as sp1 and sp2 sequences. In one embodiment, a universal anchor sequence is used as a universal primer (e.g., a sequencing primer for reading fragment 1 or reading fragment 2) to anneal to the site for sequencing. Therefore, capture oligonucleotides or universal primers include sequences that can specifically hybridize with universal sequences.

[0112] When referring to universal capture sequences or capture oligonucleotides, the terms "P5" and "P7" may be used. The terms "P5'" (P5 prime) and "P7'" (P7 prime) refer to the complementary sequences of P5 and P7, respectively. It should be understood that any suitable universal capture sequence or capture oligonucleotide can be used in the methods proposed herein, and the use of P5 and P7 is merely an exemplary embodiment. As illustrated by the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957, the use of capture oligonucleotides such as P5 and P7 or their complementary sequences on flow cells is known in the art. For example, any suitable forward amplification primer, whether fixed or in solution, can be used in the methods proposed herein for hybridization with complementary sequences and sequence amplification. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be used in the methods proposed herein for hybridization with complementary sequences and sequence amplification. Those skilled in the art will understand how to design and use primer sequences suitable for capturing and / or amplifying nucleic acids described herein.

[0113] As used herein, the term "primer" and its derivatives generally refer to any nucleic acid that can hybridize with a target target sequence. Typically, a primer acts as a substrate to which a nucleotide can be polymerized by a polymerase or to which a nucleotide sequence (e.g., an index) can be connected; however, in some embodiments, a primer can be incorporated into a synthetic nucleic acid chain and provide a site to which another primer can hybridize to initiate the synthesis of a new chain complementary to a synthetic nucleic acid molecule. A primer may include any combination of nucleotides or their analogs. In some embodiments, a primer is a single-stranded oligonucleotide or polynucleotide. The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein to refer to a polymeric form of nucleotides of any length, and may include ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. The term should be understood to include analogs of DNA, RNA, cDNA, or antibody-oligomer conjugates made of nucleotide analogs, and is applicable to single-stranded (e.g., sense or antisense) and double-stranded polynucleotides. As used herein, the term also encompasses cDNA, which is a complementary or replica DNA generated from an RNA template (e.g., by the action of a reverse transcriptase). The term refers only to the primary structure of the molecule. Thus, the term includes triple-, double-, and single-stranded deoxyribonucleic acid ("DNA"), and triple-, double-, and single-stranded ribonucleic acid ("RNA").

[0114] As used herein, the term "adapter" and its derivatives, such as universal adapters, generally refer to any linear oligonucleotide that can be connected to a nucleic acid molecule of the present disclosure. In some embodiments, the adapter is substantially non-complementary to the 3' end or 5' end of any target sequence present in the sample. In some embodiments, the suitable adapter length is in the range of about 10-100 nucleotides, about 12-60 nucleotides, or about 15-50 nucleotides. Generally, the adapter can include any combination of nucleotides and / or nucleic acids. In some aspects, the adapter can include one or more cleavable groups at one or more positions. On the other hand, the adapter can include a sequence that is substantially identical or substantially complementary to at least a portion of a primer, such as a universal primer. In some embodiments, the adapter can include a barcode (also referred to as a label or index in this article) to assist downstream error correction, identification, or sequencing. The terms "adaptor" and "adaptor" are used interchangeably.

[0115] As used herein, the term "each," when used in reference to a collection of items, is intended to identify an individual item in the collection, but not necessarily every item in the collection, unless the context clearly dictates otherwise.

[0116] As used herein, the term "transport" refers to the movement of molecules through a fluid. The term may include passive transport, such as the movement of molecules along their concentration gradient (e.g., passive diffusion). The term may also include active transport, such that molecules can move along or against their concentration gradient. Therefore, transport may include applying energy to move one or more molecules in a desired direction or to a desired position, such as an amplification site.

[0117] As used herein, "amplification," "amplified," or "amplification reaction," and their derivatives, generally refer to any action or process by which at least a portion of a nucleic acid molecule is replicated or copied to at least one additional nucleic acid molecule. Additional nucleic acid molecules optionally include sequences that are substantially identical or substantially complementary to at least some portions of a template nucleic acid molecule. The template nucleic acid molecule may be single-stranded or double-stranded, and the additional nucleic acid molecules may independently be single-stranded or double-stranded. Amplification optionally includes linear or exponential replication of nucleic acid molecules. In some embodiments, such amplification may be performed using isothermal conditions; in other embodiments, such amplification may include thermal cycling. In some embodiments, amplification is a multiplex amplification, which includes simultaneous amplification of multiple target sequences in a single amplification reaction. In some embodiments, "amplification" includes amplifying at least some portions of DNA- and RNA-based nucleic acids, either individually or in combination. Amplification reactions may include any amplification method known to those of ordinary skill in the art. In some embodiments, the amplification reaction includes a polymerase chain reaction (PCR).

[0118] As used herein, "amplification conditions" and their derivatives generally refer to conditions suitable for amplifying one or more nucleic acid sequences. Such amplification can be linear or exponential. In some embodiments, the amplification conditions may include isothermal conditions or may alternatively include thermal cycling conditions, or a combination of isothermal and thermal cycling conditions. In some embodiments, conditions suitable for amplifying one or more nucleic acid sequences include polymerase chain reaction (PCR) conditions. Generally, amplification conditions refer to a reaction mixture sufficient to amplify nucleic acids, such as one or more target sequences flanking a universal sequence, or to amplify an amplified target sequence connected to one or more adapters. Generally, amplification conditions include a catalyst for amplification or for nucleic acid synthesis, such as a polymerase; a primer having a certain level of complementarity with the nucleic acid to be amplified; and nucleotides, such as deoxyribonucleotide triphosphates (dNTPs), to promote the extension of the primer once hybridized with the nucleic acid. Amplification conditions may require hybridization or annealing of the primer to the nucleic acid, extension of the primer, and a denaturation step in which the extended primer is separated from the nucleic acid sequence being amplified. Generally, but not necessarily, amplification conditions may include thermal cycling; in some embodiments, amplification conditions include multiple cycles in which the steps of annealing, extension, and separation are repeated. Generally, amplification conditions include cations such as Mg 2+ or Mn 2+ , and may also include various regulators of ionic strength.

[0119] As used herein, "reamplification" and its derivatives generally refer to any process whereby at least a portion of an amplified nucleic acid molecule is further amplified by any suitable amplification process (referred to in some embodiments as "secondary" amplification), thereby producing a re-amplified nucleic acid molecule. The secondary amplification need not be the same as the original amplification process from which the amplified nucleic acid molecule was produced; nor need the re-amplified nucleic acid molecule be identical or completely complementary to the amplified nucleic acid molecule; all that is required is that the re-amplified nucleic acid molecule include at least a portion of the amplified nucleic acid molecule or its complementary sequence. For example, re-amplification may involve the use of different amplification conditions and / or different primers, including different target-specific primers, than the primary amplification.

[0120] As used herein, the term "polymerase chain reaction" ("PCR") refers to the method of Mullis's U.S. Pat. Nos. 4,683,195 and 4,683,202 (which describes a method for increasing the concentration of fragments of a target polynucleotide in a genomic DNA mixture without cloning or purification). This method for amplifying a target polynucleotide includes introducing a large excess of two oligonucleotide primers into a DNA mixture containing the desired target polynucleotide, and then performing a series of thermal cycles in the presence of a DNA polymerase. The two primers are complementary to their corresponding chains of the target double-stranded polynucleotide. The mixture is first denatured at a higher temperature, and then the primers are annealed to the complementary sequences within the target polynucleotide molecule. After annealing, the primers are extended with a polymerase to form a pair of new complementary chains. The steps of denaturation, primer annealing, and polymerase extension can be repeated multiple times (referred to as thermal cycling) to obtain a high concentration of amplified fragments of the desired target polynucleotide. The length of the amplified fragment (amplicon) of the desired target polynucleotide is determined by the relative position of the primers relative to each other, and therefore the length is a controllable parameter. By repeating this process, the method is referred to as PCR. Because the desired amplified segments of the polynucleotide of interest become the predominant nucleic acid sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified." In a modification of the methods discussed above, a plurality of different primer pairs, in some cases one or more primer pairs per target nucleic acid molecule of interest, can be used to PCR amplify the target nucleic acid molecules, thereby forming a multiplex PCR reaction.

[0121] As defined herein, "multiplex amplification" refers to the use of at least one target-specific primer to selectively and non-randomly amplify two or more target sequences in a sample. In some embodiments, multiplex amplification is performed so that some or all target sequences are amplified in a single reaction vessel. A given "multiplex" or "plex" of multiplex amplification generally refers to the number of different target-specific sequences amplified during the single multiplex amplification. In some embodiments, the multiplex can be about 12-fold, 24-fold, 48-fold, 96-fold, 192-fold, 384-fold, 768-fold, 1536-fold, 3072-fold, 6144-fold or higher. It is also possible to hybridize with several different methods (e.g., gel electrophoresis, followed by optical density determination, quantification with a bioanalyzer or quantitative PCR, hybridization with labeled probes; incorporation of biotinylated primers, followed by avidin-enzyme conjugate detection; 32 The amplified target sequence is detected by incorporating P-labeled deoxynucleotide triphosphates into the amplified target sequence.

[0122] As used herein, "amplified target sequence" and its derivatives generally refer to a nucleic acid sequence generated by amplifying a target sequence using target-specific primers and methods provided herein. The amplified target sequence can be the same sense (i.e., positive strand) or antisense (i.e., negative strand) relative to the target sequence.

[0123] As used herein, the terms "connection", "joining" and their derivatives generally refer to the process of covalently joining two or more molecules together, such as the process of covalently joining two or more nucleic acid molecules to each other. In some embodiments, the connection includes a nick joined between adjacent nucleotides of the nucleic acid. In some embodiments, the connection includes forming a covalent bond between the end of a first nucleic acid molecule and the end of a second nucleic acid molecule. In some embodiments, the connection may include forming a covalent bond between a 5' phosphate group of a nucleic acid and a 3' hydroxyl group of a second nucleic acid, thereby forming a connected nucleic acid molecule. Typically, for the purposes of this disclosure, an amplified target sequence can be connected to a joint to produce a joint-connected amplified target sequence.

[0124] As used herein, "ligase" and its derivatives generally refer to any reagent capable of catalyzing the connection of two substrate molecules. In some embodiments, ligases include enzymes capable of catalyzing the joining of nicks between adjacent nucleotides of a nucleic acid. In some embodiments, ligases include enzymes capable of catalyzing the formation of a covalent bond between a 5' phosphate of one nucleic acid molecule and a 3' hydroxyl of another nucleic acid molecule to form a connected nucleic acid molecule. Suitable ligases may include, but are not limited to, T4 DNA ligase, T4 RNA ligase, and E. coli DNA ligase.

[0125] As used herein, "connection conditions" and their derivatives generally refer to conditions suitable for connecting two molecules to each other. In some embodiments, the connection conditions are suitable for sealing the nick or gap between the nucleic acids. As used herein, the term nick or gap is consistent with the use of the term in the art. Typically, the nick or gap can be connected at a suitable temperature and pH in the presence of an enzyme (e.g., a ligase). In some embodiments, T4 DNA ligase can connect the nick between the nucleic acids at a temperature of about 70-72°C.

[0126] As used herein, the term "flow cell" refers to a chamber comprising a solid surface through which one or more fluid reagents can flow. Examples of flow cells and associated fluid systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456: 53-59 (2008), WO 04 / 018497; US 7,057,026; WO 91 / 06678; WO 07 / 123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281 and US2008 / 0108082.

[0127] As used herein, the term "amplicon" refers to the product of replicating nucleic acid when used to refer to nucleic acid, wherein the product has a nucleotide sequence identical or complementary to at least a portion of the nucleotide sequence of the nucleic acid. Amplicon can be produced by any of a variety of amplification methods using nucleic acid or its amplicon as a template, including, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), connection extension or connection chain reaction. Amplicon can be a nucleic acid molecule with a single copy (e.g., PCR product) of a specific nucleotide sequence or multiple copies of a nucleotide sequence (e.g., concatenation (concatameric) product of RCA). The first amplicon of a target nucleic acid is typically a complementary copy. Subsequent amplicon is a copy produced from the target nucleic acid or from the first amplicon after producing the first amplicon. Subsequent amplicon can have a sequence that is substantially complementary to the target nucleic acid or substantially identical to the target nucleic acid.

[0128] As used herein, the term "amplification site" refers to a site in or on an array that can produce one or more amplicons. An amplification site can be further configured to contain, retain or attach at least one amplicon produced at the site.

[0129] As used herein, the term "array" refers to a site population that can be distinguished from each other according to relative position. Different molecules in different sites of an array can be distinguished from each other according to the position of the site in the array. A single site of an array may include one or more molecules of a specific type. For example, a site may include a single target nucleic acid molecule with a specific sequence, or a site may include several nucleic acid molecules with the same sequence (and / or its complementary sequence). The sites of an array may be different features located on the same substrate. Exemplary features include, but are not limited to, holes in a substrate, beads (or other particles) in or on a substrate, projections of a substrate, ridges on a substrate, or channels in a substrate. The sites of an array may be separate substrates each with different molecules. Different molecules attached to a separate substrate may be identified according to the substrate position on the surface where the substrate is combined with it, or according to the substrate position in a liquid or gel. Exemplary arrays in which separate substrates are located on the surface include, but are not limited to, those with beads in holes.

[0130] As used herein, the term "capacity" when used to refer to a site and nucleic acid material refers to the maximum amount of nucleic acid material that can occupy the site. For example, the term can refer to the total number of nucleic acid molecules that can occupy the site under specific conditions. Other metrics can also be used, including, for example, the total mass of nucleic acid material that can occupy the site under specific conditions or the total copy number of a specific nucleotide sequence. Typically, the capacity of a site for a target nucleic acid is substantially equivalent to the capacity of a site for an amplicon of the target nucleic acid.

[0131] As used herein, the term "capture agent" refers to a material, chemical substance, molecule, or portion thereof that is capable of attaching, retaining, or binding to a target molecule (e.g., a target nucleic acid). Exemplary capture agents include, but are not limited to, capture nucleic acids (also referred to herein as capture oligonucleotides) that are complementary to at least a portion of a target nucleic acid, members of a receptor-ligand binding pair that is capable of binding to a target nucleic acid (or a linking portion attached thereto) (e.g., avidin, streptavidin, biotin, lectins, carbohydrates, nucleic acid binding proteins, epitopes, antibodies, etc.), or chemical reagents that are capable of forming a covalent bond with a target nucleic acid (or a linking portion attached thereto).

[0132] As used herein, the term "reporter portion" may refer to any identifiable tag, label, index, barcode or group that can determine the composition, identity and / or source of the analyte under study. In some embodiments, the reporter portion may include an antibody that specifically binds to a protein. In some embodiments, the antibody may include a detectable label. In some embodiments, the reporter may include an antibody or affinity reagent labeled with a nucleic acid tag. The nucleic acid tag may be detectable, for example, by proximity ligation assay (PLA) or proximity extension assay (PEA) or sequencing-based reads (Shahi et al., Scientific Reports, Vol. 7, Article number: 44447, 2017) or CITE-seq (Stoeckius et al. Nature Methods 14: 865-868, 2017).

[0133] As used herein, the term "clonal population" refers to a nucleic acid population that is homogeneous for a particular nucleotide sequence. Homologous sequences are typically at least 10 nucleotides long, but can be even longer, including, for example, at least 50, 100, 250, 500 or 1000 nucleotides long. A clonal population can be derived from a single target nucleic acid or template nucleic acid. Typically, all nucleic acids in a clonal population have the same nucleotide sequence. It should be understood that, without departing from clonality, a minority of mutations (e.g., due to amplification artifacts) may be present in a clonal population.

[0134] As used herein, the term "unique molecular identifier" or "UMI" refers to a molecular tag (random, non-random, or semi-random) that can be attached to a nucleic acid molecule. When incorporated into a nucleic acid molecule, the UMI can be used to correct for subsequent amplification bias by directly counting unique molecular identifiers (UMIs) sequenced after amplification.

[0135] As used herein, "providing" in the context of a composition, article, nucleic acid, or cell nucleus means preparing the composition, article, nucleic acid, or cell nucleus, purchasing the composition, article, nucleic acid, or cell nucleus, or otherwise obtaining the compound, composition, article, or cell nucleus.

[0136] The term "and / or" means one or all of the listed elements or a combination of any two or more of the listed elements.

[0137] The words "preferred" and "preferably" refer to embodiments of the present disclosure that may provide certain benefits in certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. In addition, the listing of one or more preferred embodiments does not mean that other embodiments are not applicable and is not intended to exclude other embodiments from the scope of the present disclosure.

[0138] The terms "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims.

[0139] It should be understood that whenever any embodiment is described herein using the language "comprising," "including," or "comprising," etc., additional similar embodiments described with "consisting of" and / or "consisting essentially of" are also provided.

[0140] Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one.

[0141] Also herein, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (eg, 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0142] For any method disclosed herein comprising discrete steps, the steps may be performed in any practicable order. Also, any combination of two or more steps may be performed simultaneously, where appropriate.

[0143] References throughout the specification to "one embodiment," "embodiment," "certain embodiments," or "some embodiments," etc., mean that a particular feature, configuration, composition, or characteristic described in conjunction with the embodiment is included in at least one embodiment of the present disclosure. Thus, the appearance of these phrases in various places throughout the specification are not necessarily referring to the same embodiment of the present disclosure. Furthermore, in one or more embodiments, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0144] The following detailed description of illustrative embodiments of the present disclosure is best understood when read in conjunction with the following drawing figures.

[0145] Figure 1A -B shows an overall block diagram of a general illustrative method for single-cell combinatorial indexing according to the present disclosure.

[0146] Figure 2 An overall block diagram of a general illustrative method for single-cell combinatorial indexing according to the present disclosure is shown.

[0147] Figure 3AF shows that sci-L3-WGS enables high-throughput, single-cell, linear whole-genome amplification. (A) Schematic diagram of the sci-L3-WGS workflow with three-level indexing. (B) Top: Barcode structure of the resulting amplified DNA duplex compatible with various library preparation methods. bc, barcode; sp, spacer; gDNA, genomic DNA. Middle: Example library structure of sci-L3-WGS. P5 and P7 sequencing adapters are added by A-tailing and ligation. Note that due to the symmetry of ligation, it is equally possible to have P7 at the UMI end and P5 at the gDNA end. Bottom: Example library structure of sci-L3-target-seq. P5 and P7 sequencing adapters are added by priming from spacer 2 (sp2) and the targeted target locus in the genome, respectively. Note that a new third-round barcode bc3' is also added by PCR corresponding to each bc3 in the WGS library, and a new UMI' is added in addition to bc3'. (C) Scatter plot of the number of unique Tn5 insertion sites from human and mouse cells at low sequencing depth, 24bc1 x 64bc2 x 6bc3 sci-L3-WGS, 100 to 300 cells sorted per well. Blue, inferred mouse cells (percentage of mouse reads >95%, median 98.7%, n=315); red, inferred human cells (percentage of human reads >95%, median 99.8%, n=719); gray, inferred conflicts (n=48, 4%). (D) Box plot of the number of unique Tn5 insertion sites per cell at an average of 2.4M raw reads per cell and 1.78x depth is shown. Depth is defined as the ratio between the number of unique IVT transcripts and the number of unique Tn5 insertion sites. Thick horizontal line, median; upper and lower box edges, first and third quartiles, respectively; whiskers, 1.5× interquartile range; circles, outliers. For characterization of libraries prepared using a modified version of this protocol see also Figure 5 and Example 2, section “Methods and Molecular Design of sci-L3-WGS and sci-L3-target-seq”. (E) Example chromosome copy number variation (CNV) plots for individual cells. Top, HEK293T cells, 2.6M raw reads, 2.4M unique molecules, 1.3M unique Tn5 insertion sites, MAPQ>1. Bottom, 3T3 cells, 2.7M raw reads, 2.4M unique molecules, 1.2M unique Tn5 insertion sites, MAPQ>1. (F) Box plots of copy number variation across 822 293T cells or 1,453 HAP1 cells. The Y axis represents the fraction of reads per chromosome normalized by chromosome length, such that euploid chromosomes with no segmental copy gain or loss are expected to have a value of 1.

[0148] Figure 4AF shows the molecular structure of sci-LIANTI in each step. Dashed line: RNA, solid line: DNA. (A) Both 5' ends of the Tn5 adapter are phosphorylated, one end is required for insertion and the other is required for ligation. The overhang of the annealed transposon contains the first-round barcode ("bc1") and the spacer ("sp1") for ligation. (B) The ligated molecules are pre-annealed as a hairpin loop, which reduces the intermolecular ligation from three molecules to two molecules; the hairpin structure also helps to improve the RT efficiency of the downstream step. The hairpin contains 1) an overhang annealed with "sp1" for ligation, 2) a second-round barcode ("bc2") and a spacer ("sp2"), which is used as a priming site in the stem for SSS in the downstream step, and 3) a T7 promoter in the loop for IVT. (C) Gap extension converts the circular T7 promoter into a duplex. Note that if the ligation is successful at both ends, the T7 promoter is present on both sides; however, if the ligation is successful at one end, the framed portion will be missing. However, both can be reverse transcribed using different RT primers in the downstream step. (D) IVT produces a single-stranded RNA amplicon downstream of the T7 promoter. (E) If the ligation is successful at both ends, the RT is preferably primed by the self-circular RT primer, which is inherited from the circular ligated molecule; if the ligation is successful only at one end, the RT is primed by an additional RNA RT primer added in excess. The excess RNA primer is then removed before SSS to avoid interfering with the subsequent SSS reaction. (F) Double-stranded DNA molecules are generated by SSS, which primes off from "sp2" to simultaneously add a third round of barcodes and UMI tags to each transcript. Example 2, "Methods and Molecular Design of sci-L3-WGS and sci-L3-Target-seq" section provides a more detailed description.

[0149] Figure 5AG shows the number of reads in different sci-L3-WGS experiments and at different Tn5 transposome concentrations. Box plots showing the number of unique Tn5 insertion sites per cell at the indicated depths. Depth is defined as the ratio between the number of unique IVT transcripts and the number of unique Tn5 insertion sites. Thick horizontal line, median; upper and lower box edges, first and third quartiles, respectively; whiskers, 1.5 times the interquartile range; circles, outliers. Concentrated Tn5 transposome: 0.2 μM, diluted Tn5 transposome: 0.1 μM. (A) Human vs. mouse unique reads (median human unique reads: 215k, n=115 cells; median mouse unique reads: 169k, n=44) of yi128 with concentrated Tn5 (median unique reads: 215k) vs. diluted Tn5 (median unique reads: 46k) of human unique reads. (B) Human unique reads of yi129 (median depth: 1.78x) with concentrated Tn5 (median unique reads: 635k) vs. diluted Tn5 (median unique reads: 183k). Mouse unique reads are presented in Figure 3D. (C) yi140 and yi141 with concentrated Tn5 (median depth: 1.37x; median human unique reads: 660k). See also Table 2 and Example 2. (D) yi144 and yi145 with concentrated Tn5 (median depth: 1.05x; median human unique reads: 97.3k). See also Table 2. Note that yi140, yi141, yi144, and yi145 are libraries with the optimization scheme discussed in Example 2. (E) yi174 with concentrated Tn5 (median depth: 1.06x) human / mouse unique reads (median human unique reads: 100k, n=103; median mouse unique reads: 23k, n=35); human unique reads with concentrated Tn5 (median unique reads: 100k) and diluted Tn5 (median unique reads: 54k). (F) Library of mouse germ cells: yi186, yi187, yi188 were prepared with diluted Tn5; yi190, yi192, yi193 were prepared with concentrated Tn5. (G) Number of unique Tn5 insertion sites as a function of sequencing depth. The blue and red lines show sci-L3-WGS with and without RNA RT primers (Example 2), respectively. Unique insertions of yi129 (as in panel B, median depth: 1.78x) with enrichment (median unique insertions: 635k). When projected to 5x and 10x depths, the expected number of unique insertions is 1.9M and 2.6M, respectively. The median depth of yi140 and yi141 combination is 1.37x, and the median unique insertion is 660k. When projected to 1.78x, 5x, and 10x depths, the expected number of unique insertions is 1.5M, 4.2M, and 6.0M, respectively.

[0150] Figure 6AE shows that Sci-L3-based RNA / DNA co-analysis can jointly achieve high-throughput and linear amplification for the genome and transcriptome from the same single cell. (A) Schematic diagram of the sci-L3-RNA / DNA co-analysis workflow with three-level indexing. Note that the Tn5 transposon and cDNA synthesis primers contain the same phosphorylated ligation landing pad (pink) at the 5' overhang outside the first round of barcodes. (B) Barcode structure of the resulting amplified duplexes corresponding to the genome and transcriptome (left and right, respectively) compatible with various library preparation methods. bc, barcode; sp, spacer; gDNA, genomic DNA. (C) Scatter plot of the number of unique Tn5 insertion sites from human and mouse cells at low and high sequencing depths, 24bc1 x 64bc2 x 6bc3 sci-L3-RNA / DNA co-analysis, 100 to 300 cells sorted per well, drawn together. Blue, inferred mouse cells (percentage of mouse reads >95%, median 99.5%, n=2002); red, inferred human cells (percentage of human reads >95%, median 99.8%, n=2419); gray, inferred conflicts (n=149, combined low and high depth 6.6%; 5 / 270, high depth 3.7%). (D) Same as (C) for RNA. Blue, inferred mouse cells (median purity of mouse reads 95.1%); red, inferred human cells (median purity of human reads 91.5%); gray, inferred conflicts (n=272, combined low and high depth 12%; 7 / 270, high depth 5.2%). (E) Seurat with RNA-seq signals shows distinct clusters corresponding to BJ-5ta human skin fibroblasts (male) and HEK293T cells (female). 988 / 1024 cells (96.5%) were correctly assigned based on the presence or absence of a Y chromosome.

[0151] Figure 7AE shows mitosis / equal and meiosis / reductive chromosome segregation with and without exchange. Each vertical segment represents a chromatid (DNA strands not shown). Black and blue represent homologs. Ovals represent centromeres. Note that mouse chromosomes are acrocentric. Gray crosses represent exchange sites after DNA replication at stage 4C. Red boxes represent heterozygous mitotic daughter cells, while black and blue boxes represent daughter cells of meiosis I (MI) that are homozygous for the corresponding strain background at the proximal region of the centromere. LOH regions in daughter cells are marked by curly brackets. (A) Mitosis / equal segregation, no exchange. Both daughter cells retain heterozygosity. (B) Mitosis / equal segregation, with exchange between homologs. The recombined chromatids separate separately, resulting in LOH distal to the exchange centromere. (C) Mitosis / equal segregation, with exchange between homologs. The recombined chromatids separate together so that two daughter cells remain heterozygous, but one daughter cell has a linkage switch. (D) Meiosis / segregation with exchange leads to LOH at the proximal end of the exchanged centromere, which is different from (B). (E) Meiosis / segregation without exchange leads to mutual uniparental disomy (UPD) in daughter cells. Note that MI with equal chromosome separation is similar to (B) and (C). In the text, since our research mainly focuses on MI, the expected meiosis / segregation during MI (wherein sister chromatids separate together) is referred to as "segregation", and the unexpected mitosis-like / equal separation during MI (wherein sister chromatids separate separately) is referred to as "equal separation".

[0152] Figure 8AG shows sperm and sperm precursors and their ploidy by FACS. (A) Visualization of B6 sperm. (B) Visualization of (B6x Spret) F1 sperm. We observed a low number of round germ cells of unknown ploidy and very few morphologically mature sperm (arrows). (C) (B6 x Spret) F1 sperm and sperm precursors isolated from the epididymis unexpectedly contain a large proportion of 2C cells. DAPI voltage is 375. (D) HEK293 / Patski mixture, DAPI voltage is 350. Due to the lower DAPI voltage, the Patski peak (2C) is slightly shifted to the left relative to the 2C peak in (C). (E) (B6x Cast) F1 sperm isolated from the epididymis consists almost entirely of 1C cells. DAPI voltage is 375. (F) (B6x Cast) F1 sperm precursors, pre-sorted for 2C cells from dissociated testes; a large number of 1C cells are still present. DAPI voltage is 375. (G) (B6 x Cast) F1 sperm and sperm precursors at the FACS step (after two rounds of barcoding) in the Sci-L3-WGS process are still primarily composed of 1C cells. Based on the proportion of contaminating 1C nuclei in the pre-sorted 2C nuclei from (F), we estimated that the proportion of tagged nuclei that were 2C was 18%, a 7.2-fold enrichment relative to the 2.5% 2C nuclei in homogenized testes. We sorted from the 2C population (about 15.4% of all cells, similar to the 18% estimated for the tagging step). DAPI voltage was 375.

[0153] Fig. 9 AF demonstrates that sci-L3-WGS of interspecific hybrid mouse male germlines revealed many instances of non-independent equal segregation in MI. In (A), (B), and (C), the red lines depict the fitted crossover transitions through the HMM. The centromere is located at the far left of the image for each chromosome. (A) Example crossover plot for 1C cells. Grey dots have a value of 1 for the Spret allele, and a value of 0 for the B6 allele. In (B) and (C), the grey dots show the allele frequency for Spret, averaged across 40 SNP sites. (B) Example LOH plot for M2 cells with mitotic segregation (see also Figure 7 D) LOH is present in the centromere-proximal region of the crossover site. (C) Example LOH plot for an M2 cell with equal segregation (see also Figure 7(B). LOH is present in the centromeric-distal region of the exchange site, unlike in (B). (DF) Number of meiotically (red, pink, black) and equally (blue, green) segregated chromosomes per M2 cell. Each column represents a single M2 cell (19 chromosomes per cell, distributed as indicated by color). (D) Expected distribution of meiotically segregated vs. equally segregated based on the binomial distribution and assuming that the probability of meiotically segregated p is equal to 0.76 (MLE from the observed data). (E) Observed data in M2 cells. In rare cases (27 / 5,548 chromosomes), we cannot distinguish meiotically segregated vs. equally segregated due to sporadic SNP coverage (blank space at top of graph). The black bars depict MI nondisjunction (NDJ, 40 chromosomes total), in which we observe either 0 or 4 copies of a chromatid. Note that NDJ is considered meiotically segregated because sister chromatids segregate together. (F) Same as (E), but further subdivided according to the number of chromosomes with or without exchange (abbreviated "CO"). Cells are sorted first by the number of equally segregated chromosomes (light green and blue, descending), and then by the number of equally segregated chromosomes observed in the absence of crossover (blue, descending).

[0154] Fig.10 AG shows meiotic crossovers and the distribution of uniparental chromosomes on a chromosome scale. (A) After normalization for chromosome size, the number of haploid cells with at least one crossover per chromosome is negatively correlated with chromosome size (r = -0.87, p = 2e-6). (B6 x Spret) crosses are shown. For (B6 x Cast) crosses see Fig.14 C. (B) Same as (A) for M2 cells (r = -0.91, p = 8e-8). For (B6 x Cast) hybridization see Fig.14 D. (C) Distribution of crossover (CO) counts per chromosome per haploid cell (mean = 0.62 for (B6 x Spret) and mean = 0.58 for (B6 x Cast). (D) Same as (C) for M2 cells (mean = 0.92 for (B6 x Spret) and mean = 1.03 for (B6 x Cast). (E) For chromosomes with at least two crossovers, the distribution of the expected number of crossovers for all chromosomes. Distribution of the expected number generated by randomly placing 2 crossovers per chromosome. (B6 x Spret) crossovers are shown. For (B6 x Cast) crossovers see Fig.14E. (F) Number of UPD and LOH events (top) and chromosome distribution (bottom) in Patski cells. (G) Resolved mitochondrial copy number (normalized) for M2 cells, where most chromosomes segregate relative to equal segregation. (B6 x Spret) hybridization.

[0155] Fig.11 AE shows that sci-L3-WGS of intraspecific hybrid mouse male germline also reveals many examples of non-independent equal segregation. (AB) The number of chromosomes separated by reduction (red) and equal (blue) separation of artificial "2C" cells from barcode group 1, which originates from the double peak of two random 1C cells. Each column represents a single 2C cell (19 chromosomes per cell, distributed as shown in color). (A) Based on the binomial distribution and assuming that the probability of equal separation p is equal to 0.5, the expected distribution of reduction vs. equal separation. (B) Observed data in 2C cells, which matches the expected distribution shown in (A). (CE) For the number of chromosomes separated by reduction (red, pink, black) and equal (blue, green) separation of non-1C cells from barcode group 2, it is a mixture of artificial doubles of two random 1C cell nuclei and actual 2C secondary spermatocytes. Each column represents a non-1C single cell (19 chromosomes per cell, distributed as shown by color). (C) All non-1C cells from barcode group 2. (D) Non-1C cells with only biased chromosome segregation, i.e., at least 15 chromosomes segregate equally or reductively. The black bar depicts meiosis I nondisjunction (NDJ, 2 of 2185 chromosomes), where we observe 0 or 4 copies of chromatids. (E) Same as (D), but further broken down by the number of chromosomes with or without exchange (abbreviated as "CO"). Cells are first sorted by the number of equally segregated chromosomes (light green and blue, descending), and then by the number of equally segregated chromosomes observed without exchange (blue, descending).

[0156] Fig.12 AC shows fitted finite mixture models with three binomial distributions (top) compared to observed data from sci-L3-WGS of mouse male germline (bottom). See Example 2 for details on mixture modeling. (A) Mixture modeling of non-1C cells from barcode set 1 in (B6 x Cast) hybrids. (B) Mixture modeling of non-1C cells from barcode set 2 in (B6 x Cast) hybrids. (C) Mixture modeling of 2C cells from (B6 x Spret) hybrids.

[0157] Fig.13AI shows meiotic crossovers and the distribution of uniparental chromosomes on a chromosomal scale. (A) The number of crossovers normalized by chromosome size (cM / Mb) is negatively correlated with chromosome size in haploid cells (r = -0.66, p = 0.002). (B6 x Spret) crossovers are shown. (B6 x Cast) crossovers are shown in Fig.14 A. (B) Same as (A) for M2 cells (r = -0.83, p = 1e-5). (B6 x Spret) hybridization is shown. For (B6 x Cast) hybridization see Fig.14 B. (C) Distribution of exchange (CO) frequencies per chromosome per haploid cell. For the distribution of counts, see Fig.10 C. (D) Same as (C) for M2 cells. Distribution of counts see Fig.10 D. (E) Distances (Mb) between crossovers for chromosomes 1, 2, 12, and 13 for chromosomes with at least two crossovers. For all chromosomes see Fig.10 E. (B6 x Spret) hybridization is shown. (B6 x Cast) hybridization see Fig.14 E. Distribution of expected counts generated by randomly placing 2 crossovers per chromosome. Box plots show that (B6 x Cast) crosses have stronger crossover interference than (B6 x Spret) crosses (p = 5e-91). (F) Histogram of the number of uniparental chromosomes per haploid (median = 8, mean = 8.1), M2 cells (median = 1, mean = 1.1), or other diploid / 4C (median = 0, mean = 0.4) cells. (B6 x Spret) crosses are shown. (B6 x Cast) crosses see Fig.14 F. (G) Distribution of uniparental chromosomes in haploid (r = -0.87, p = 2e-6), M2 cells (r = -0.75, p = 2e-4) and other diploid / 4C (r = -0.68, p = 0.001) cells. (B6 x Spret) hybrids are shown. (B6 x Cast) hybrids see Fig.14 G. (H) Chromosomal distribution of reverse segregation events in (B6 x Spret) (left) and (B6 xCast) (right) hybridizations. (I) Number of mitochondrial reads per cell, normalized by read depth, for haploid, M2 cells and other diploid / 4C diploid cells. (B6 x Spret) hybridizations.

[0158] Fig.14AG shows the chromosome distribution of meiotic crossovers and UPD, (B6 x Cast). (A) The number of crossovers normalized by chromosome size (cM / Mb) is negatively correlated with chromosome size in haploid cells (r = -0.65, p = 0.003). (B6 x Cast) hybrid. (B) Same as (A) in M2 cells (r = -0.9, p = 2e-7). (B6 x Cast) hybrid. (C) The number of haploid cells with at least one crossover per chromosome is negatively correlated with chromosome size after normalization for chromosome size (r = -0.85, p = 5e-6). (B6 x Cast) hybrid. (D) Same as (C) for M2 cells (r = -0.94, p = 3e-9). (B6 x Cast) hybrid. (E) For chromosomes with at least two crossovers, the crossover distances for all chromosomes. The distribution of the expected number was generated by randomly placing 2 crossovers per chromosome. (B6 x Cast) hybrid. (F) Number of uniparental chromosomes per haploid (median = 8, mean = 8.9) and M2 cells (median = 0, mean = 0.54). (B6 x Cast) hybrid. (G) Distribution of uniparental chromosomes (relative to chromosome size shown in parentheses) for haploid (r = -0.8, p = 4e-5) and M2 cells (r = -0.45, p = 0.05). (B6 x Cast) hybrid.

[0159] Fig.15 AC shows the stacking distribution of exchange breakpoints. (A) From top to bottom: Meiotic DSB hotspots for B6, Cast, and (B6 x Cast) F1 hybrids by SSDS maps, exchange maps for (B6 x Spret) and (B6 x Cast) generated in this study. See (B) and (C) for haploid vs. M2 cell breaks and Spol1-oligo maps. (B) From top to bottom: 1) Meiotic DSB hotspot map for (B6 x Cast) F1 hybrids by SSDS, 2) haploid exchange map in (B6 x Cast), and 3) exchange map of M2 cells in (B6 x Cast). (C) From top to bottom: 1) Meiotic DSB hotspots by Spo11-oligo map with "symmetric" hotspots, 2) Meiotic DSB hotspots by Spo11-oligo map with all hotspots: PRDM9 motifs are not considered. 3) Haploid exchange map in (B6x Spret), and 4) M2 cell exchange map in (B6 xSpret).

[0160] Fig.16AF shows meiotic crossover heat and explanatory genomic features. (A) Marginal inclusion probability for features associated with crossover heat by BMA. The x-axis ranks models by posterior probability, with grey boxes depicting features not included in each model (vertical lines, top 20 models shown), and the orange scale depicting the posterior probability of the model. Shown here is a combined dataset of the (B6 x Spret) and (B6 x Cast) crosses. For the two crosses analyzed separately see Fig.15 . (B) Size distribution (lognormal distribution) for breakpoint resolution. Left: (B6 x Spret), median 150 kb. Right: (B6 x Cast), median 250 kb. (CD) Position of the rightmost exchange on each chromosome. The length of the chromosome is indicated by the range of the rightmost SNP (black bar) rather than the red line. (C) M2 cells. Exchanges in (B6 x Cast) (left) hybrids favor the centromere-distal ends of chromosomes, while exchanges in (B6 x Spret) hybrids (right) favor the mid-region of each chromosome arm. After accounting for inter-chromosomal variability, we estimate that exchanges in (B6 x Spret) hybrids are on average 5.5 Mb more proximal to the centromere. See Fig. 20 A, which is similar, but for 1C cells. (D) Comparison of 1C and M2 cells, (B6 x Spret) hybridization. After accounting for interchromosomal variability, we estimate that in the (B6 x Spret) hybridization, the crossovers in M2 cells (right) are on average 9.4 Mb more proximal to the centromere in 1Cs (left). The same trend is observed for the lower program in the (B6 x Cast) hybridization (see Fig. 20 (B). (E) An AUC of 0.73 quantifies the expected accuracy of predictions if the region extracted from the mouse genome is from the B6 x Spret exchange locus or an equal number of randomly sampled loci. Left: All 76 features. Right: A subset of 25 features with MIP>0.5 from BMA. (F) An AUC of 0.85 quantifies the expected accuracy of predictions if the region extracted from the mouse genome is from the B6 x Cast exchange locus or an equal number of randomly sampled loci. Left: All 69 features. Right: A subset of 25 features with MIP>0.5 from BMA.

[0161] Fig.17 AB shows the marginal inclusion probability of features associated with exchange heat by BMA. The x-axis ranks the models by posterior probability. (A) (B6 x Cast) hybrid. (B) (B6 x Spret) hybrid.

[0162] Fig.18The correlation matrix of exchange events and genomic features in the (B6 x Cast) crossover is shown. Here we show all possible pairwise correlations between various exchange accumulation tracks and genomic features calculated over a 100kb window. The exchange accumulation tracks are the first five columns or rows ("event" prefix; red text markers), while the rest are the same genomic features used in modeling (blue text markers). The exchange accumulation tracks with the suffixes "hp_m2", "hp", "m2", "mt" and "me" are from haploid and M2 cells, haploid, M2 cells, M2 cells with biased equal segregation, and M2 cells with biased meiotic segregation, respectively. Blue squares indicate positive correlations, and red squares indicate negative correlations. Features are sorted by hierarchical clustering. The hollow ovals highlight the features "telomere" and "quantile_75_100", which show different trends in the two crossovers as described in the text.

[0163] Fig.19 The correlation matrix of crossover events and genomic features in the (B6 x Spret) cross is shown. Fig.18 The format is the same as described in the legend.

[0164] Fig. 20 AE shows the position of the right-most exchange on each chromosome. (A) Haploid cells. In both crosses, the exchange favors the centromere-distal end of the chromosome. (B) Comparison of haploid and M2 cells (B6 x Cast cross). After accounting for inter-chromosomal variability, we estimate that in the (B6 x Cast) cross, the exchange in M2 cells is an average of 5.2 Mb more proximal to the centromere than in haploids. (C) Comparison of M2 cells with biased chromosome segregation. After accounting for inter-chromosomal variability, we estimate that in the (B6 x Cast) cross, the exchange in M2 cells with biased equal segregation is an average of 13.7 Mb more distal to the centromere than in M2 cells with biased meiotic segregation. (D) Same as in (C) in the (B6 x Spret) cross. The exchange is an average of 8.7 Mb more distal to the centromere. (E) Model of the effect of the position of the exchange on proper chromosome segregation. Exchanges closer to the centromere (in the middle two quartiles rather than the last quartile) may promote meiotonic segregation by having stronger arm cohesion; however, exchange closer to the ends of chromosome arms may promote MII segregation by having stronger CEN cohesion.

[0165] Fig.21A principal component analysis of features distinguishing crossover hotspots in a B6 x Spret crossover is shown. Note that "chr3_bp (breakpoint)" and "chr1_upc (uniparental chromosome)" represent features included for all chromosomes. We show 44 of 115 total features. In addition to the 36 other chromosome breakpoint and UPC features that were omitted, 35 other features are not shown due to lack of clear trends.

[0166] Fig. 22 A principal component analysis of features distinguishing crossover hotspots for the B6 x Cast hybrid is shown. Note that "chr3_bp (breakpoint)" and "chr1_upc (uniparental chromosome)" represent features included for all chromosomes. We show 19 of the 108 total features. In addition to the 36 other chromosome breakpoint and UPC features that were omitted, 53 other features are not shown due to lack of clear trends.

[0167] Fig.23 A model for the relationship between meiotic crossover and chromosome missegregation is shown. "MI": Meiosis I, "CEN": Centromere (oval or circular), "IH": Interhomologs. The following detailed description of illustrative embodiments of the present disclosure may be better understood when read in conjunction with the following drawings.

[0168] The schematic diagrams are not necessarily drawn to scale. The same numbers used in the drawings refer to the same components, steps, etc. However, it should be understood that the use of numbers to refer to components in a given figure is not intended to limit the components marked with the same numbers in another figure. In addition, the use of different numbers to refer to components is not intended to limit the indication that the components with different numbers cannot be the same or similar to the components with other numbers. DETAILED DESCRIPTION

[0169] The method provided herein can be used to generate a single cell combined index (sci) sequencing library of multiple single cells or cell nuclei, including, for example, whole genome (sci-WGS), transcriptome (sci-RNA), genome and transcriptome co-analysis (sci-DNA / RNA) and / or methylation group (sci-MET). In one embodiment, the method can be used for targeted sequencing of one or more specific target regions. For example, primers hybridized with a specific region (e.g., coding region, non-coding region, etc.), guide RNA, or nucleotide sequences inserted by guide RNA can be used to selectively enrich for targeted sequences. In one embodiment, information (Perturb-seq) about individual gene editing, DNA, editing or markers for editing, gene signatures, perturbations and / or functional read fragments (RNA, DNA, proteins or combinations) from cells or cell nuclei can be collected and analyzed. In other embodiments, the method can be used to assess chromatin accessibility (sci-ATAC), chromatin conformation (Hi-C) and other single cell combined indexing methods.

[0170] The method comprises providing isolated nuclei or cells, distributing subsets of the nuclei or cells into compartments, treating the nuclei or cells to contain nucleic acid fragments, adding compartment-specific indices to the nucleic acid fragments, and amplifying the nucleic acid fragments by linear amplification. These steps can occur in different orders and can be combined in different ways. Figure 1A and 1B Three embodiments are shown. In one embodiment, the method comprises providing a distributed subset of isolated cell nuclei or cells containing nucleic acid fragments ( Figure 1A , Box 1, and Figure 1B , Box 1). Figure 1A -B, a nucleic acid fragment is amplified by linear amplification ( Figure 1A , Box 2) and then add indexes to the amplified nucleic acid fragments ( Figure 1A , Box 3). Figure 1B As shown in , the nucleic acid fragments in the distributed cell nuclei or cells include an index, and the nucleic acid fragments are amplified by linear amplification ( Figure 1B , Box 2). Described herein are steps of providing isolated nuclei or cells, distributing subsets of the isolated nuclei or cells, processing the isolated nuclei or cells to include nucleic acid fragments, adding compartment-specific indices, and amplifying the nucleic acid fragments by linear amplification.

[0171] Provide isolated nuclei or cells

[0172] The method provided herein includes providing cells or isolated nuclei from multiple cells. The cells and nuclei can be from any sample, such as any organism, and from any cell type or any tissue of an organism. In one embodiment, the cell can be a reproductive cell, such as a sperm cell or an egg cell. In one embodiment, the tissue can be a reproductive tissue, such as an epididymis. In one embodiment, the cell or nucleus can be from a cancer or diseased tissue. The method may further include dissociating cells and / or isolating nuclei. Methods for isolating nuclei from cells are known to those skilled in the art and are conventional. The number of nuclei or cells can be at least two. The upper limit depends on the actual limitations of the equipment (e.g., multiwell plate) used in other steps of the method described herein. The number of nuclei or cells that can be used is not intended to be limited, and can reach billions. For example, in one embodiment, the number of nuclei or cells can be no more than 100,000,000, no more than 10,000,000, no more than 1,000,000,000, no more than 100,000,000, no more than 10,000,000, no more than 1,000,000, no more than 100,000, greater than 10,000, no more than 1,000,000, no more than 100,000, greater than 10,000, no more than 1,000, no more than 500 or no more than 50. One or more samples can be provided. For example, a sample can be a cell type or tissue from an organism. Using the indexing methods described herein, multiple samples, such as different cell types from an organism, a cell type or tissue from two or more organisms, or different cell types or tissues from two or more organisms, can be indexed individually with a first index to identify samples, and then combined. One skilled in the art will recognize that in some embodiments, the nucleic acid molecules in each cell nucleus represent the entire genetic complement of the organism (also referred to as the organism's complete genome), and are genomic DNA molecules that include intron and exon sequences as well as non-coding regulatory sequences such as promoter and enhancer sequences.

[0173] Cell nuclei separation can be accomplished by incubating the cells in a cell lysis buffer for at least 1 to 20 minutes, such as 5, 10 or 15 minutes. Optionally, the cells can be exposed to an external force to assist in lysis, such as by the movement of a pipette. Examples of cell lysis buffers include 10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630, and 1% SUPERase In RNase inhibitor. The skilled person will recognize that these levels of components can be slightly changed without reducing the effectiveness of the cell lysis buffer for separating nuclei. The skilled person will recognize that RNase inhibitors, BSA, and / or surfactants may be useful in buffers for separating nuclei, and other additives may be added to the buffer for other downstream single cell combination indexing applications.

[0174] In one embodiment, the nucleus is separated from a single cell that is adhered or suspended. Methods for separating the nucleus from a single cell are known to those of ordinary skill in the art. In one embodiment, the nucleus is separated from a cell in a tissue. The method for obtaining the separated nucleus generally comprises preparing the tissue and separating the nucleus from the prepared tissue. In one embodiment, all steps are performed on ice.

[0175] Tissue preparation can include quick freezing the tissue in liquid nitrogen, and then subjecting the tissue to mincing or blunt force to reduce the size of the tissue to a block with a diameter of 1 mm or less. Optionally, cold proteases and / or other enzymes that destroy cell-cell connections can be used. Mincing can be accomplished with a blade to cut the tissue into small pieces. Applying blunt force can be achieved by smashing the tissue with a hammer or similar object, and the resulting composition of the smashed tissue is referred to as a powder.

[0176] Conventional tissue cell nuclear extraction techniques typically incubate the tissue with a tissue-specific enzyme (e.g., trypsin) at high temperature (e.g., 37° C.) for 30 minutes to several hours, and then lyse the cells with a cell lysis buffer for cell nuclear extraction. The cell nuclear isolation method described herein and in U.S. Provisional Patent Application No. 62 / 680,259 has several advantages: (1) No artificial enzymes are introduced, and all steps are completed on ice. This reduces potential disturbances to cell states (e.g., transcriptome states, chromatin states, or methylation states). (2) This has been validated in most tissue types including brain, lung, kidney, spleen, heart, cerebellum, and disease samples (e.g., tumor tissue). Compared to conventional tissue cell nuclear extraction techniques that use different enzymes for different tissue types, this new technology can potentially reduce bias when comparing cell states from different tissues. (3) The method also reduces costs and improves efficiency by eliminating the enzyme treatment step. (4) Compared with other cell nucleus extraction techniques (e.g., Dounce tissue grinder), this technique is more stable to different tissue types (e.g., the Dounce method requires optimization of Dounce cycles for different tissues) and can process large samples with high throughput (e.g., the Dounce method is limited by the size of the grinder).

[0177] An isolated nucleus or cell may include nucleosomes, may be nucleosome-free, or may be subjected to conditions that deplete the nucleus of nucleosomes to produce a nucleosome-depleted nucleus. The nucleosome-depleted nucleus may be used in a method of determining the DNA sequence of the entire genome of a cell or a portion thereof.

[0178] In one embodiment, the conditions for nucleosome depletion maintain the integrity of the isolated nuclei. Typically, the nucleosome depletion method is used on a pellet or suspension of single cells, so in those embodiments where adherent cell cultures or tissues are used as a source of cells, the source is processed to obtain a pellet or suspension of single cells.

[0179] Methods for nucleosome depletion are known and conventional, and include, but are not limited to, enzymatic and chemical treatments. In one embodiment, conditions for nucleosome depletion include chemical treatment with a chaotropic agent capable of disrupting nucleic acid-protein interactions. Examples of useful chaotropic agents include, but are not limited to, lithium 3,5-diiodosalicylate. Conditions for using lithium 3,5-diiodosalicylate include adding it to the cell pellet and incubating on ice.

[0180] In a preferred embodiment, the conditions include chemical treatment with a detergent capable of disrupting nucleic acid-protein interactions. Examples of useful detergents include, but are not limited to, sodium dodecyl sulfate (SDS). Conditions using SDS include adding it to the cell pellet and incubating at an elevated temperature (e.g., 42° C.) followed by the addition of a non-ionic detergent (e.g., TritonTM X-100) and incubated at high temperature (e.g., 42°C).

[0181] In some embodiments, when a detergent such as SDS is used, the nuclei are exposed to a crosslinking agent prior to nucleosome depletion (WO 2018 / 018008). In one embodiment, the nuclei are exposed to the crosslinking agent while inside the cell, while in another embodiment, the isolated nuclei are exposed to the crosslinking agent. Useful examples of crosslinking agents include, but are not limited to, formaldehyde (Hoffman et al., 2015, J. Biol. Chem., 290: 26404-26411). Treating cells with formaldehyde may include adding formaldehyde to a cell suspension and incubating at room temperature. In one embodiment, after formaldehyde treatment, the nuclei may be exposed to glycine and a non-ionic, non-denaturing detergent, such as

[0182] In the process of depleting the nucleosome of the separated nucleus, the integrity of the separated nucleus is maintained. The state of the nucleus can be determined by conventional methods (e.g., phase contrast imaging) to visualize whether the nucleus remains intact after being exposed to the conditions for nucleosome depletion. In one embodiment, the number of complete nuclei after nucleosome depletion can be 1 to 1,000, 1,000 to 10,000, 10,000 to 100,000, 100,000 to 1,000,000, 1,000,000 to 10,000,000 or 10,000,000 to 100,000,000.

[0183] The operation of the nucleus or cell, including providing, converging and distributing steps as described herein, may include using a nucleus buffer. Examples of nucleus buffers include 10mM Tris-HCl, pH 7.4, 10mM NaCl, 3mM MgCl2, 1% SUPERase In RNase inhibitor (20U / μL, Ambion) and 1% BSA (20mg / ml, NEB). Technicians will recognize that these levels of components can be slightly changed without reducing the effectiveness of the nucleus buffer in which the nucleus is suspended. Technicians will also recognize that various components can be replaced without reducing the effectiveness of the nucleus buffer in which the nucleus is suspended.

[0184] In one embodiment, the cells (including the cells from which the nuclei are isolated) have been exposed to different predetermined conditions. For example, subsets of cells can be exposed to different predetermined conditions. Different conditions can include, for example, different culture conditions (e.g., different culture media, different environmental conditions), different reagent doses, different reagents or combinations of reagents. Reagents are described herein. Each subset of cells and / or the nuclei or cells of one or more samples are indexed with one or more index sequences, merged, and then analyzed by large-scale multiplexed single cell nuclei or single cell sequencing methods. Essentially any single cell nucleus or single cell sequencing method can be used, including but not limited to single cell nucleus transcriptome sequencing (US Provisional Patent Application No. 62 / 680,259 and Gunderson et al. (WO2016 / 130704)), whole genome sequencing of single cell nuclei (US Patent Application Publication No. US2018 / 0023119) or single cell nucleus sequencing of transposon accessible chromatin (US Patent No. 10,059,989), sci-HiC (Ramani et al., Nature Methods, 2017, 14:263-266), DRUG-seq (Ye et al., Nature Commun., 1994, 23:115-124). number4307), Perturb-seq (Dixit et al., Cell, 2016, 167(7):1853–1866.e17), or any combination of DNA, RNA, and protein analytes, such as sci-CAR (Cao et al., Science, 2018, 361(6409):1380-1385). Droplet-based single-cell analysis can also be applied after the initial split-merge index (examples include 10X Genomics Chromium TM System or BioRad ddseq system), including using the index as a sample index. Nuclear hashing is used to demultiplex and identify individual cells or nuclei from different conditions.

[0185] In one embodiment, each subset of cells is exposed to a reagent or disturbance. The reagent can be basically anything that causes a change in the cell. For example, the reagent can change the transcriptome of the cell, change the chromatin structure of the cell, change the activity of the protein in the cell, change the DNA of the cell, change the DNA editing of the cell, or cause other changes. Examples of reagents include, but are not limited to, compounds such as proteins (including antibodies), non-ribosomal proteins, polyketides, organic molecules (including 900 Daltons or less organic molecules), inorganic molecules, RNA or RNAi molecules, carbohydrates, glycoproteins, nucleic acids, or combinations thereof. In one embodiment, the reagent causes a genetic disturbance, such as a DNA editing protein and / or a guide RNA such as CRISPR or Talen. In one embodiment, the reagent is a therapeutic drug. In one embodiment, the cell can be a wild-type cell, and in another embodiment, the cell can be genetically modified to include a genetic disturbance, such as a gene knock-in or a gene knock-out (Szlachta et al., Nat Commun., 2018, 9: 4275). A subset of cells can be exposed to the same reagent, but different variables can be changed in the compartment of a porous device, thereby allowing multiple variables to be tested in a single experiment. For example, different doses, different exposure durations, and different cell types can be tested in a single plate. In one embodiment, cells can express a protein with a known activity, and the effect of an agent on the activity is assessed under different conditions. Using index sequences to label nucleic acid fragments allows for later identification of specific subsets derived from nuclei or cells, such as from one well of a multiwell plate.

[0186] Distribution Subset

[0187] The method provided herein includes distributing a subset of a nucleus (e.g., a nucleus depleted of nucleosomes) or a cell into a plurality of compartments. The method may include a plurality of distribution steps, wherein a population of a separated nucleus or a cell (also referred to herein as a pool) is divided into subsets. Typically, a subset of a separated nucleus or a cell is distributed from a pool to a plurality of compartments before an index is added to a nucleic acid fragment present in a subset of a separated nucleus or a cell. Therefore, the method includes obtaining the separated nucleus or a cell that is merged and distributing at least one "segmentation and merging" step thereof, wherein the number of "segmentation and merging" steps may depend on the number of different indexes added to the nucleic acid fragment. After indexing, subsets may be merged, divided into subsets, indexed and merged again as needed until a sufficient number of indexes are added to the nucleic acid fragment.

[0188] The number of nuclei or cells present in the subset, and thus in each compartment, may be at least 1. In one embodiment, the number of nuclei or cells present in the subset is no greater than 100,000,000, no greater than 10,000,000, no greater than 1,000,000, no greater than 100,000, no greater than 10,000, no greater than 4,000, no greater than 3,000, no greater than 2,000 or no greater than 1,000, no greater than 500 or no greater than 50. In one embodiment, the number of nuclei or cells present in the subset may be 1 to 1,000, 1,000 to 10,000, 10,000 to 100,000, 100,000 to 1,000,000, 1,000,000 to 10,000,000 or 10,000,000 to 100,000,000. In one embodiment, the number of the nuclei or cells present in each subset is approximately equal. The number of the nuclei present in the subset and therefore in each compartment is partly based on the demand for reducing index conflicts (it is two nuclei with the same transposase index in the final step of the method in the same compartment). The method for distributing the nuclei or cells to the subset is known to those skilled in the art and is conventional. Examples include but are not limited to fluorescence activated cell sorting (FACS) cell counting and simple dilution. Optionally, the nuclei of different ploidy can be gated and enriched by dyeing, such as DAPI (4', 6-diamidino-2-phenylindole) dyeing.

[0189] The number of compartments in the distribution step (and subsequent index addition) can depend on the format used. For example, the number of compartments can be 2 to 96 compartments (when using a 96-well plate), 2 to 384 compartments (when using a 384-well plate), or 2 to 1536 compartments (when using a 1536-well plate). In one embodiment, each compartment can be a droplet. When the type of compartment used is a droplet containing two or more nuclei or cells, any number of droplets can be used, such as at least 10,000, at least 100,000, at least 1,000,000 or at least 10,000,000 droplets. In one embodiment, the number of compartments is 24.

[0190] Processing to generate nucleic acid fragments

[0191] In one embodiment, the treatment of the isolated nucleus or cell can be used to fragment the DNA nucleic acid such as chromosome and / or plasmid in the isolated nucleus or cell into nucleic acid fragments. When the target nucleic acid to be sequenced comes from the DNA present in the nucleus or cell, the treatment is usually necessary; however, in some embodiments, when the target nucleic acid to be sequenced is derived from RNA (e.g., mRNA and / or non-coding RNA) present in the nucleus or cell, the treatment is optional because RNA molecules do not usually need to be fragmented. The nucleic acid in the treatment nucleus or cell usually adds a nucleotide sequence to one or both ends of the nucleic acid fragment produced by the treatment, and the nucleotide sequence can and usually does include one or more universal sequences. Universal sequences can be used as "landing pads" in subsequent steps, for example, so that the nucleotide sequence that can be used as a primer for adding another nucleotide sequence (e.g., index) in subsequent connection, primer extension or amplification steps annealing with the nucleic acid fragment. The nucleotide sequence of this primer can optionally include an index sequence. The nucleic acid in the treatment nucleus or cell can add one or more unique molecular identifiers to one or both ends of the nucleic acid fragment produced by the treatment.

[0192] There are several points in the method where processing of nucleic acids into nucleic acid fragments can occur. For example, in one embodiment, the isolated nuclei or cells can be processed prior to distributing the subsets of isolated nuclei or cells. In embodiments such as this embodiment, processing typically includes adding universal sequences and / or universal molecular identifiers to the nucleic acid fragments, but non-compartment-specific indices, since adding compartment-specific indices is generally not useful when all isolated nuclei or cells are combined. In another embodiment, the isolated nuclei or cells can be processed after the subsets are distributed into different compartments (e.g., Figure 1A and Figure 1B In one aspect of this embodiment, processing does not add an index ( Figure 1A , Box 1), and in another aspect of this embodiment, processing may include adding a compartment-specific index ( Figure 1B , Box 1). Processing at any point in the method may include adding universal sequences and / or universal molecular identifiers to one or both ends of the nucleic acid fragments.

[0193] Various methods for processing nucleic acids in a cell nucleus or cell into nucleic acid fragments are known. Examples include CRISPR and Talen-like enzymes, and enzymes (e.g., helicases) that can form DNA fragments that can hybridize with and initiate extension or amplification of single-stranded regions that unwind DNA. For example, helicase-based amplification (Vincent et al., 2004, EMBORep., 5 (8): 795-800) can be used. In one embodiment, extension or amplification is initiated with random primers. In one embodiment, a transposome complex is used.

[0194] The transpososome complex is a transposase that is bound to a transposase recognition site, and the transposase recognition site can be inserted into a target nucleic acid in the nucleus in a process sometimes referred to as "tagmentation". In some such insertion events, one strand of the transposase recognition site can be transferred to the target nucleic acid. Such a strand is referred to as a "transferred strand". In one embodiment, the transpososome complex includes a dimeric transposase with two subunits and two discontinuous transposon sequences. In another embodiment, the transposase includes a dimeric transposase with two subunits and a continuous transposon sequence. In one embodiment, the 5' end of one or both strands of the transposase recognition site can be phosphorylated.

[0195] Some embodiments may include the use of a hyperactive Tn5 transposase and a Tn5-type transposase recognition site (Goryshin and Reznikoff, J. Biol. Chem., 273:7367 (1998)), or a MuA transposase and a Mu transposase recognition site comprising R1 and R2 terminal sequences (Mizuuchi, K., Cell, 35:785, 1983; Savilahti, H et al., EMBO J., 14:4893, 1995). The Tn5 Mosaic end (ME) sequence may also be optimized and used by a skilled artisan.

[0196] Further examples of transposition systems that can be used with certain embodiments of the compositions and methods provided herein include Staphylococcus aureus Tn552 (Colegio et al., J. Bacteriol., 183:2384-8, 2001; Kirby C et al., Mol. Microbiol., 43:173-86, 2002), Ty1 (Devine & Boeke, Nucleic Acids Res., 22:3765-72, 1994 and International Publication WO 95 / 23875), transposon Tn7 (Craig, NL, Science. 271:1512, 1996; Craig, NL, reviewed in Curr Top Microbiol Immunol., 204:27-48, 1996), Tn / O and IS10 (Kleckner N et al., Curr Top Microbiol Immunol., 204:27-48, 1996), Immunol., 204:49-82, 1996), Mariner transposase (Lampe DJ et al., EMBO J., 15:5470-9, 1996), Tc1 (Plasterk RH, Curr. Topics Microbiol. Immunol., 204:125-43, 1996), P element (Gloor, GB, Methods Mol. Biol., 260:97-114, 2004), Tn3 (Ichikawa & Ohtsubo, J Biol. Chem. 265:18829-32, 1990), bacterial insertion sequence (Ohtsubo & Sekine, Curr. Top. Microbiol. Immunol. 204:1-26, 1996), retrovirus (Brown et al., Proc Natl Acad Sci USA, 86:2525-9, 1989) and yeast retrotransposons (Boeke & Corces, Annu Rev Microbiol. 43:403-34, 1989). More examples include IS5, Tn10, Tn903, IS911 and engineered forms of transposase family enzymes (Zhang et al., (2009) PLoS Genet. 5:e1000689. Epub 2009 Oct 16; Wilson C. et al. (2007) J. Microbiol. Methods 71:332-5).

[0197] Other examples of integrases that can be used with the methods and compositions provided herein include retroviral integrases and integrase recognition sequences for such retroviral integrases, such as integrases from HIV-1, HIV-2, SIV, PFV-1, RSV.

[0198] Transposon sequences useful for the methods and compositions described herein are provided in U.S. Patent Application Publication No. 2012 / 0208705, U.S. Patent Application Publication No. 2012 / 0208724, and International Patent Application Publication No. WO 2012 / 061832. In some embodiments, the transposon sequence includes a first transposase recognition site and a second transposase recognition site. In those embodiments in which the transposome complex is used to introduce the index sequence, the index sequence may be present between the transposase recognition sites or in the transposon.

[0199] Some transposome complexes useful herein include a transposase having two transposon sequences. In some such embodiments, the two transposon sequences are not connected to each other, in other words, the transposon sequences are discontinuous with each other. Examples of these transpososomes are known in the art (see, e.g., U.S. Patent Application Publication No. 2010 / 0120098).

[0200] In some embodiments, the transposome complex includes a transposon sequence nucleic acid that combines two transposase subunits to form a "circular complex" or "circular transposome". In one example, the transposome includes a dimeric transposase and a transposon sequence. The circular complex can ensure that the transposon is inserted into the target DNA while maintaining the ordered information of the original target DNA and without the need for target DNA fragmentation. As should be understood, the circular structure can insert a desired nucleic acid sequence such as an index into the target nucleic acid while maintaining the physical connectivity of the target nucleic acid. In some embodiments, the transposon sequence of the circular transposome complex may include a fragmentation site so that the transposon sequence can be fragmented to produce a transposome complex comprising two transposon sequences. Such a transposome complex can be used to ensure that the adjacent target DNA fragments into which the transposon is inserted receive a barcode combination, which can be clearly assembled in the later stages of the assay.

[0201] In one embodiment, nucleic acid fragmentation is achieved by using the fragmentation sites present in the nucleic acid. Typically, the fragmentation sites are introduced into the target nucleic acid by using a transpososome complex. In one embodiment, after nucleic acid fragmentation, the transposase remains attached to the nucleic acid fragments so that the nucleic acid fragments derived from the same genomic DNA molecule remain physically connected (Adey et al., 2014, Genome Res, 24: 2041-2049). For example, the looped transpososome complex may include a fragmentation site. The fragmentation site can be used to cut the physical rather than information connection between the index sequences inserted into the target nucleic acid. Cutting can be performed by biochemical, chemical or other means. In some embodiments, the fragmentation site may include nucleotides or nucleotide sequences that can be fragmented in various ways. Examples of fragmentation sites include, but are not limited to, restriction endonuclease sites, at least one ribonucleotide cleavable with an RNase, nucleotide analogs cleavable in the presence of a chemical agent, diol linkages cleavable by treatment with periodate, disulfide groups cleavable with a chemical reducing agent, cleavable moieties that undergo photochemical cleavage, and peptides cleavable by peptidases or other suitable means (see, e.g., U.S. Patent Application Publication No. 2012 / 0208705, U.S. Patent Application Publication No. 2012 / 0208724, and WO 2012 / 061832).

[0202] The transposome complex may optionally include at least one index sequence, and may also be referred to as a transposase index. The index sequence is present as part of the transposon sequence. In one embodiment, the index sequence may be present on the transferred strand (the strand that is transferred to the transferred strand recognition site in the target nucleic acid).

[0203] The transposome complex may optionally include at least one index sequence, and may be referred to as a transposase index. The index sequence is present as part of the transposon sequence. In one embodiment, the index sequence may be present on the transferred strand (the strand that is transferred to the transposase recognition site in the target nucleic acid).

[0204] The transposome complex can optionally include at least one nucleotide sequence that can be used by a linear amplification mediator. When the nucleic acid fragment includes a bacteriophage promoter (e.g., a T7 RNA polymerase used together with a T7 promoter) and a linear amplification primer, examples of such nucleotide sequences include, but are not limited to, RNA polymerase. Examples of linear amplification primers include single primers or linear amplification mediators for PCR-type amplification. Other embodiments of the nucleotide sequence that a linear amplification mediator can use are sequences that are recognized by a strand displacement polymerase. The mediator can include a nicking site to initiate replication. In some cases, the nicking site can be regenerated for additional amplification.

[0205] Adding compartment-specific indexes

[0206] The index sequence, also called a tag or barcode, can be used as a marker feature of the compartment in which a specific nucleic acid is present. Thus, the index is a nucleic acid sequence tag attached to each target nucleic acid present in a specific compartment, the presence of which indicates or is used to identify the compartment in which the isolated nucleus or cell population is present at a specific stage of the method. The addition of the index to the nucleic acid fragments is achieved with subsets of isolated nuclei or cells distributed to different compartments.

[0207] The length of the index sequence can be any suitable number of nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more. Tetranucleotide tags give the possibility of multiplexing 256 samples on the same array, while hexanucleotide tags enable processing of 4096 samples on the same array.

[0208] In one embodiment, the addition of the index is achieved during the processing of the nucleic acid into nucleic acid fragments. For example, a transposome complex comprising an index can be used. In other embodiments, the index is added after the nucleic acid fragments comprising a nucleotide sequence at one or both ends are generated by processing. Methods for adding indexes include, but are not limited to, connection, extension (including extension using a reverse transcriptase), hybridization, adsorption, specific or non-specific interaction or amplification of primers. The nucleotide sequence added to one or both ends of the nucleic acid fragment can also include one or more universal sequences and / or unique molecular identifiers. The universal sequence can be used, for example, as a "landing pad" in a subsequent step to anneal the nucleotide sequence, which can be used as a primer for adding another nucleotide sequence (such as another index and / or another universal sequence) to the nucleic acid fragment.

[0209] For example, in embodiments including the use of nucleic acid fragments derived from mRNA, various methods can be used to add indexes to mRNA in one or two steps. For example, the type of method for producing cDNA can be used to add indexes. Primers with poly-T sequences at the 3' end can be annealed to mRNA molecules and extended using reverse transcriptase. Under conditions suitable for reverse transcription, the isolated nucleus or cell is exposed to these components to cause a step of index addition, thereby obtaining the nucleus or cell colony of the index, wherein each nucleus or nucleic acid fragment comprising the index. Alternatively, primers with poly-T sequences include universal sequences instead of indexes, and the index is extended by connection, primer extension, and amplification. The nucleic acid fragment of the index can and usually does include an index sequence indicating a specific compartment on the synthetic chain.

[0210] In embodiments comprising the use of nucleic acid fragments derived from non-coding RNA, various methods can be used to add an index to the non-coding RNA in one or two steps. For example, the index can be added using a first primer comprising a random sequence and a template switching primer, wherein either primer can contain the index. A reverse transcriptase having terminal transferase activity can be used to cause the addition of non-template nucleotides at the 3' end of the synthesized chain, and the template switching primer comprises nucleotides that anneal to the non-template nucleotides added by the reverse transcriptase. An example of a useful reverse transcriptase is Moloney murine leukemia virus reverse transcriptase. In a specific embodiment, SMARTer purchased from Takara Bio USA, Inc. TM Reagent (Cat. No. 634926) is used for template switching to add indexes to non-coding RNA and mRNA (if necessary). Alternatively, the first primer and / or the template switching primer may include a universal sequence instead of an index, and the index is added by subsequent steps of connection, primer extension or amplification. The indexed nucleic acid fragments may and usually do include an index sequence indicating a specific compartment on the synthetic strand. Other embodiments include 5' or 3' typing of RNA or full-length RNA typing.

[0211] Other methods can be used to add indexes to nucleic acid fragments, and how to add indexes is not intended to be limiting. For example, in one embodiment, the incorporation of the index sequence includes connecting a primer to one or both ends of the nucleic acid fragment. The connection of the connecting primer can be assisted by the presence of a universal sequence at the end of the nucleic acid fragment. A non-limiting example of a primer is a hairpin connecting duplex. The connecting duplex can be connected to one end or preferably both ends of the nucleic acid fragment. In one embodiment, a primer such as a hairpin connecting duplex can include a nucleotide sequence that is recognized by a linear amplification mediator. Example 1, Figure 2 An example of a hairpin linker containing such nucleotides is described in . An assay protocol (such as the one described in Example 1) that introduces an amplification mediator that requires successful ligation at only one of the two ends of a barcode molecule to produce an amplification product of that molecule is desirable because it has the advantage of increasing the efficiency of template conversion. For example, if the efficiency of a single ligation event is 50%, this modification results in a 75% success rate in the ligation step of the amplified molecule, rather than a 25% success rate (Example 1, Figure 2 ).

[0212] In another embodiment, the incorporation of the index sequence comprises the use of a single-stranded nucleic acid fragment and the synthesis of a second DNA strand. In one embodiment, the second DNA strand is generated using a primer comprising a sequence complementary to the nucleotides present at the end of the single-stranded nucleic acid fragment.

[0213] In another embodiment, incorporation of indexes occurs in one, two, three, or more rounds of split-pool barcoding, thereby generating singly, doubly, triply, or multiply indexed single-cell libraries.

[0214] In another embodiment, the incorporation of nucleotide sequences that can be used by the indexing and amplification mediators is designed to be unidirectional, thereby allowing the preparation of targeted single-cell sequencing libraries (see Example 1, Figure 3 b).

[0215] Linear amplification of nucleic acid fragments

[0216] Methods provided herein include linear amplification of nucleic acid fragments. Most amplification methods are based on PCR, and therefore there is an exponential amplification bias. Linear amplification as used herein can reduce or eliminate exponential amplification bias, thereby resulting in better uniformity and reduced sequence errors. In all single-cell genomics methods utilizing whole genome amplification, the amplified product is included by a compartment (e.g., a hole or droplet), and the barcode is directly or indirectly connected to the amplified product. In this way, each compartment only has a single cell, thereby limiting flux and increasing cost. The unique aspect of the present invention is that multiple single-cell libraries can be amplified in a single compartment without exponential amplification bias. The library from a single cell can be distributed based on one or more unique barcodes for each unique single cell.

[0217] In one embodiment, linear amplification is realized by adding a bacteriophage promoter to one or both ends of nucleic acid fragment.When placed in the upstream of nucleic acid fragment, the bacteriophage promoter can be used for driving transcription by using the corresponding bacteriophage RNA polymerase for in vitro transcription producing single-stranded RNA.The RNA copy produced from the DNA template can not be used as the template for further amplification.Therefore, all copies are directly derived from the original DNA template, and avoid exponential amplification.In one embodiment, subsequent steps can include the reverse transcription of the RNA copy to obtain single-stranded DNA, and then carry out the second chain synthesis to convert the single-stranded DNA copy into a double-stranded molecule.The second chain synthesis usually needs to use a primer, and this primer can be used for introducing one or more in an index, a universal sequence and / or a universal molecular identifier.

[0218] Other methods of linear amplification can be used. For example, PCR amplification can be performed with one primer or two primers (one of which is excessive). In some embodiments, linear PCR can be used to amplify flanking sequences adjacent to the transposon insertion site (Xianbo et al. AMB Express, 2017, 7: 195). Linked linear amplification (linked linear amplification) (Reyes et al., Clin. Chem., 2001, 47 (1): 31-40), linear extension and linear extension and connection, strand displacement amplification (SDA) (Walker et al., Nucl. Acids Res., 1992, 20 (7): 1691–1696) and rolling circle amplification (Ali et al., Chem. Soc. Rev., 2014, 43: 3324-3341) can also be used in some embodiments. In some embodiments, an index, a universal sequence and / or a unique molecular identifier can be added to a nucleic acid fragment during linear amplification.

[0219] In general, linear amplification includes introducing a linear amplification mediator into a separated nucleus or cell. When the nucleic acid fragment includes a phage promoter (e.g., a T7 RNA polymerase used together with a T7 promoter) and a linear amplification primer, the example of a linear amplification mediator includes an RNA polymerase. The example of a linear amplification primer includes a single primer or a linear amplification mediator used in a PCR type amplification. Other embodiments of an amplification mediator are chain displacement polymerases that recognize nucleotide sequences. The mediator may include a nicking site to initiate replication. In some cases, the nicking site is regenerated for additional amplification. The mediator may include a unique bar code or primer, thereby allowing the bar code to replicate in the labeling process of amplification or amplification products.

[0220] Added generic sequence for fixation

[0221] In one embodiment, adding nucleotides during processing and / or indexing steps increases the universal sequence that can be used for fixing and sequencing fragments. In another embodiment, the nucleic acid fragments of index can be further processed to add the universal sequence that can be used for fixing and sequencing nucleic acid fragments. Technicians will recognize that in the embodiment where the compartment is a droplet, the sequence that can be used for fixing nucleic acid fragments is optional. In one embodiment, the incorporation of the universal sequence that can be used for fixing and sequencing fragments includes connecting the same universal adapter (also referred to as " mispaired joint ", its general features are described in Gormley et al., US 7,741,463 and Bignell et al., US 8,053,192) to the 5' and 3' ends of the nucleic acid fragments of index. In one embodiment, universal adapters include all sequences required for sequencing, including sequences for fixing the nucleic acid fragments of indexes on arrays.

[0222] In one embodiment, blunt end connection can be used. In another embodiment, nucleic acid fragments are prepared with a single protruding nucleotide by, for example, certain types of DNA polymerases (e.g., Taq polymerase or Klenow exo negative polymerase) (which have non-template-dependent terminal transferase activity) to add a single deoxynucleotide, such as deoxyadenosine (A), to the 3' end of the nucleic acid fragment of the index. In some cases, the protruding nucleotide exceeds one base. Such enzymes can be used to add a single nucleotide "A" to the blunt end 3' end of each chain of the nucleic acid fragment. Therefore, "A" can be added to the 3' end of each chain of the double-stranded target fragment by reacting with Taq or Klenow exo negative polymerase, and other sequences to be added to each end of the nucleic acid fragment can include the compatible "T" protruding end present on the 3' end of each region of the double-stranded nucleic acid to be added. This terminal modification also prevents the self-connection of nucleic acids, so that there is a bias towards the indexed nucleic acid fragments that form the sequence flanks added in this embodiment.

[0223] In another embodiment, when the universal adapter attached to the indexed nucleic acid fragments does not include all sequences required for sequencing, an amplification step, such as PCR, can be used prior to fixation and sequencing to further modify the universal adapter present in each indexed nucleic acid fragment. For example, a universal anchor sequence complementary to the universal sequence present in the indexed nucleic acid fragments can be used to perform an initial primer extension reaction, wherein extension products complementary to the two strands of each individual indexed nucleic acid fragment are formed. Typically, PCR adds additional universal sequences, such as universal capture sequences.

[0224] After adding the universal adapter, the final index fragment includes the universal capture sequence and the anchor sequence by a single-step method of ligating a universal adapter that includes all sequences required for sequencing, or by a two-step method of ligating a universal adapter and then amplifying to further modify the universal adapter. The result of adding a universal adapter at each end is a plurality of indexed nucleic acid fragments or a library of indexed nucleic acid fragments.

[0225] The resulting indexed nucleic acid fragments collectively provide a nucleic acid library that can be immobilized and then sequenced.The term library, also referred to herein as a sequencing library, refers to a collection of nucleic acid fragments from a single nucleus or cell that contain known universal sequences at their 3' and 5' ends.

[0226] The nucleic acid fragments of the index can be subjected to conditions selected for a predetermined size range, such as 150 to 400 nucleotides in length, such as 150 to 300 nucleotides. The resulting indexed nucleic acid fragments are merged, and optionally a cleaning process can be performed to improve the purity of the DNA molecule by removing at least a portion of the universal adapter or primer that is not incorporated. Any suitable cleaning process can be used, such as electrophoresis, size exclusion chromatography, etc. In some embodiments, solid phase reversible fixed paramagnetic beads can be used to separate the desired DNA molecule from the unconnected universal adapter or primer, and select nucleic acids based on size. Solid phase reversible fixed paramagnetic beads can be purchased from Beckman Coulter (Agencourt AMPure XP), Thermofisher (MagJet), OmegaBiotek (Mag-Bind), Promega Beads (Promega) and Kapa Biosystems (Kapa Pure Beads).

[0227] Non-limiting illustrative embodiments of the present disclosure are described in Figure 2 and described in Example 1. In this embodiment, the method comprises providing isolated nuclei ( Figure 2 , Box 22). The isolated nuclei can be nucleosome-free, or can be subjected to conditions that deplete the nuclei of nucleosomes, thereby producing nucleosome-depleted nuclei ( Figure 2 , Box 23).

[0228] In this embodiment, the method comprises distributing a subset of nucleosome-depleted nuclei into a first plurality of compartments ( Figure 2 , box 24). In the first distribution step ( Figure 2 , the number of compartments in block 24) may depend on the format used. In one embodiment, the number of compartments is 24.

[0229] Each compartment includes a transposome complex. The transposome complex can be added to each compartment before, after, or simultaneously with the addition of a subset of cell nuclei to the compartment. The transposome complex includes at least one index sequence and at least one universal sequence. The universal sequence present as part of the transposome complex can be called a spacer sequence. The spacer sequence exists as part of the transposon sequence. In one embodiment, the spacer sequence can be present on the transfer strand (the strand that transfers to the transferase recognition site in the target nucleic acid). The spacer sequence can be used as a site for annealing to a complementary sequence. For example, the spacer sequence can be a universal primer, or a complementary sequence to a universal primer. For each compartment, the spacer sequence of the transposome complex can be the same. In one embodiment, the index ("bc1") and the spacer ("sp1") are present in the overhang, which is as shown in Example 1. Figure 4The directional arrangement shown in A.

[0230] The method also includes generating an indexed nucleus ( Figure 2 , Box 25). In one embodiment, generating indexed nuclei includes processing nucleic acids present in a subset of nucleosome-depleted nuclei (e.g., nucleic acids present in each compartment) into a plurality of nucleic acid fragments. In one embodiment, after nucleic acid fragmentation, the transposase remains attached to the nucleic acid fragments so that nucleic acid fragments derived from the same genomic DNA molecule remain physically connected (Adey et al., 2014, Genome Res., 24: 2041-2049). The result of fragmentation is a population of indexed nuclei, each of which contains indexed nucleic acid fragments. The index sequence of the transposome complex is different for each compartment, and therefore, the indexed nucleic acid fragments can and typically do include an index sequence indicating a specific compartment on at least one strand. Examples of indexed nucleic acid fragments are shown in Example 1. Figure 4 In the framed portion of A.

[0231] Indexed nuclei from multiple compartments can be combined ( Figure 2 , box 26). Then, subsets of these combined indexed nuclei are distributed into a second plurality of compartments. The number of nuclei present in a subset, and therefore in each compartment, is based in part on the need to reduce index conflicts (which is the presence of two nuclei with the same transposase index in the same compartment at this step of the method). In one embodiment, the number of nuclei present in each subset is approximately equal.

[0232] After the nuclei are distributed into subsets, a second index sequence is incorporated into the indexed nucleic acid fragments in each compartment to generate dual indexed fragments. This results in further indexing of the indexed nucleic acid fragments ( Figure 2 , Box 27). In those embodiments where the cells are cross-linked by a cross-linking agent, the transposase attached to the indexed nucleic acid fragments can be dissociated from the indexed nucleic acid fragments. A detergent can be used to dissociate the transposase, and in one embodiment, the detergent is sodium dodecyl sulfate (SDS).

[0233] In one embodiment, incorporation of the second index sequence comprises attaching a hairpin ligation duplex to the indexed nucleic acid fragments in each compartment. The ligation duplex can be attached to one end or preferably both ends of the dual indexed nucleic acid fragments. In one embodiment, the ligation duplex comprises five elements: 1) a first spacer sequence (e.g., Figure 4B) is used as a "landing pad" in the ligation step described herein; 2) the reverse complement of the second round barcode; 3) the reverse complement of the second strand synthesis (SSS) primer; 4) a T7 promoter, which is preferably the loop region of the hairpin; 5) a second strand synthesis (SSS) primer region starting with GGG for enhancing T7 transcription (second spacer sequence, Example 1 Figure 4 B); and 6) the second round barcode second index sequence (Example 1 Figure 4 For each compartment in which the distributed indexed nuclei are placed after adding the first index by tagmentation, the second index sequence is unique ( Figure 2 , Box 27).

[0234] Indexed nuclei from multiple compartments can be combined ( Figure 2 , box 28). Then the subsets of these combined index nuclei are distributed to the third multiple compartments. The number of nuclei present in the subset and therefore in each compartment is based in part on the need to reduce index conflicts (which is the presence of two nuclei with the same transposase index in the same compartment in this step of the method). In one embodiment, 100 to 300 cells are distributed to each hole. In one embodiment, up to 300 cells are distributed to each hole. In one embodiment, the number of nuclei present in each subset is approximately equal.

[0235] Distribution of dual-indexed nuclei into subsets prior to lysis and further manipulation ( Figure 2 , Box 29). Methods for lysis of the nucleus are known and conventional to the skilled person. Further manipulations include, but are not limited to, gap extension, in vitro transcription (IVT) and reverse transcription.

[0236] The hairpin T7 promoter structure was converted into a duplex by gap extension (Example 1 Figure 4 C). Polymerases with strand displacement activity are often used for gap extension. Polymerases with this activity, such as Bst polymerase, are available.

[0237] IVT produces linearly amplified single-stranded RNA molecules downstream of the T7 promoter (Example 1 Figure 4 D) Methods of IVT are known and routine.

[0238] Reverse transcription can occur in one of two ways (Example 1 Figure 4E). The ligation reaction described herein produces two types of nucleic acid fragments: nucleic acid fragments with ligated duplexes at both ends and nucleic acid fragments with ligated duplexes at one end. If ligation is successful at both ends, reverse transcription can be initiated by a self-circularized reverse transcription primer that is inherited from the circularized ligated duplex; if ligation is successful only at one end, reverse transcription is initiated by an additional RNA reverse transcription primer added in excess.

[0239] After cleavage of the nucleic acid and processing of the nucleic acid fragments, a third index sequence is incorporated into the dual-indexed nucleic acid fragments in each compartment to generate triply indexed fragments, wherein the third index sequence in each compartment is different from the first and second index sequences in the other compartments, and the third index sequence in each compartment is different from the third index sequences in the other compartments. This results in further indexing of the nucleic acid fragments indexed prior to fixation and sequencing ( Figure 2 , block 30; Example 1 Figure 4 F). The third index can be incorporated by synthesis of a second DNA strand. In one embodiment, the second DNA strand is generated using a primer comprising a sequence complementary to the nucleotides present at the ends of the dual indexed nucleic acid fragment. For example, the primer may include a second spacer sequence (sp2) that will anneal to the reverse complement of the second spacer sequence (Example 1). Figure 4 F). The primer further comprises a third index (Example 1 Figure 4 F) and other unique molecular identifiers (UMIs). The resulting double-stranded DNA can be purified using conventional methods.

[0240] Multiple triple-indexed fragments can be prepared for sequencing. After the triple-indexed fragments are combined, they are usually enriched by fixation and / or amplification before sequencing ( Figure 2 , box 31).

[0241] Preparation of fixed samples for sequencing

[0242] Multiple indexed fragments can be prepared for sequencing. For example, in those embodiments in which a library of triple-indexed fragments is generated, the triple-indexed fragments are enriched prior to sequencing, typically by fixation and / or amplification ( Figure 2Box 21). Methods for attaching index fragments from one or more sources to a substrate are known in the art. In one embodiment, the indexed fragments are enriched using a variety of capture oligonucleotides that are specific to the indexed fragments, and the capture oligonucleotides can be fixed on the surface of a solid substrate. For example, the capture oligonucleotide may include a first member of a universal binding pair, and wherein the second member of the binding pair is fixed on the surface of the solid substrate. Similarly, methods for amplifying fixed dual index fragments include, but are not limited to, bridge amplification and kinetic exclusion. Methods for fixation and amplification prior to sequencing are described in, for example, Bignell et al. (US 8,053,192), Gunderson et al. (WO2016 / 130704), Shen et al. (US 8,895,249) and Pipenburg et al. (US 9,309,502).

[0243] The combined samples can be fixed in preparation for sequencing. Sequencing can be performed as a single molecule array, or can be amplified before sequencing. Amplification can be performed using one or more fixed primers. The fixed primers can be, for example, lawns on a plane or on a pool of beads. The pool of beads can be separated into emulsions, with a single bead in each "compartment" of the emulsion. At a concentration of only one template per "compartment", only one template is amplified on each bead.

[0244] As used herein, the term "solid phase amplification" refers to any nucleic acid amplification reaction performed on or in conjunction with a solid support so that all or part of the amplified product is fixed on the solid support when it is formed. In particular, the term encompasses solid phase polymerase chain reaction (solid phase PCR) and solid phase isothermal amplification, which is a reaction similar to standard solution phase amplification, except that one or both of the forward and reverse amplification primers are fixed on a solid support. Solid phase PCR encompasses systems such as emulsions (one of the primers is anchored on a bead and the other is in free solution), and colony formation in a solid phase gel matrix (one of the primers is anchored on a surface, and one primer is in free solution).

[0245] In some embodiments, the solid support includes a patterned surface. "Patterned surface" refers to the arrangement of different regions in or on the exposed layer of the solid support. For example, one or more regions can be features in which one or more amplification primers are present. These features can be separated by gap regions in which there are no amplification primers. In some embodiments, the pattern can be an xy format of features in rows and columns. In some embodiments, the pattern can be a repeated arrangement of features and / or gap regions. In some embodiments, the pattern can be a random arrangement of features and / or gap regions. Exemplary patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Patent Nos. 8,778,848, 8,778,849 and 9,079,148 and U.S. Publication No. 2014 / 0243224.

[0246] In some embodiments, the solid support comprises an array of holes or depressions in the surface. This can be manufactured using a variety of techniques as generally known in the art, including but not limited to photolithography, imprinting techniques, molding techniques, and micro-etching techniques. As will be appreciated by those skilled in the art, the techniques used depend on the composition and shape of the array substrate.

[0247] The features in the patterned surface can be wells in an array of wells (e.g., microwells or nanowells) on glass, silicon, plastic, or other suitable solid supports with patterned, covalently attached gels (e.g., poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide (PAZAM, see, e.g., U.S. Publication Nos. 2013 / 184796, WO 2016 / 066586, and WO 2015 / 002813)). This process creates a gel pad for sequencing that can be stable over sequencing runs with a large number of cycles. The covalent attachment of the polymer to the wells helps maintain the gel in the structured features throughout the life of the structured matrix during various uses. However, in many embodiments, the gel need not be covalently attached to the wells. For example, in certain conditions, silane-free acrylamide (SFA, see, e.g., U.S. Patent No. 8,563,477) that is not covalently attached to any portion of the structured matrix can be used as a gel material.

[0248] In a particular embodiment, a structured matrix can be prepared by patterning a solid support material with pores (e.g., micropores or nanopores), coating the patterned support with a gel material (e.g., PAZAM, SFA, or a chemically modified variant thereof, such as an azidolyzed form of SFA (azido-SFA)), and polishing the gel-coated support (e.g., by chemical or mechanical polishing), thereby retaining the gel in the pores, but removing or inactivating substantially all of the gel between the pores from the interstitial regions on the surface of the structured matrix. Primer nucleic acids can be attached to the gel material. A solution of the indexed fragments can then be contacted with the polished matrix so that a single indexed fragment inoculates a single pore by interacting with the primers attached to the gel material; however, the target nucleic acid does not occupy the interstitial region due to the lack or inactivity of the gel material. Amplification of the indexed fragments is confined to the pores because the lack or inactivation of the gel in the interstitial region prevents the outward migration of the growing nucleic acid colonies. The method can be conveniently manufactured, scalable, and utilize conventional micro- or nano-manufacturing methods.

[0249] Although the present disclosure encompasses "solid phase" amplification methods in which only one amplification primer is fixed (the other primer is typically present in free solution), in one embodiment, it is preferred that a solid support provide both fixed forward and reverse primers. In fact, since the amplification process requires an excess of primers to maintain amplification, there are "multiple" identical forward primers and / or "multiple" identical reverse primers fixed on the solid support. Unless the context otherwise indicates, reference to forward and reverse primers herein should be interpreted accordingly as covering "multiple" such primers.

[0250] As will be appreciated by those skilled in the art, any given amplified reaction requires at least one type of forward primer and at least one type of reverse primer to be specific to the template of amplification. However, in certain embodiments, forward and reverse primers may include template-specific portions of identical sequences, and may have identical nucleotide sequences and structures (including any non-nucleotide modifications). In other words, it is possible to use only a type of primer to carry out solid phase amplification, and this single primer method is encompassed within the scope of the present disclosure. Other embodiments may use forward and reverse primers that comprise identical template-specific sequences but are different in some other structural features. For example, a type of primer may be included in a non-nucleotide modification that does not exist in another primer.

[0251] In all embodiments of the present disclosure, the primer for solid phase amplification is preferably fixed by covalently connecting to a solid support at or near the 5' end of the primer at a single point, so that the template-specific part of the primer is free to anneal to its cognate template, and the 3' hydroxyl is free for primer extension. For this purpose, any suitable covalent connection mode known in the art can be used. The connection chemistry selected depends on the properties of the solid support and any derivatization or functionalization applied thereto. The primer itself can include a part that can be a non-nucleotide chemical modification to facilitate connection. In a specific embodiment, the primer can include a sulfur-containing nucleophile at the 5' end, such as a thiophosphate or a thiophosphate. In the case of a solid-loaded polyacrylamide hydrogel, the nucleophile combines the bromoacetamide group present in the hydrogel. As described in WO 05 / 065814, a more specific way for attaching primers and templates to a solid support is to connect via a 5' thiophosphate of a hydrogel composed of polymerized acrylamide and N-(5-bromoacetamidopentyl) acrylamide (BRAPA).

[0252] Certain embodiments of the present disclosure can utilize a solid support comprising an inert substrate or matrix (e.g., a glass slide, polymer beads, etc.) that has been "functionalized" (e.g., by applying a layer or coating of an intermediate material comprising a reactive group) that allows covalent attachment to a biomolecule, such as a polynucleotide. Examples of such carriers include, but are not limited to, polyacrylamide hydrogels loaded on an inert matrix such as glass. In such embodiments, biomolecules (e.g., polynucleotides) can be directly covalently attached to an intermediate material (e.g., a hydrogel), but the intermediate material itself can be non-covalently attached to a substrate or matrix (e.g., a glass matrix). The term "covalently attached to a solid support" is correspondingly interpreted as encompassing this type of arrangement.

[0253] The sample of merging can be amplified on a bead, wherein each bead comprises forward and reverse amplification primers. In a specific embodiment, the library of index fragments is used to prepare a cluster array of nucleic acid colonies, similar to U.S. Publication No. 2005 / 0100900, U.S. Patent No. 7,115,400, WO 00 / 18957 and WO 98 / 44151, by solid phase amplification and more particularly by solid phase isothermal amplification. The terms "cluster" and "colony" are used interchangeably herein to refer to discrete sites on a solid support, comprising a plurality of identical fixed nucleic acid chains and a plurality of identical fixed complementary nucleic acid chains. The term "cluster array" refers to an array formed by such a cluster or colony. In this case, the term "array" should not be construed as requiring an ordered arrangement of clusters.

[0254] The terms "solid phase" or "surface" are used to refer to a planar array in which primers are attached to a flat surface, such as a glass, silica, or plastic microscope slide or similar flow cell device; a bead to which one or two primers are attached and the bead is amplified; or an array of beads on a surface following bead amplification.

[0255] Cluster arrays can be prepared using a thermal cycling method as described in WO 98 / 44151 or a method in which the temperature is kept constant and a change in reagents is used to carry out a cycle of extension and denaturation. Such isothermal amplification methods are described in patent application number WO 02 / 46456 and U.S. Publication No. 2008 / 0009420. Due to the lower temperatures available in isothermal processes, this is particularly preferred in some embodiments.

[0256] It should be understood that any amplification method described herein or generally known in the art can be used with universal or target-specific primers to amplify fixed DNA fragments. Suitable amplification methods include, but are not limited to, polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and nucleic acid sequence-based amplification (NASBA), as described in U.S. Patent No. 8,003,354. The above-mentioned amplification methods can be used to amplify one or more target nucleic acids. For example, PCR, including multiplex PCR, SDA, TMA, NASBA, etc., can be used to amplify fixed DNA fragments. In some embodiments, primers specific for the target polynucleotide are included in the amplification reaction.

[0257] Other suitable methods for polynucleotide amplification may include oligonucleotide extension and ligation, rolling circle amplification (RCA) (Lizardi et al., Nat. Genet. 19: 225-232 (1998)) and oligonucleotide ligation assay (OLA) technology (see generally U.S. Patent Nos. 7,582,420, 5,185,243, 5,679,524 and 5,573,907; EP 0 320 308 B1; EP 0 336731 B1; EP 0 439 182 B1; WO 90 / 01069; WO 89 / 12696; and WO 89 / 09835). It should be understood that these amplification methods can be designed to amplify fixed DNA fragments. For example, in some embodiments, the amplification method may include ligation probe amplification or oligonucleotide ligation assay (OLA) reactions, which include primers specific for the target nucleic acid. In some embodiments, the amplification method may include a primer extension-ligation reaction comprising primers specific for the target nucleic acid. As a non-limiting example of primer extension and ligation primers that can be specifically designed to amplify the target nucleic acid, the amplification may include primers for GoldenGate analysis (Illumina, Inc., San Diego, CA), as exemplified by U.S. Patent Nos. 7,582,420 and 7,611,869.

[0258] DNA nanoballs can also be used in combination with the methods and compositions described herein. Methods for producing and using DNA nanoballs for genome sequencing can be found in, for example, U.S. Patents and Publications US Patent No. 7,910,354, 2009 / 0264299, 2009 / 0011943, 2009 / 0005252, 2009 / 0155781, 2009 / 0118488 and described in, for example, Drmanac et al., 2010, Science 327 (5961): 78-81. In short, after the genomic library DNA fragmentation adapter is connected to the fragment, the adapter-connected fragment is circularized by connection with a circular ligase and rolling circle amplification is performed (as described in Lizardi et al., 1998. Nat. Genet. 19: 225-232 and US2007 / 0099208 A1). The extended tandem structure of the amplicon promotes curling, thereby producing a compact DNA nanoball. The DNA nanoballs can be captured on a substrate, preferably to produce an ordered or patterned array such that the distance between each nanoball is maintained to allow sequencing of individual DNA nanoballs. In some embodiments, such as those used by Complete Genomics (Mountain View, CA), successive rounds of adapter ligation, amplification, and digestion are performed prior to circularization to produce a head-to-tail construct with several genomic DNA fragments separated by adapter sequences.

[0259] Exemplary isothermal amplification methods that can be used in the methods of the present disclosure include, but are not limited to, multiple displacement amplification (MDA) as exemplified, for example, by Dean et al., Proc. Natl. Acad. Sci. USA 99: 5261-66 (2002) or isothermal strand displacement nucleic acid amplification as exemplified, for example, by U.S. Pat. No. 6,214,587. Other non-PCR-based methods that can be used in the present disclosure include, for example, strand displacement amplification (SDA), which is described, for example, in Walker et al., Molecular Methods for Virus Detection, Academic Press, Inc, 1995; U.S. Pat. Nos. 5,455,166 and 5,130,238 and Walker et al., Nucl. Acids Res. 20: 1691-96 (1992), or hyperbranched strand displacement amplification, which is described, for example, in Lage et al., Genome Res. 13: 294-307 (2003). Isothermal amplification methods can be used for example for strand displacement Phi29 polymerase or Bst DNA polymerase large fragment (5'->3'exo-) for random primer amplification of genomic DNA. The use of these polymerases takes advantage of their high continuous synthesis ability and strand displacement activity. High continuous synthesis ability enables polymerase to produce fragments of 10-20kb in length. As mentioned above, polymerases with low continuous synthesis ability and strand displacement activity, such as Klenow polymerase, can be used to produce smaller fragments under isothermal conditions. Other descriptions of amplification reactions, conditions and components are provided in detail in the disclosure of U.S. Patent No. 7,670,810.

[0260] Another polynucleotide amplification method useful in the present disclosure is a marker PCR, which uses a population of two-domain primers with a constant 5' region and then a random 3' region, such as described in Grothues et al. Nucleic Acids Res. 21(5): 1321-2 (1993). The first round of amplification is performed to allow a large number of primings on heat-denatured DNA based on individual hybridizations from the random synthetic 3' region. Due to the nature of the 3' region, the site of priming is considered to be random throughout the genome. Thereafter, the unbound primer can be removed and further replication can be performed using a primer complementary to the constant 5' region.

[0261] In some embodiments, kinetic exclusion amplification (KEA), also referred to as exclusion amplification (ExAmp), can be used to carry out isothermal amplification. The method comprising the following steps can be used to prepare a nucleic acid library of the present disclosure: an amplification reagent is reacted to produce a plurality of amplification sites, each amplification site comprising a substantially cloned amplicon population from a single target nucleic acid inoculated in the site. In some embodiments, the amplification reaction is carried out until a sufficient number of amplicon is produced to fill the capacity of the corresponding amplification site. Filling the site inoculated in this way suppresses the ability of the target nucleic acid to land and amplify in the site, thereby producing a clonal population of the amplicon in the site. In some embodiments, even if the amplification site is not filled to its capacity before the second target nucleic acid arrives in the site, it is also possible to achieve obvious clonality. Under some conditions, the amplification of the first target nucleic acid can be carried out to prepare a sufficient number of copies to effectively compete or overwhelm the point of generation of the copy of the second target nucleic acid transported to the site. For example, in an embodiment using a bridge amplification process on circular features with a diameter of less than 500 nm, it has been determined that after 14 cycles of exponential amplification of the first target nucleic acid, contamination from a second target nucleic acid from the same site produced an insufficient number of contaminating amplicons to adversely affect synthesis sequencing analysis on the Illumina sequencing platform.

[0262] In some embodiments, the amplification sites in the array can be but not necessarily completely cloned. Instead, for some applications, a single amplification site can be mainly filled with the amplicon from the first index fragment, and can also have a low-level contamination amplicon from the second target nucleic acid. The array can have one or more amplification sites with low-level contamination amplicon, as long as the contamination level will not produce unacceptable effects on the subsequent use of the array. For example, when the array is used in detection applications, an acceptable contamination level is a level that will not affect the resolution of the signal-to-noise ratio or detection technology in an unacceptable manner. Therefore, obvious clonality is usually related to the specific use or application of the array made by the method set forth herein. For a specific application, the exemplary contamination level acceptable at a single amplification site includes but is not limited to at most 0.1%, 0.5%, 1%, 5%, 10% or 25% of the contamination amplicon. The array can include one or more amplification sites with these exemplary contamination amplicon levels. For example, up to 5%, 10%, 25%, 50%, 75% or even 100% of the amplification sites in the array can have some contamination amplicons. It will be appreciated that at least 50%, 75%, 80%, 85%, 90%, 95%, or 99% or more of the sites in an array or other collection of sites may be clonal or apparently clonal.

[0263] In some embodiments, kinetic exclusion can occur when a process occurs at a sufficiently fast rate to effectively exclude another event or process from occurring. Take the preparation of a nucleic acid array in which the sites of the array are randomly inoculated with three index fragments from a solution and a copy of the three index fragments is produced during the amplification process to fill each inoculation site to capacity as an example. According to the kinetic exclusion method of the present disclosure, inoculation and amplification processes can be carried out simultaneously under the condition that the amplification rate exceeds the inoculation rate. In this way, the relatively fast rate of forming a copy at the site that has been inoculated with the first target nucleic acid effectively excludes the second nucleic acid from being inoculated with the site for amplification. The kinetic exclusion amplification method can be carried out as described in detail in U.S. Patent Application Publication No. 2013 / 0338042.

[0264] Kinetic exclusion can take advantage of a relatively slow rate of initiating amplification (e.g., a slow rate of forming the first copy of an index fragment) and a relatively fast rate of forming subsequent copies of three index fragments (or the first copy of an index fragment). In the example of the previous paragraph, kinetic exclusion occurs due to a relatively slow rate of index fragment seeding (e.g., relatively slow diffusion or transport) and a relatively fast rate at which amplification occurs to fill sites with copies of index fragment seeds. In another exemplary embodiment, kinetic exclusion may occur due to a delay in the formation of the first copy of an index fragment of a seeded site (e.g., a delay or slow activation) and a relatively fast rate at which subsequent copies are formed to fill sites. In this example, a single site may have been seeded with several different index fragments (e.g., several index fragments may exist at each site before amplification). However, the formation of the first copy of any given index fragment may be randomly activated, so that the average rate of first copy formation is relatively slow compared to the rate at which subsequent copies are generated. In this case, although a single site may have been seeded with several different index fragments, kinetic exclusion only allows amplification of one of those index fragments. More specifically, once the first index segment is activated for amplification, the site is rapidly filled to capacity with its copies, thereby preventing copies of the second index segment from forming at the site.

[0265] In one embodiment, the method is performed to simultaneously (i) transport the index fragments to the amplification site at an average transport rate, and (ii) amplify the index fragments located at the amplification site at an average amplification rate, wherein the average amplification rate exceeds the average transport rate (U.S. Patent No. 9,169,513). Therefore, in such embodiments, kinetic exclusion can be achieved by using a relatively slow transport rate. For example, a sufficiently low index fragment concentration can be selected to achieve the desired average transport rate, and a lower concentration results in a slower average transport rate. Alternatively or additionally, the presence of a molecular crowding reagent in a high viscosity solution and / or solution can be used to reduce the transport rate. Examples of useful molecular crowding reagents include, but are not limited to, polyethylene glycol (PEG), polysucrose (ficoll), dextran, or polyvinyl alcohol. Exemplary molecular crowding reagents and preparations are provided in U.S. Patent No. 7,399,590, which is incorporated herein by reference. Another factor that can be adjusted to achieve the desired transport rate is the average size of the target nucleic acid.

[0266] Amplification reagents may include other components that promote amplicon formation and increase the rate of amplicon formation in some cases. An example is a recombinase. Recombinases can promote amplicon formation by allowing repeated invasion / extension. More specifically, recombinases can use index fragments as templates for amplicon formation to promote the invasion of index fragments of polymerases and primer extension of polymerases. This process can be repeated as a chain reaction, wherein the amplicon produced by each round of invasion / extension is used as a template in subsequent rounds. Since no denaturation cycle (e.g., by heating or chemical denaturation) is required, the process can occur faster than standard PCR. In this way, the amplification promoted by the recombinase can be carried out isothermally. It is generally desirable to include ATP or other nucleotides (or in some cases, non-hydrolyzable analogs thereof) in the amplification reagent promoted by the recombinase to promote amplification. A mixture of recombinase and single-stranded binding (SSB) protein is particularly useful because SSB can further promote amplification. Exemplary preparations for amplification promoted by recombinases include those sold commercially by TwistDx (Cambridge, UK) with TwistAmp test kits. Useful components and reaction conditions for recombinase-facilitated amplification reagents are described in US 5,223,414 and US 7,399,590.

[0267] Another example of a component that can be included in the amplification reagent to promote amplicon formation and increase the amplicon formation rate in some cases is a helicase. The helicase can promote amplicon formation by a chain reaction that allows the amplicon to form. Since no denaturation cycle (e.g., by heating or chemical denaturation) is required, the process can occur faster than standard PCR. In this way, the amplification promoted by the helicase can be carried out isothermally. A mixture of helicase and single-stranded binding (SSB) protein is particularly useful because SSB can further promote amplification. Exemplary formulations for the amplification promoted by the helicase include those sold commercially as IsoAmp test kits by Biohelix (Beverly, MA). In addition, examples of useful formulations including helicase proteins are described in US 7,399,590 and US 7,829,284.

[0268] Yet another example of a component that can be included in an amplification reagent to promote amplicon formation, and in some cases increase the rate of amplicon formation, is an origin binding protein.

[0269] Sequencing Applications / Sequencing Methods

[0270] After the indexed fragments are attached to the surface, the sequence of the fixed and amplified indexed fragments is determined. Sequencing can be performed using any suitable sequencing technology, and methods for determining the sequence of fixed and amplified indexed fragments, including strand resynthesis, are known in the art and are described, for example, in Bignell et al. (US 8,053,192), Gunderson et al. (WO2016 / 130704), Shen et al. (US 8,895,249), and Pipenburg et al. (US 9,309,502).

[0271] Methods described herein can be used in combination with a variety of nucleic acid sequencing techniques. Particularly suitable techniques are those in which nucleic acids are connected to fixed positions in an array so that their relative positions remain unchanged, and in which the array is repeatedly imaged. Particularly suitable are embodiments in which images are obtained with different color channels, for example, consistent with the different marks used to distinguish a type of nucleotide base from another type of nucleotide base. In some embodiments, the process of determining the nucleotide sequence of an index fragment can be an automated process. Preferred embodiments include synthetic sequencing ("SBS") technology.

[0272] SBS technology generally relates to the enzymatic extension of the nascent nucleic acid chain by the iterative addition of nucleotides for the template strand. In the conventional method of SBS, the single nucleotide monomer can be provided to the target nucleotide in the presence of a polymerase in each delivery. However, in the method described herein, in the presence of a polymerase in the delivery, one or more types of nucleotide monomers can be provided to the target nucleic acid.

[0273] In one embodiment, the nucleomonomer comprises a locked nucleic acid (LNA) or a bridged nucleic acid (BNA). The use of LNA or BNA in the nucleomonomer increases the hybridization intensity between the nucleomonomer and the sequencing primer sequence present on the immobilized index fragment.

[0274] SBS can use the nucleotide monomer with terminator part or those nucleotide monomers without any terminator part.The method using the nucleotide monomer lacking terminator includes, for example, pyrophosphate sequencing and the sequencing of nucleotides using γ-phosphate labeling, as further described in detail herein.In the method using the nucleotide monomer lacking terminator, the nucleotide quantity added in each cycle is usually variable, and depends on the mode of template sequence and nucleotide delivery.For the SBS technology utilizing the nucleotide monomer with terminator part, terminator may be effectively irreversible under the sequencing conditions used, as in the case of traditional Sanger sequencing for dideoxynucleotides, or terminator may be reversible, as in the case of sequencing method developed by Solexa (now Illumina, Inc.).

[0275] The SBS technique can use nucleotide monomers with a labeling portion or those lacking a labeling portion. Thus, incorporation events can be detected based on properties of the label, such as fluorescence of the label; properties of the nucleotide monomer, such as molecular weight or charge; byproducts of nucleotide incorporation, such as release of pyrophosphate; and the like. In embodiments where two or more different nucleotides are present in the sequencing reagent, the different nucleotides can be distinguished from each other, or alternatively, the two or more different labels may be indistinguishable under the detection technology used. For example, different nucleotides present in the sequencing reagent can have different labels, and they can be distinguished using appropriate optical devices, as exemplified by the sequencing method developed by Solexa (now Illumina, Inc.).

[0276] Preferred embodiments include pyrophosphate sequencing techniques. Pyrophosphate sequencing detects the release of inorganic pyrophosphate (PPi) as specific nucleotides are incorporated into nascent chains (Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlen, M., and Nyren, P. (1996) "Real-time DNA sequencing using detection of pyrophosphate release." Analytical Biochemistry 242 (1), 84-9; Ronaghi, M. (2001) "Pyrosequencing sheds light on DNA sequencing." Genome Res. 11 (1), 3-11; Ronaghi, M., Uhlen, M., and Nyren, P. (1998) "A sequencing method based on real-time pyrophosphate." Science 281 (5375), 363; U.S. Pat. Nos. 6,210,891; 6,258,568 and 6,274,320). In pyrophosphate sequencing, the released PPi can be detected by being immediately converted into adenosine triphosphate (ATP) by ATP sulfurylase, and the level of ATP produced is detected by the photons produced by luciferase. The nucleic acid to be sequenced can be connected to the features in the array, and the array can be imaged to capture the chemiluminescent signals generated due to the incorporation of nucleotides at the features of the array. After processing the array with a specific nucleotide type (such as A, T, C or G), an image can be obtained. The images obtained after each nucleotide type is added are different about which features in the array are detected. These differences in the image reflect the different sequence contents of the features on the array. However, the relative position of each feature remains unchanged in the image. The image can be stored, processed and analyzed using the method set forth herein. For example, the image obtained after processing the array with various different nucleotide types can be disposed in the same manner as the image obtained from different detection channels for the sequencing method based on reversible terminators exemplified herein.

[0277] In another exemplary SBS type, cycle sequencing is accomplished by gradually adding reversible terminator nucleotides, which include, for example, cleavable or photobleachable dye labels, such as described in WO 04 / 018497 and U.S. Patent No. 7,057,026. The method is commercialized by Solexa (now Illumina Inc.) and is also described in WO 91 / 06678 and WO 07 / 123,744. The availability of fluorescently labeled terminators in which terminators can be reversed and fluorescent labels can be cleaved promotes effective cyclic reversible termination (CRT) sequencing. Polymerases can also be co-engineered to effectively incorporate modified nucleotides and extend from these modified nucleotides.

[0278] In some sequencing embodiments based on reversible terminators, the label does not substantially inhibit extension under SBS reaction conditions. However, the detection label can be removed, for example, by cutting or degradation. The image can be captured after the label is incorporated into the arrayed nucleic acid feature. In a specific embodiment, each cycle involves delivering four different nucleotide types to the array simultaneously, and each nucleotide type has a spectrally different label. Four images can then be obtained, each image using a detection channel that is selective to one of the four different labels. Alternatively, different nucleotide types can be added sequentially, and the image of the array can be obtained between each addition step. In such an embodiment, each image shows the nucleic acid features of the specific type of nucleotide that has been incorporated. Due to the different sequence content of each feature, different features may or may not exist in different images. However, the relative position of the feature remains unchanged in the image. As described herein, the images obtained from this reversible terminator-SBS method can be stored, processed and analyzed. After the image capture step, the label can be removed and the reversible terminator portion can be removed for subsequent nucleotide addition and detection cycles. Removing the label after detecting the label in a specific cycle and before the subsequent cycle can provide the advantage of reducing background signals and crosstalk between cycles. Examples of useful labeling and removal methods are described herein.

[0279] In a specific embodiment, some or all of the nucleotide monomers may include a reversible terminator. In such an embodiment, the reversible terminator / cleavable fluorophore may include a fluorophore connected to a ribose moiety via a 3' ester bond (Metzker, Genome Res. 15: 1767-1776 (2005)). Other methods separate terminator chemistry from the cleavage of a fluorescent label (Ruparel et al., Proc Natl Acad Sci USA 102: 5932-7 (2005)). Ruparel et al. describe the development of a reversible terminator that uses a small 3' allyl group to block extension, but can be easily unblocked by a short treatment with a palladium catalyst. The fluorophore is connected to the base via a photocleavable linker that can be easily cleaved by 30 seconds of long wavelength ultraviolet irradiation. Therefore, disulfide reduction or photocleavage can be used as a cleavable linker. Another method of reversible termination is to use natural termination that is ensured after arranging a bulky dye on the dNTP. The presence of a charged bulky dye on a dNTP can act as an effective terminator through steric and / or electrostatic hindrance. Unless the dye is removed, the presence of an incorporation event prevents further incorporation. Cleavage of the dye removes the fluorophore and effectively reverses termination. Examples of modified nucleotides are also described in U.S. Patent Nos. 7,427,673 and 7,057,026.

[0280] Additional exemplary SBS systems and methods that may be used with the methods and systems described herein are described in U.S. Publication Nos. 2007 / 0166705, 2006 / 0188901, 2006 / 0240439, 2006 / 0281109, 2012 / 0270305, and 2013 / 0260372, U.S. Patent Application No. 7,057,026, PCT Publication No. WO 05 / 065814, U.S. Patent Application Publication No. 2005 / 0100900, and PCT Publication Nos. WO 06 / 064199 and WO 07 / 010,251.

[0281] Some embodiments can use the detection of four different nucleotides less than four different labels.For example, SBS can be performed using the method and system described in the incorporation material of the U.S. Publication No.2013 / 0079232.As a first example, a pair of nucleotide types can be detected at the same wavelength, but based on the intensity difference of a member of the pair relative to another member, or based on a member of the pair compared with the signal detected for another member of the pair, causing a change (for example, by chemical modification, photochemical modification or physical modification) that causes obvious signal to appear or disappear.As a second example, three of four different nucleotide types can be detected under specific conditions, and the fourth nucleotide type lacks a detectable mark under those conditions, or the minimum detection (for example, due to background fluorescence, etc.) under these conditions. The first three nucleotide types can be determined to be incorporated into nucleic acid based on the presence of their respective signals, and the fourth nucleotide type can be determined to be incorporated into nucleic acid according to the absence or minimum detection of any signal.As a third example, a nucleotide type can include a mark detected in two different channels, and detects other nucleotide types in no more than one channel.The aforementioned three exemplary configurations are not considered to be mutually exclusive, and can be used in various combinations. An exemplary embodiment combining all three examples is a fluorescence-based SBS method that uses a first nucleotide type detected in a first channel (e.g., dATP with a label that is detected when excited in the first channel by a first excitation wavelength), a second nucleotide type detected in a second channel (e.g., dCTP with a label that is detected when excited in the second channel by a second excitation wavelength), a third nucleotide type detected in the first and second channels (e.g., dTTP with at least one label that is detected when excited in both channels by the first and / or second excitation wavelengths), and a fourth nucleotide type that lacks a label and is not detected or minimally detected in either channel (e.g., dTTP without a label).

[0282] In addition, as described in the incorporated materials of U.S. Publication No. 2013 / 0079232, sequencing data can be obtained using a single channel. In this so-called single-dye sequencing method, a first nucleotide type is labeled, but the label is removed after the first image is generated, and a second nucleotide type is labeled only after the first image is generated. A third nucleotide type retains its label in both the first and second images, and a fourth nucleotide type remains unlabeled in both images.

[0283] Some embodiments can use sequencing by ligation technology. Such technology uses DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides. Oligonucleotides generally have different tags related to the identity of specific nucleotides in the sequence to which the oligonucleotides hybridize. As with other SBS methods, images can be obtained after processing an array of nucleic acid features with labeled sequencing reagents. Each image shows nucleic acid features with a specific type of tag incorporated. Due to the different sequence content of each feature, different features may or may not exist in different images, but the relative position of the feature remains unchanged in the image. As described herein, images obtained from sequencing methods based on connection can be stored, processed and analyzed. Exemplary SBS systems and methods that can be used together with the methods and systems described herein are described in U.S. Patent Nos. 6,969,488, 6,172,218 and 6,306,597.

[0284] Some embodiments may use nanopore sequencing (Deamer, DW & Akeson, M. "Nanopores and nucleic acids: prospects for ultrarapid sequencing." Trends Biotechnol. 18, 147-151 (2000); Deamer, D. and D. Branton, "Characterization of nucleic acids by nanopore analysis", Acc. Chem. Res. 35: 817-825 (2002); Li, J., M. Gershow, D. Stein, E. Brandin and J. A. Golovchenko, "DNA molecules and configurations in a solid-state nanopore microscope" Nat. Mater. 2: 611-615 (2003)). In such embodiments, the indexed fragments pass through the nanopore. The nanopore can be a synthetic pore or a biological membrane protein, such as α-hemolysin. As the index fragment passes through the nanopore, each base pair can be identified by measuring the fluctuations in the conductivity of the pore (U.S. Patent No. 7,001,792; Soni, GV & Meller, "A. Progress toward ultrafast DNA sequencing using solid-state nanopores." Clin. Chem. 53, 1996-2001 (2007); Healy, K. "Nanopore-based single-molecule DNA analysis." Nanomed. 2, 459-481 (2007); Cockroft, SL, Chu, J., Amorin, M. & Ghadiri, MR "A single-molecule nanopore device detects DNA polymerase activity with single-nucleotide resolution." J. Am. Chem. Soc. 130, 818-820 (2008)). As described herein, data obtained from nanopore sequencing can be stored, processed, and analyzed. In particular, the data can be processed as images according to the exemplary processing of optical images and other images described herein.

[0285] Some embodiments may use methods involving real-time monitoring of DNA polymerase activity. Nucleotide incorporation may be detected by fluorescence resonance energy transfer (FRET) interactions between polymerases carrying fluorophores and γ-phosphate labeled nucleotides (as described, for example, in U.S. Pat. Nos. 7,329,492 and 7,211,414), or nucleotide incorporation may be detected using zero-mode waveguides (as described, for example, in U.S. Pat. No. 7,315,019) and using fluorescent nucleotide analogs and engineered polymerases (as described, for example, in U.S. Pat. No. 7,405,281 and U.S. Publication No. 2008 / 0108082). Illumination can be confined to a zeptoliter-scale volume around a surface-bound polymerase, allowing incorporation of fluorescently labeled nucleotides to be observed with low background (Levene, MJ et al. "Zero-mode waveguides for single-molecule analysis at high concentrations." Science 299, 682-686 (2003); Lundquist, PM et al. "Parallel confocal detection of single molecules in realtime." Opt. Lett. 33, 1026-1028 (2008); Korlach, J. et al. "Selective aluminum passivation for targeted immobilization of single DNA polymerase molecules inzero-mode waveguide nano structures." Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008)). Images obtained from these methods can be stored, processed, and analyzed as described herein.

[0286] Some SBS embodiments include detecting the protons released when the nucleotides are incorporated into the extension products. For example, sequencing based on the detection of released protons can use electrical detectors and related technologies commercially available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies) or sequencing methods and systems described in U.S. Publication Nos. 2009 / 0026082; 2009 / 0127589; 2010 / 0137143; and 2010 / 0282617. The method for amplifying target nucleic acids using kinetic exclusion as described herein can be easily applied to a matrix for detecting protons. More specifically, the method described herein can be used to generate a clonal population of amplicons for detecting protons.

[0287] The above-mentioned SBS method can be advantageously performed in a multiplex format so that a plurality of different index fragments are operated simultaneously. In a specific embodiment, different index fragments can be processed in a common reaction vessel or on the surface of a specific matrix. This allows to conveniently deliver sequencing reagents, remove unreacted reagents and detect incorporation events in a multiplex manner. In an embodiment using a surface-bound target nucleic acid, the fragment of the index can be in array form. In the array form, the fragment of the index can be generally bound to the surface in a spatially distinguishable manner. The fragment of the index can be combined by direct covalent attachment, attachment to beads or other particles or attachment to polymerase or other molecules attached to the surface. The array can include a single copy of the index fragment at each site (also referred to as feature), or multiple copies with the same sequence can be present at each site or feature. As described in further detail herein, multiple copies can be produced by amplification methods such as bridge amplification or emulsion PCR.

[0288] The methods described herein can use arrays having features at any of a variety of densities, including, for example, at least about 10 features / cm2, 100 features / cm2, 500 features / cm2, 1,000 features / cm2, 5,000 features / cm2, 10,000 features / cm2, 50,000 features / cm2, 100,000 features / cm2, 1,000,000 features / cm2, 5,000,000 features / cm2, or more.

[0289] The advantage of the method set forth herein is that they are used for fast and effectively parallel detection of multiple cm2. Therefore, the present disclosure provides an integrated system that can prepare and detect nucleic acid using technology known in the art such as those illustrated herein. Therefore, the integrated system of the present disclosure can include a fluid assembly that can deliver amplification reagents and / or sequencing reagents to one or more fixed index fragments, and the system includes components such as pumps, valves, reservoirs, fluid pipelines, etc. The flow cell can be configured in the integrated system and / or used in the integrated system for detecting target nucleic acid. Exemplary flow cells are described in, for example, U.S. Publication No.2010 / 0111768 and U.S. Series No.13 / 273,666. As illustrated for the flow cell, one or more fluid assemblies of the integrated system can be used for amplification method and detection method. Taking nucleic acid sequencing embodiment as an example, one or more fluid assemblies of the integrated system can be used for amplification method as described herein and for the delivery of sequencing reagents in sequencing method (such as those illustrated above). Alternatively, the integrated system can include a separate fluid system to perform amplification method and perform detection method. Examples of integrated sequencing systems capable of producing amplified nucleic acids and determining the sequence of nucleic acids include, but are not limited to, the MiSeq™ platform (Illumina, Inc., San Diego, CA) and the device described in US Serial No. 13 / 273,666.

[0290] Compositions are also provided herein. In the process of implementing the methods described herein, various compositions can be obtained. For example, a composition comprising three indexed nucleic acid fragments can be obtained. A multi-well plate is also provided, wherein the holes of the multi-well plate include indexed nucleic acid fragments.

[0291] Kits are also provided herein. In one embodiment, the kit is used to prepare a sequencing library. The kit includes a transposome and / or a linear amplification medium described herein in an amount sufficient for at least one assay or use in a suitable packaging material. Optionally, other components may be included, such as one or more nucleic acids (including primers, indexes, universal sequences, or a combination thereof). Other components that may be included are reagents such as buffers and solutions. Instructions for use of the packaging components are also generally included. As used herein, the phrase "packaging material" refers to one or more physical structures for containing the contents of the kit. The packaging material is constructed by conventional methods, generally providing a sterile, non-contaminated environment. The packaging material may have a label indicating how to use the components of the sequencing library. In addition, the packaging material contains instructions for explaining how to use the materials in the kit. As used herein, the term "packaging" refers to a container such as glass, plastic, paper, foil, etc., which is capable of keeping the components of the kit within fixed limits. "Instructions for use" generally include a tangible expression describing the concentration of a reagent or at least one assay method parameter, such as the relative amounts of the reagents and samples to be mixed, the maintenance time of the reagent / sample mixture, temperature, buffer conditions, and the like.

[0292] Exemplary embodiments

[0293] Embodiment 1. A method for preparing a sequencing library, wherein the sequencing library comprises nucleic acids from a plurality of single nuclei or a single cell, the method comprising:

[0294] providing a plurality of isolated nuclei or cells in a first plurality of compartments, wherein each compartment comprises a subset of isolated nuclei or cells, and wherein the nuclei or cells comprise nucleic acid fragments;

[0295] The cell or cell nucleus introduces a linear amplification mediator;

[0296] amplifying the nucleic acid fragment by linear amplification;

[0297] processing each subset of nuclei or cells to generate indexed nuclei or cells, wherein the processing comprises adding a first compartment-specific index sequence to nucleic acid fragments present in the isolated nuclei or cells to produce indexed nucleic acids present in the isolated nuclei or cells, wherein the processing comprises ligation, primer extension, hybridization, amplification, or transposition; and

[0298] The indexed nuclei or cells are combined to produce merged indexed nuclei or cells, thereby producing a sequencing library from the plurality of nuclei or cells.

[0299] Embodiment 2. The method of embodiment 1, wherein the amplification occurs before the processing.

[0300] Embodiment 3. The method of embodiment 1, wherein the processing occurs before the amplifying.

[0301] Embodiment 4. A method for preparing a sequencing library, the sequencing library comprising nucleic acids from a plurality of single nuclei or a single cell, the method comprising:

[0302] providing a plurality of isolated nuclei or cells, wherein the nuclei or cells contain nucleic acid fragments;

[0303] introducing a linear amplification mediator into the isolated nuclei or cells;

[0304] distributing the isolated nuclei or cells into a first plurality of compartments, wherein each compartment contains a subset of the isolated nuclei or cells;

[0305] amplifying the nucleic acid fragment by linear amplification;

[0306] processing each subset of the isolated nuclei or cells to generate indexed nuclei or cells, wherein the processing comprises adding a first compartment-specific index sequence to nucleic acid fragments present in the isolated nuclei or cells to produce indexed nucleic acids present in the isolated nuclei or cells, wherein the processing comprises ligation, primer extension, amplification, or transposition;

[0307] The indexed nuclei are combined to produce merged indexed nuclei or cells, thereby producing a sequencing library from the plurality of nuclei or cells.

[0308] Embodiment 5. A method for preparing a sequencing library, the sequencing library comprising nucleic acids from a plurality of single nuclei or a single cell, the method comprising:

[0309] providing a plurality of isolated nuclei or cells in a first plurality of compartments, wherein each compartment comprises a subset of isolated nuclei or cells, and wherein the nuclei or cells comprise nucleic acid fragments;

[0310] processing each subset of nuclei or cells to generate indexed nuclei or cells, wherein the processing comprises adding to the nucleic acid fragments present in the isolated nuclei or cells (i) a first compartment-specific index sequence to generate indexed nucleic acids present in the isolated nuclei or cells and (ii) a nucleotide sequence recognized by a linear amplification mediator; wherein the processing comprises ligation, primer extension, hybridization, amplification, or transposition;

[0311] introducing a linear amplification mediator into the cell or cell nucleus;

[0312] amplifying the nucleic acid fragment by linear amplification; and

[0313] The indexed nuclei or cells are combined to produce merged indexed nuclei or cells, thereby producing a sequencing library from the plurality of nuclei or cells.

[0314] Embodiment 6. The method of any one of Embodiments 1-5, wherein the linear amplification mediator comprises a bacteriophage RNA polymerase or a linear amplification primer.

[0315] Embodiment 7. The method of any one of embodiments 1-6, wherein the nucleic acid fragment comprises a T7 promoter and the bacteriophage RNA polymerase comprises a T7 RNA polymerase.

[0316] Embodiment 8. The method of any one of Embodiments 1-7, wherein introducing the linear amplification mediator comprises adding the linear amplification mediator to the nucleic acid fragments present in the isolated cell nucleus or cell.

[0317] Embodiment 9. The method of any one of Embodiments 1-8, further comprising exposing the plurality of separated nuclei or cells of each compartment to predetermined conditions.

[0318] Embodiment 10. The method of any one of Embodiments 1-9, further comprising isolating cell nuclei from the plurality of cells after the exposing.

[0319] Embodiment 11. The method of any one of Embodiments 1-10, further comprising exposing the plurality of isolated nuclei or cells to predetermined conditions.

[0320] Embodiment 12. The method of any one of Embodiments 1-11, further comprising subjecting the isolated cell nucleus to conditions that produce a nucleosome-depleted cell nucleus while maintaining the integrity of the isolated cell nucleus.

[0321] Embodiment 13. The method of any one of Embodiments 1-12, wherein the treating comprises:

[0322] contacting each subset with a transposome complex, wherein the transposome complex in each compartment comprises the first index sequence that is different from the first index sequence in the other compartments; and

[0323] The nucleic acids in the subset are fragmented into a plurality of nucleic acids, and the first index sequence is incorporated into at least one strand of the nucleic acids to generate the indexed nuclei or cells comprising the indexed nucleic acids.

[0324] Embodiment 14. The method of any one of Embodiments 1-13, wherein the treating comprises:

[0325] Each subset is contacted with a reverse transcriptase and primers that anneal to RNA molecules in the isolated cell nuclei, wherein the primers in each compartment contain the first index sequence that is different from the first index sequences in other compartments, to generate the indexed cell nuclei or cells containing the indexed nucleic acids.

[0326] Embodiment 15. The method of any one of Embodiments 1-14, wherein the contacting further comprises a target-specific primer that anneals to a specific nucleotide sequence.

[0327] Embodiment 16. The method of any one of Embodiments 1-15, wherein the processing of adding the first compartment-specific index sequence comprises a two-step process of adding a nucleotide sequence comprising a universal sequence to the nucleic acid fragment and then adding the first compartment-specific index sequence to the nucleic acid fragment.

[0328] Embodiment 17. The method of any one of embodiments 1-16, wherein the adding comprises a transposome complex comprising a universal sequence.

[0329] Embodiment 18. The method of any one of Embodiments 1-17, wherein the processing comprises adding a first index to a DNA nucleic acid present in the isolated cell nucleus or cell, adding a first index to an RNA nucleic acid present in the isolated cell nucleus or cell, or a combination thereof.

[0330] Embodiment 19. The method of any one of embodiments 1-18, wherein adding the first index sequence to the RNA nucleic acid comprises:

[0331] Each subset is contacted with a reverse transcriptase and primers that anneal to RNA molecules in said isolated nuclei or cells, wherein said primers in each compartment comprise said first compartment-specific index sequence to produce said indexed nuclei or cells comprising said indexed nucleic acids.

[0332] Embodiment 20. The method of any one of embodiments 1-19, wherein adding the first index sequence to the DNA nucleic acid comprises:

[0333] contacting each subset with a transposome complex, wherein the transposome complex in each compartment comprises the first compartment-specific index sequence;

[0334] The nucleic acids in the subset are fragmented into a plurality of nucleic acids, and the first compartment-specific index sequence is incorporated into at least one strand of the nucleic acids to generate the indexed nuclei or cells comprising the indexed nucleic acids.

[0335] Embodiment 21. The method of any of Embodiments 1-20, wherein the first index sequence added to the DNA nucleic acid and the first index sequence added to the RNA nucleic acid in each compartment are the same.

[0336] Embodiment 22. The method of any one of Embodiments 1-21, wherein the first index sequence added to the DNA nucleic acid and the first index sequence added to the RNA nucleic acid in each compartment are different.

[0337] Embodiment 23. The method of any one of Embodiments 1-22, further comprising exponential amplification of the nucleic acid fragments, wherein the exponential amplification comprises target-specific primers that anneal to specific nucleotide sequences.

[0338] Embodiment 24. The method of any one of embodiments 1-23, further comprising after the combining:

[0339] distributing the merged, indexed subset of nuclei or cells into a second plurality of compartments; and

[0340] Introducing a second compartment-specific indexing sequence into the indexed nucleic acid to generate a dual-indexed nucleus or cell comprising the dual-indexed nucleic acid, wherein the introducing comprises ligation, primer extension, amplification, or transposition.

[0341] Embodiment 25. The method of any one of embodiments 1-24, further comprising

[0342] combining the dual-indexed nuclei to generate merged dual-indexed nuclei or cells,

[0343] distributing a subset of the merged dual-indexed nuclei or cells into a third plurality of compartments; and

[0344] A third compartment-specific indexing sequence is introduced into the indexed nucleic acid to generate a triply-indexed nucleus or cell comprising the triply-indexed nucleic acid, wherein the introducing comprises ligation, primer extension, amplification or transposition.

[0345] Embodiment 26. The method of any one of embodiments 1-25, further comprising processing the indexed cell nuclei or cells for methylation analysis to generate nucleic acid fragments suitable for methylation analysis.

[0346] Embodiment 27. The method of any one of embodiments 1-26, further comprising subjecting the indexed nuclei or cells to proximity ligation to generate nucleic acid fragments suitable for analyzing chromatin conformation.

[0347] Embodiment 28. The method of any one of Embodiments 1-27, further comprising amplifying the nucleic acid fragments of the sequencing library to produce DNA nanoballs.

[0348] Embodiment 29. The method of any of Embodiments 1-28, wherein the compartment comprises a well or a droplet.

[0349] Embodiment 30. The method of any one of Embodiments 1-29, wherein each compartment of the first plurality of compartments comprises 50 to 100,000,000 nuclei or cells.

[0350] Embodiment 31. The method of any of Embodiments 1-29, wherein each compartment of the second plurality of compartments comprises 50 to 100,000,000 nuclei or cells.

[0351] Embodiment 32. The method of any one of Embodiments 1-31, further comprising:

[0352] providing a surface comprising a plurality of amplification sites, wherein the amplification sites comprise at least two populations of attached single-stranded capture oligonucleotides having free 3' ends, and

[0353] A surface comprising amplification sites is contacted with the indexed fragments under conditions suitable for generating a plurality of amplification sites, each amplification site comprising a clonal population of amplicons from a single fragment comprising the plurality of indexes.

[0354] Embodiment 33. A method for preparing a sequencing library comprising nucleic acids from a plurality of single cells, the method comprising:

[0355] (a) providing isolated cell nuclei from a plurality of cells;

[0356] (b) chemically treating the isolated cell nucleus to produce a nucleosome-depleted cell nucleus while maintaining the integrity of the isolated cell nucleus;

[0357] (c) distributing subsets of the nucleosome-depleted nuclei into a first plurality of compartments and contacting each subset with a transposome complex, wherein the transposome complex in each compartment comprises a transposase and a first index sequence that is different from first index sequences in other compartments;

[0358] (d) fragmenting the nucleic acid in the subset of the nucleosome-depleted nuclei into a plurality of nucleic acid fragments and incorporating the first index sequence into at least one strand of the nucleic acid fragments to generate indexed nuclei comprising indexed nucleic acid fragments, wherein the indexed nucleic acid fragments remain attached to the transposase;

[0359] (d) combining the indexed nuclei to generate merged indexed nuclei;

[0360] (e) distributing subsets of the merged indexed nuclei into a second plurality of compartments and contacting each subset with a hairpin ligated duplex under conditions suitable for ligation of the hairpin ligated duplex to one or both ends of the indexed nucleic acid fragments, thereby generating dual-indexed nucleic acid fragments, wherein the hairpin ligated duplex comprises a second index sequence that is different from the second index sequence in the other compartments;

[0361] (f) combining the dual-indexed nuclei to generate merged indexed nuclei;

[0362] (g) distributing a subset of the merged dual-indexed nuclei into a third plurality of compartments;

[0363] (h) lysing the dual-indexed cell nuclei;

[0364] (i) processing the dual-indexed nucleic acid fragments to include a third index sequence that is different from the third index sequence in the other compartment; and

[0365] (j) combining the three indexed fragments to generate a sequencing library comprising whole genome nucleic acids from the plurality of single cells.

[0366] Example

[0367] The present disclosure is illustrated by the following examples. It is to be understood that the specific examples, materials, amounts, and processes are to be interpreted broadly in accordance with the scope and spirit of the present disclosure as described herein.

[0368] Example 1

[0369] High-throughput single-cell sequencing using linear amplification

[0370] Conventional methods for single-cell genome sequencing are limited in uniformity and yield. Here, we describe “sci-L3,” a high-throughput, high-coverage single-cell sequencing approach that combines single-cell combinatorial indexing (“sci”) and linear (“L”) amplification. The sci-L3 approach employs a unidirectional 3-level (“3”) indexing scheme that minimizes amplification bias while enabling an exponential increase in throughput. We demonstrate the general applicability of the sci-L3 framework through proof-of-concept demonstrations of single-cell whole-genome sequencing (“sci-L3-WGS”), targeted genome sequencing (“sci-L3-target-seq”), and co-assaying of the genome and transcriptome (“sci-L3-RNA / DNA”). We applied sci-L3-WGS to genomic profiles of >10,000 sperm and sperm precursors from F1 hybrid male mice, localizing 86,786 crossovers and characterizing rare chromosome missegregation events in male meiosis, including cases of genome-wide equal chromosome segregation. We anticipate that sci-L3 analysis can be applied to comprehensively characterize recombination scenarios, combine measurements of CRISPR perturbations and genome stability, and achieve other goals that require high-throughput, high-coverage single-cell genome sequencing.

[0371] introduction

[0372] Contemporary single-cell genome sequencing technologies have two major limitations. First, most methods require compartmentalization of individual cells, which limits throughput. Second, most amplification methods are PCR-based and therefore suffer from exponential amplification bias. To address the first problem, we and colleagues developed single-cell combinatorial indexing ('sci-'), in which several rounds of split-and-merge molecular barcode labeling are performed to uniquely label the nucleic acid content of single cells, thereby achieving an exponential increase in indexing throughput with each round. Sci- methods have been successfully developed to analyze chromatin accessibility (sci-ATAC-seq), transcriptome (sci-RNA-seq), genome (sci-DNA-seq), methylome (sci-MET), chromosome conformation (sci-Hi-C) of large numbers of single cells (Cao et al., 2017; Cusanovich et al., 2015; Mulqueen et al., 2018; Ramani et al., 2017; Vitak et al., 2017). To address the second problem, linear amplification by T7-based transcription provides a possible solution, which has previously been used in the context of single-cell assays (Eberwine et al., 1992; Hashimshony et al., 2012; Sos et al., 2016). For example, recently, Chen et al. developed a linear amplification technology ("LIANTI") by transposon insertion, which uses Tn5 transposon to fragment the genome and simultaneously inserts a T7 RNA promoter for in vitro transcription (IVT). The RNA copies generated from the DNA template cannot be used as templates for further amplification. Therefore, all copies come directly from the original DNA template. By avoiding exponential amplification, LIANTI maintains uniformity and minimizes sequence errors. However, this method is low-throughput because it requires preparing a series of libraries from each single cell (Chen et al., 2017, Science 356: 189-194).

[0373] To minimize amplification bias while achieving exponential growth in throughput, we developed sci-L3, which integrates single-cell combinatorial indexing and linear amplification. Through three rounds of molecular barcoding, sci-L3 increases the throughput of LIANTI to at least thousands or even millions of cells per experiment while retaining the advantages of linear amplification. We demonstrate the general applicability of the sci-L3 framework through proof-of-concept demonstrations of single-cell whole-genome sequencing (“sci-L3-WGS”), targeted genome sequencing (“sci-L3-target-seq”), and co-analysis of genomes and transcriptomes (“sci-L3-RNA / DNA”). As further demonstration, we applied sci-L3-WGS to locate an unprecedented number of meiotic crossovers and rare chromosome missegregation events in immature and mature male germ cells from infertile interspecies (B6 x Spretus) F1 male mice and fertile intraspecies (B6 x Cast) F1 male mice.

[0374] design

[0375] A potential technical approach to increase throughput while minimizing amplification bias would be to simply combine the “sci” and “LIANTI” approaches. However, the molecular architecture of LIANTI, in which the T7 promoter is inserted via the Tn5 transposon, provides the opportunity for only two rounds of cell barcoding, which would limit the throughput to thousands of single cells per experiment. Furthermore, it is limited to typing of genomic DNA (Chen et al., 2017; Sos et al., 2016). In developing sci-L3, we integrated three rounds of cell barcoding (“tertiary”) of single-cell combinatorial indexing, linear amplification, and introduction of the T7 promoter via ligation ( Figure 3 A). The sci-L3 approach has several major advantages over simply combining “sci” and “LIANTI”. First, through three-level indexing, the potential throughput per experiment increases exponentially to over a million cells per experiment at a greatly reduced cost (Cao et al., 2019). Second, the unidirectional nature of single-cell barcoding makes sci-L3 easily convertible to targeted sequencing (“target-seq”) beyond whole genome sequencing (“WGS”), which enables coupling of CRISPR perturbations and resulting genomic instability, as well as other applications where it is desirable to sequence specific genomic loci in large numbers of single cells. Third, as a broadly applicable linear amplification and high-throughput cell barcoding protocol, sci-L3 provides the flexibility to adapt to other single-cell analyses and co-analyses with minor modifications to the protocol, as demonstrated in this paper’s proof-of-concept of sci-L3-based single-cell RNA / DNA co-analysis.

[0376] result

[0377] Proof of concept of sci-L3-WGS and sci-L3-target-seq

[0378] The three-level combined indexing and amplification scheme for sci-L3-WGS and sci-L3-target-seq is as follows Figure 3 As shown in A: (i) Cells are fixed with formaldehyde and depleted of nucleosomes using SDS (Vitak et al., 2017). The resulting nuclei are then evenly distributed into 24 wells. (ii) A first round of barcoding is added via indexed Tn5 insertion (“tag- ing”) within each of the 24 wells. Unlike LIANTI (where the Tn5 transposon contains a T7 promoter but no barcode), a spacer sequence is included 5′ to the barcode that serves as a “landing pad” for the subsequent ligation step (for details on Tn5 transposon design, see Figure 4 and Example 2, “Methods and Molecular Design of Sci-L3-WGS and sci-L3-target-seq” section). (iii) All nuclei are pooled and evenly distributed into 64 new wells; a second round of barcodes is added by ligation, which includes the T7 promoter sequence located outside the two barcodes. (iv) All nuclei are pooled together again and sorted by fluorescence activated cell sorting (FACS) cytometry and distributed into the final round of wells at a maximum of 300 cells per well. Note that nuclei of different ploidy can be gated and enriched by DAPI (4',6-diamidino-2-phenylindole) staining. Moreover, simple dilution is an alternative to FACS that can reduce the loss rate. (v) Sorted nuclei are lysed and in situ nick extension is performed to form a duplex T7 promoter. This is followed by IVT, reverse transcription (RT) and second strand synthesis (SSS) to amplify the genome in a linear manner. A third round of barcodes is added in the SSS step, as well as unique molecular identifiers (UMIs) to mark individual IVT transcripts. (vi) double-stranded DNA molecules each containing three barcodes defining their cell of origin ( Figure 3 B, top) is compatible with conventional library construction methods if the goal is single-cell WGS (e.g. by ligation ( Figure 3 B, middle) or tagmentation-attached sequence adapters), or is compatible with slightly modified methods if the goal is single-cell targeted DNA-seq (e.g., adding a PCR step where one of the primers is target-specific ( Figure 3 B, bottom)).

[0379] As an initial proof of concept, we mixed mouse and human cells and performed sci-L3-WGS. For more than 95% of the resulting single-cell genomes, the vast majority of reads mapped to either the mouse or human genome, with occasional “collisions” resulting from two or more cells accidentally using the same barcode combination ( Figure 3C). The performance of sci-L3-WGS is compared to LIANTI and our previous PCR-based sci-DNA-seq approach in Table 1. We highlight several advantages of sci-L3-WGS: 1) we routinely recover 90% of sorted cells, compared to 60% recovery for PCR-based sci-DNA-seq (Vitak et al., 2017); 2) using 40% fewer raw reads (329M by sci-L3-WGS vs. 549M by sci-DNA-seq), sci-L3-WGS produces sequence coverage of ~97,000 unique Tn5 insertions per cell, a >3-fold improvement compared to ~30,000 unique insertions by sci-DNA-seq. Sequencing a smaller number of cells to a higher depth, we observed ~660,000 unique Tn5 insertions per cell while maintaining a higher library complexity than sci-DNA-seq, indicating a further improvement of >20-fold; 3) The mappable read fragment rate increased from 61% for LIANTI to 86% for sci-L3-WGS. This may be because LIANTI is completely in-tube and it is therefore difficult to remove artifactual sequences (e.g., self-insertions secondary to Tn5), while for sci-L3-WGS, the nuclei are precipitated several times to remove excess free DNA; 4) Unlike PCR-based amplification, where duplicate read fragments are not informative for SNP calling, the "duplicate" read fragments of sci-L3-WGS are almost always from independent IVT transcripts aggregated from the original template, and can therefore be used for de novo SNV discovery or for genotyping known SNPs.

[0380] Table 1. Performance comparison of sci-DNA-seq and sci-L3-WGS with LIANTI. Sci-DNA-seq data from the xSDS method of (Vitak et al., 2017). LIANTI from the in-line method of (Chen et al., 2017). For sci-L3-WGS, we show the results of libraries yi140 and yi141 (at high sequencing depth) and yi144 and yi145 (at low sequencing depth). These four libraries used an optimized protocol in which we used concentrated Tn5 transposomes (0.2 μM) and an improved RT reaction using additional RNA primers (see for details). Figure 5and Example 2, “Methods and Molecular Design of sci-L3-WGS and sci-L3-target-seq” section). The same colors indicate comparisons of interest. Green: 1.9-fold increase in the percentage of single cells recovered from sorting using sci-L3-WGS compared to sci-DNA-seq; Pink: 1.4-fold increase in the mapping rate of raw reads using sci-L3-WGS compared to LIANTI; Yellow: unique insertion sites at different sequencing depths; Rows 1 and 2 are compared at similar numbers of raw reads compared to sci-DNA-seq, sci-L3-WGS maps 40% fewer raw reads compared to sci-DNA-seq The number of segments had a 3.3-fold improvement, and rows 1 and 3 were compared at similar library complexity, sci-L3-WGS had a 22.4-fold improvement compared to LIANTI with a 20% higher Tn5 insert complexity; Blue: Median library complexity, which shows that the method including both LIANTI and sci-L3-WGS had the fewest PCR replicates; Orange: The number of cells with greater than 50k unique read segments recovered using LIANTI was increased by 1.8-fold compared to LIANTI.

[0381]

[0382] For sci-L3-WGS, Tn5 insertions are present every 0.5-1.5 kb of the human genome on average, and IVT generates ∼1,000 transcripts. This corresponds to 2-6 million unique Tn5 insertions per single cell, and thus 2-6 billion unique genome-derived IVT transcripts. It is currently impractical to sequence the resulting libraries to saturation relative to the number of unique IVT transcripts. Here, we define the “sequencing depth” of each library as the ratio between the number of unique transcripts sequenced and the number of unique Tn5 insertion sites mapped. In this study, most libraries were sequenced at a depth of 1.1x to 2x, resulting in 0.5% to 5% coverage of the genome per cell. Distribution of unique Tn5 insertion sites per cell in human / mouse proof-of-concept experiments is shown in Figure 2. Figure 3 D, and for other experiments as Figure 5 The estimated relative chromosome copy numbers of representative single cells are shown in Figure 3 As shown in E, and as Figure 3 They are distributed across all cells as shown in F. To infer the expected genome coverage per single cell at higher sequencing depths, we fitted the number of unique insertion sites as a function of sequencing depth ( Figure 5 G). We expect to observe 4.2M and 6.0M unique insertions per cell at 5x and 10x sequencing depths, respectively, which corresponds to 16% and 22% coverage of the genome of a single cell.

[0383] As described above, the double-stranded amplicon generated by sci-L3 ( Figure 3 B, top) not only compared with single-cell WGS (sci-L3-WGS; Figure 3 B, middle) and is also compatible with single-cell targeted DNA sequencing ("sci-L3-target-seq"). Specifically, for targeted sequencing, after second-strand synthesis, one primer with a third cell barcode can be used to add sequencing adapters by PCR, while another primer targets a specific region of the genome ( Figure 3 B, bottom). To quantify the recovery efficiency of sci-L3-target-seq, we integrated the lentiviral CRISPR library at a low MOI (see Example 2, “Methods and Molecular Design of sci-L3-WGS and sci-L3-target-seq” section for details) and recovered the DNA sequence corresponding to the sgRNA spacer by sci-L3-target-seq. For 97 of 1003 single cells, we were able to successfully recover a single integrated sgRNA. This 10% efficiency per haplotype is roughly consistent with the 22% genome coverage estimated above by projected sequencing depth ( Figure 5 G).

[0384] Note that at the molecular level, we modified the “sci” and “LIANTI” methods in several ways. In summary, we: 1) changed the design of the Tn5 transposon to be compatible with ligation and thus enable more than two rounds of “sci”, an approach that is likely to generalize to other single-cell analyses, 2) added a loop structure of the T7 promoter to facilitate intramolecular ligation, and 3) changed the RT protocol such that we only require successful ligation at one of the two ends of the barcoded molecule in the first round. Assuming a 50% efficiency of a single ligation event, this modification yields a 75% success rate in the ligation step, instead of 25% ( Figure 5 We compare Figure 4The structure of the molecule is depicted after each barcoding step in , and the rationale for these designs is discussed in Example 2, "Methods and Molecular Design of sci-L3-WGS and sci-L3-targeted t-seq" section. Scalability and cost are also discussed in Example 2 and Table 2. For libraries of 100, 1000, 10,000, and 1 million single cells, we estimate that the cost of sci-L3-WGS is 14%, 1.5%, 0.26%, and 0.014% of the cost of processing the same number of cells with LIANTI, respectively. Combinatorial indexing can be used at three levels instead of two to increase throughput (e.g., the cost of building a library for 1 million cells with 3-level sci-L3-WGS at a conflict rate of 5% is about $8,000), or to reduce the conflict rate (e.g., the cost of building a library for 10,000 cells with a conflict rate of 1% is about $1,500 using 3-level sci-L3-WGS).

[0385] Table 2. Cost calculations for sci-L3-WGS. The current approach involves three levels of indexing, which not only increases throughput and reduces barcode conflicts, but also significantly reduces the cost per cell of library preparation. This is due to two reasons: 1) with 2-level indexing, one needs to start with more Tn5 transposome complexes to analyze a similar number of cells, which significantly increases the cost; 2) with 2-level indexing, one is also limited to sorting a much smaller number of nuclei per well before IVT, RT, and column purification, which also significantly increases the cost. For processing ~10k and ~1M cells, we estimate that 3-level sci-L3-WGS is nearly 400-fold and 7,000-fold less expensive than LIANTI.

[0386]

[0387]

[0388]

[0389]

[0390]

[0391] Using sci-L3-WGS for single-cell RNA / DNA co-analysis

[0392] We recognize that the sci-L3-WGS protocol can be adapted to other aspects of molecular biology with minor modifications to the protocol. To demonstrate this, we performed a proof-of-concept experiment for sci-L3-RNA / DNA co-analysis. Briefly, as in sci-L3-WGS, the first round of DNA barcoding was performed by Tn5 insertion, but we simultaneously performed the first round of RNA barcoding, thereby labeling mRNA by reverse transcription with a barcode and a poly-T primer bearing a UMI ( Figure 6 A). Both the Tn5 insert and RT primers carry overhangs that mediate the ligation of the second round of barcodes as well as the T7 promoter, effectively enabling tertiary indexing and subsequent IVT-based linear amplification in much the same manner as sci-L3-WGS ( Figure 6 A-6B, Example 2, section “Methods and Molecular Design of sci-L3-RNA / DNA Co-analysis”). As a proof of concept, we mixed mouse cells with cells from two human cell lines and performed sci-L3-RNA / DNA co-analysis. For the vast majority of cells, reads of both RNA (5.2% conflict rate) and DNA (6.6% conflict rate) mapped to either the mouse or human genome ( Figure 6 C-6D). Furthermore, consistent with a successful co-analysis, 100% of the cells were assigned the same species label by their RNA and DNA profiles. As a further check, we visualized human cells in t-SNE space based on their RNA profiles. As expected, they fell into two clusters. Labeling individual cells based on the presence or absence of the Y chromosome consistently identified clusters as corresponding to BJ cells (male) or HEK293T cells (female) with 96.5% accuracy ( Figure 6 E).

[0393] Single-cell DNA analysis of mouse germ cells by sci-L3-WGS

[0394] In normal mitotic cell division, diploid chromosomes undergo replication to produce four copies of DNA, and sister chromatids separate into reciprocal daughter cells. Daughter cells receive one copy of each maternally and paternally inherited DNA sequence and almost always remain heterozygous in the centromere proximal sequence ( Figure 7 A). Rarely, chromosomes undergo mitotic crossover between chromosome homologs, which can sometimes result in diploid cells with loss of heterozygosity (LOH) at centromeric sequences distal to the crossover if the two recombined chromatids segregate into different daughter cells ( Figure 7 BC).

[0395] In meiosis, sister chromatids first co-segregate into the same daughter cells, and homologs separate into reciprocal daughter cells during meiosis I ("MI"), also known as "segregation," resulting in 2C cells (unreplicated diploid cells) with loss of heterozygosity (LOH) of centromere-proximal sequences ( Figure 7 DE). For successful chromosome segregation in MI ( Figure 7 D), the exchange is initiated by double-strand breaks (DSBs) catalyzed by Spo11 (Baudat et al., 2000; Keeney et al., 1997; Romanienko and Camerini-Otero, 2000), providing association and necessary tension between chromosome homologs (Hong et al., 2013). Rarely, chromosomes segregate in a meiotic manner without any interhomolog exchange, resulting in uniparental disomy (UPD). After MI, these 2C cells then undergo mitotic-like chromosome segregation, also known as “equisegregation,” in meiosis II (“MII”), allowing sister chromatids to separate to form 1C gametes ( Figure 7 E). In the following, since our studies mainly focus on MI, we refer to meiosis / segregation during MI (where sister chromatids segregate together) as “segregation”, and mitosis-like / equisegregation during MI (where sister chromatids segregate separately) as “equisegregation”.

[0396] To date, most work on the relationship between exchange locations and chromosome segregation has been performed using imaging (Wang et al., 2017a, 2017b), which has failed to fully characterize the underlying genomic sequences that are prone to meiotic exchange. Several assays enable detailed localization of meiotic DSB hotspots (Lange et al., 2016; Smagulova et al., 2011, 2016), but these analyses do not directly localize meiotic exchange. Assays that do well dissect exchange versus nonexchange are limited to a few hotspots (Cole et al., 2014). As a result, we know much less about the relationship between exchange and chromosome-scale features such as replication domains than we do about meiotic DSB hotspots (Baudat et al., 2013; Choi and Henderson, 2015; Yamada et al., 2017). Genome-wide meiotic crossover maps have been generated by mapping quadruplets in yeast (Mancera et al., 2008; Zhang et al., 2017), single human sperm, and intact human female meioses (Hou et al., 2013; Lu et al., 2012; Ottolini et al., 2015; Wang et al., 2012). With the exception of studies of human female meiosis, which analyzed a total of 87 complete meioses (Hou et al., 2013; Ottolini et al., 2015), most crossover maps are limited in at least three ways: 1) Analysis of mature 1C gametes in which cells complete two rounds of meiosis prevents direct observation of more informative intermediate 2C cells to assess whether and how often chromosomes undergo segregation vs. equal segregation during MI ( Figure 7 ); 2) abnormal cells are selected for their inability to enter the mature gamete state; 3) analysis by sequencing a single sperm or oocyte is limited in throughput to a few hundred cells at most, so rare events may be missed. Even for fertile crosses, the number of offspring that can be reasonably generated and genotyped is very limited (Liu et al., 2014).

[0397] To address all of these limitations at once, we applied sci-L3-WGS to the infertile progeny of an interspecific cross (female house mouse (Mus musculus domesticus) C57BL / 6 (‘B6’) x Mediterranean mouse (Mus spretus) SPRET / Ei (subsequently referred to as ‘Spret’)) as well as the fertile progeny of an intraspecific hybrid (female B6 x Mus musculus castaneous CAST / Ei (‘Cast’)). By sequencing sperm using a highly scalable technology, we were able to map an unprecedented number of crossover events in mammalian systems and in both infertile and fertile hybrids. Furthermore, by leveraging the throughput of sci-L3-WGS to recover signature profiles from rare 2C secondary sperm cells, we could also simultaneously assess crossovers and chromosome missegregation in the same single cells.

[0398] Unlike inbred males and (B6 x Cast) F1 males, which store millions of mature sperm in their epididymis, the epididymis of (B6 x Spret) F1 males (Berletch et al., 2015) contains very few morphologically mature sperm and a limited number of round germ cells of unknown ploidy ( Figure 8 AB). Interestingly, we observed a much higher fraction of 2C cells during FACS than expected for a "normal" epididymis (which is dominated by 1C spermatozoa) ( Figure 8 CD). The number of recovered cells and their estimated ploidy are listed in Table 3. In contrast and as expected, the epididymis of (B6 x Cast) F1 males contained almost exclusively 1C sperm ( Figure 8 E). Therefore, for this cross, we sorted 1C and 2C cells from dissected testes ( Figure 8 F).

[0399] Table 3. Number of cells recovered and cell ploidy, (B6 x Spret) epididymis. Note that we did not prepare sequencing libraries for all sorted cells; for example, the 2C pool in Exp1 only contained a subset of cells. We also gated extensively on 1C cells (DAPI signal was as high as 58 in some wells), and due to the abundant 2C cells in this hybrid, we only enriched to about 51-55% for 1C cells.

[0400]

[0401] For cells from F1 males from (B6 x Spret) and (B6 x Cast) crosses, we performed linear amplification, second-strand synthesis to add a third round of barcodes, library preparation, and sequencing (described in detail in Example 2, “Setup of sci-L3-WGS experiments in (B6 x Spret) hybrids and (B6 x Cast) hybrids” section). An important point is that although 1C and 2C cells can be distinguished by information, their relative abundance still affects our analysis. Specifically, in (B6 x Spret) hybrids, 1C cells are rare, such that any “doublets” (e.g., two 1C cells that stick together or accidentally receive the same barcode) have essentially no impact on the 2C population. In contrast, in (B6 x Cast) hybrids, despite enrichment, the majority of cells are still 1C (approximately 85%, Figure 8 G), so that there may be many 1C doublets that simulate 2C cells. In the following section, we discuss how to informatively distinguish 1C doublets from real 2C cells.

[0402] M2 cells show clustered reduction or equal chromosome segregation

[0403] Chromosome segregation in M2 cells from a sterile (B6 x Spret) cross

[0404] We first sought to analyze meiosis in cells from the epididymis of sterile (B6 x Spretus) F1 males obtained as described above. In two sci-L3-WGS experiments, we analyzed the genomes of 2,689 (92% of 2,919 sorted cells with >10k raw reads) and 4,239 (94% of 4,497 sorted cells with >30k raw reads) single cells. The number of uniquely mapped reads was Figure 5 F. At 1.6x and 1.4x sequencing depths for the two libraries ( Figure 5 ), we obtained a median of ~70k and ~144k unique Tn5 sites per cell, corresponding to a median genome coverage of 0.7% and 1.4%, respectively.

[0405] To identify crossover breakpoints, we implemented a hidden Markov model (HMM) that relies on high-quality reads that can be unambiguously assigned to B6 vs. Spret (see Example 2, "Bioinformatics and Statistical Analysis Methods" section). We characterized crossovers in 1,663 1C cells, with typical examples such as Fig. 9A. In addition, we searched for crossover events in ~5,200 2C cells. Although most of these 5,200 were likely simply somatic cells, to our surprise, we identified 292 2C cells with a high number of crossovers, which we termed “M2 cells” ( Fig. 9 B and 9C). Even more surprisingly, a large fraction of these cells showed equal segregation rather than mesenchymal segregation.

[0406] After an exchange occurs between two chromosomal homologs, if the chromosomes segregate in a subtractive manner, the region between the centromere and the site of the exchange will become homozygous, while heterozygosity will remain downstream of the exchange ( Figure 7 D) However, if the chromosomes segregate equally, then upon separation of the recombinant chromatids, LOH is observed to be exchange distal to the centromere ( Figure 7 B) We are Fig. 9 An example of an M2 cell whose chromosomes have undergone the expected meiotic segregation is shown in B (note the consistent homozygosity between the centromere and the crossover point), and in Fig. 9 An example of an M2 cell whose chromosomes unexpectedly underwent equal segregation is shown in C (note the consistent heterozygosity between the centromere and the crossover point). In total, among 292 M2 cells, we observed 4,162 instances of chromosomes undergoing reductive segregation, of which 3,740 had crossovers (90%), and 1,310 instances of chromosomes undergoing equal segregation, of which 636 had crossovers (49%). However, it is important to note that the number of crossover events among the equally segregating chromosomes is likely higher because we were unable to determine the outcome of a subset of crossovers ( Figure 7 C); at the same time, we can detect all crossovers of segregating chromosomes.

[0407] Although we observed many examples of cells in which some chromosomes exhibited meiotic segregation and others exhibited equisegregation, the segregation patterns of individual chromosomes within M2 cells do not appear to be independent. If chromosomes in each cell independently choose between meiotic segregation and equisegregation, we would expect a binomial distribution of meiotic segregation and equisegregation chromosomes, centered around the maximum likelihood estimate (MLE) of the probability of meiotic segregation, p (p = 0.76 from the data, 4162 / 5472), with approximately three quarters of chromosomes segregating and one quarter segregating equisegregate ( Fig. 9 D). However, among the 292 M2 cells we analyzed, we observed that at least 15 chromosomes segregated in a subtractive manner in 202 cells and at least 15 chromosomes segregated in an equal manner in 38 cells ( Fig. 9E; this is in contrast to the expected 148 and 0 cells, respectively, under the assumption of independence; p = 4e-23, Fisher's exact test). Individual M2 cells were biased overwhelmingly toward equal segregation, suggesting that a cell-autonomous global sensing mechanism determines the likelihood of whether a cell continues into meiosis or returns to mitosis.

[0408] We can further classify cells by whether or not the chromosomes in the M2 cells have crossed over ( Fig. 9 F). Chromosomes undergoing mesosynthesis ( Fig. 9 The pink color in F) appears to be more similar than the equally separated chromosomes ( Fig. 9 However, unlike in the segregating chromosomes where we can detect all crossovers as centromeric LOH, the equally segregating chromosomes have LOH only when the two recombinant chromatids segregate into each other's daughter cells ( Figure 7 B) If the opposite recombinant chromatids co-segregate, heterozygosity is maintained throughout the chromosome despite the absence of a detectable linkage switch ( Figure 7 C) Fig. 9 In F, the ratio of equally segregating chromosomes with (shown in green) to those without (shown in blue) observable LOH is approximately 1:1. This could mean that if those fully heterozygous chromosomes (shown in blue) do have linkage switches, then equally segregating chromosomes have a 50% chance of segregating the recombined chromatids together. Or alternatively, equally segregating chromosomes always segregate the recombined chromatids apart and the frequency of crossovers is reduced by half compared to the chromosomes that are segregating at reduced frequency.

[0409] Segmental or whole-chromosome LOH is known to be rare in mammalian mitotic cells. However, to exclude a mitotic origin of such events, we examined such events in the Patski cell line, a spontaneously immortalized cell line derived from female (B6 xSpret)F1 mice. We analyzed 1,107 single cells from Patski with sci-L3-WGS, where we found an average of 0.36 UPD chromosomes and 0.098 segmental LOH events per cell, a greatly reduced incidence compared to M2 cells. We also noted that these events are not necessarily independent. For example, a UPD that arises early in a cell line passage can be shared by a large fraction of descendant cells, making the incidence of independent LOH events even potentially lower. The distribution of these events (relatively uniform for Spretus-derived chromosomes, and relatively heterogeneous for B6-derived chromosomes) is plotted in Fig.10 F.

[0410] Overall, the contrast between the low incidence of mitotic LOH measured by the same technique (expected) and the relatively high incidence of 2C cells showing equal segregation (unexpected) confirms that the latter are highly unlikely to correspond to somatic cells. In the next section, by analyzing fertile (B6 x Cast) crosses, we further show that: 1) the genome-wide equal segregation event observed here is not an artifact of a duplication of two 1C cells, and 2) this segregation event also occurs in fertile intra-hybrids, albeit at a reduced incidence.

[0411] Chromosome segregation in M2 cells from fertile (B6 x Cast) crosses

[0412] We wondered whether equal segregation also occurred during MI in the fertile offspring of intraspecific (B6 x Cast) F1 males. As shown above, the epididymis from this cross consisted almost entirely of 1C mature sperm; therefore, we enriched 2C secondary spermatocytes from the whole testis. We then performed sci-L3-WGS on cells from both the epididymis and testis.

[0413] In the first sci-L3-WGS experiment of this hybrid, mainly for quality control to assess recovery and barcode conflict rates, we evenly distributed 1C round spermatocytes and sorted only 1C cells after two rounds of barcoding. Doublets determined by the fact that they were non-1C allowed us to quantify the barcode conflict rate. Of the 2400 sorted cells (200 / well), we recovered 2127 cells with >7,000 reads per cell (89%); of these, 2,008 were 1C with meiotic crossovers, indicating a barcode conflict rate of 5.5%. At a sequencing depth of 1.06x, we obtained a median of ~60k unique Tn5 insertions per cell, corresponding to a median genome coverage of ~0.6%.

[0414] In a second sci-L3-WGS experiment on this hybrid, we barcoded 1C round spermatids from testis (“barcode group 1”), 2C cells from testis (“barcode group 2”; contaminated by a large number of 1C spermatozoa, such as Figure 8 F) and 1C mature sperm from the epididymis (“Barcode Set 3”, Example 2, “Setup of sci-L3-WGS Experiments in (B6 x Spret) Hybridization and (B6 x Cast) Hybridization” section). As a further enrichment, in the FACS step of sci-L3-WGS, for a subset of wells, we specifically gated on 2C cells (15.5% of all cells, Figure 8 G). At a sequencing depth of 1.09x, we obtained a median of ~94k unique Tn5 insertions per cell, corresponding to a median genome coverage of ~0.9%.

[0415] In total, we recovered 3539 1C and 1477 non-1C cells from this second sci-L3-WGS experiment. Interestingly, >97% of the 1C cells were from barcode group 1 (n=1,853) and barcode group 2 (n=1,598), but not barcode group 3 (n=88), indicating that mature sperm from the epididymis were not well recovered by sci-L3-WGS. This suggests that the 1C cells recovered from the above (B6 x Spret) hybridization may also not be from mature sperm but round spermatids, which is consistent with the Figure 8 This is consistent with the low number of spermatozoa with mature morphology in B.

[0416] 1477 non-1C cells were obtained from barcode set 1 (n = 1,104; putative 1C round spermatid duplexes) and barcode set 2 (n = 373; a mixture of putative true M2 cells and 1C duplexes). To identify the characteristics of 1C duplexes, we examined the distribution of non-1C cells from barcode set 1 (which were specifically presorted for 1C content, making them less likely to contain true M2 cells). Centromere-proximal SNPs in 1C cells that have completed two rounds of meiosis should be of B6 or Cast origin. For 1C duplexes, these regions have an equal chance of appearing heterozygous or homozygous. Therefore, in any given 1C duplex, the number of chromosomes that appear equally segregated and the number of chromosomes that appear subtractively segregated should follow a binomial distribution with n = 19 and p = 0.5. Indeed, this is what we observed for 1C duplexes from barcode set 1 (p = 0.53, chi-square test for the distribution of the proportion of equally segregated chromosomes that deviate from binomial (19, 0.5), Fig.11 AB). In fact, only 11 1C doublets had at least 15 chromosomes that appeared to segregate in a consistent manner, either isomeric or meiotic.

[0417] In contrast, non-1C cells from barcode set 2 showed a very different distribution. Of the 373 such cells, 258 were doubly similar to 1C from barcode set 1 in that they had similar numbers of chromosomes with either an equal or reduced segregation pattern. The remaining 115 cells were biased, with at least 15 chromosomes segregating in a consistent manner, either equal or reduced ( Fig.11 CE; 115 / 373 for barcode group 2 vs 11 / 1,104 for barcode group 1; p=3e-70, chi-square test), many of which showed either a completely equal (n=6) or completely reduced (n=91) pattern.

[0418] Finite mixture models for fitting three non-1C cell populations

[0419] To consider this more formally, we fit the data from each experiment to a Bayesian finite mixture of three binomial distributions. Example 2, "Finite mixture models for fitting three non-1C cell populations" and Fig.12 Details are provided in , and the key conclusions are summarized here. First, it is estimated that non-1C cells from the testes of intraspecific (B6 x Cast) F1 males (i.e., from barcode group 2) include a subset of cells that are divided equally (28%) and possibly 1C doublets (69%) ( Fig.12 B). The proportion of M2 cells from interspecies (B6 x Spret) F1 males differs, estimated to include a subset of cells that segregate equally (14%) and possibly 1C doublets (20%) ( Fig.12 C). These analyses support the conclusion that the sterile (B6 x Spret) cross has a much higher proportion of cells tending towards equal rather than reductive segregation.

[0420] Distribution of meiotic crossovers at the chromosome level

[0421] We next sought to investigate the genomic correlates of crossover events. In total, we analyzed 1,663 1C cells with 19,601 crossover breakpoints and 240 M2 cells with 4,184 crossover breakpoints from (B6 x Spret) crosses, and 5,547 1C cells with 60,755 crossover breakpoints and 115 M2 cells with 2,246 crossover breakpoints from (B6 x Cast) crosses. To our knowledge, this is an unprecedented dataset on the number of crossover events associated with mammalian meiosis.

[0422] The high-throughput nature of sci-L3-WGS enabled us to analyze large numbers of immature germ cells and identify rare populations of cells with completed MI but not MII, and thus observe meiotic crossover and chromosome missegregation events in the same cells. When comparing the sterile interspecific (B6 x Spret) hybrids with the fertile intraspecific (B6 x Cast) hybrids at the chromosome level, we observed the following defects in MI: 1) the proportion of M2 cells with at least one exchange on all 19 autosomes decreased from about 2 / 3 in (B6 x Cast) to about 1 / 2 in (B6 x Spret); 2) the average number of exchanges per M2 cell was reduced in (B6 x Spret), but the average number of exchanges per 1C cell was higher; 3) exchange interference was weaker in (B6 x Spret), where the median distance between adjacent exchange arms decreased from 97 Mb to 82 Mb; 4) in (B6 x Spret) M2 cells, exchange arms tended to occur in the middle half of each chromosome arm, in contrast to the two hybrid 1C and (B6 x Cast) M2 cells, where they tended to occur in the most centromeric-distal quartile; 5) in M2 cells with biased equal or reduced chromosome segregation, (B6 x The proportion of genome-wide equal segregation was much higher in (B6 x Spret) (38 / 240) than in (B6 x Cast) (8 / 115). 6) In genome-wide reductive segregation of MI in M2 cells, the average number of fragmented equal segregation (also called reverse segregation (Ottolini et al., 2015)) increased from 0.2 to 1.1. These findings suggest mechanisms that may cause or reflect underlying factors leading to (B6 x Spret) F1 male sterility (including defects in crossover formation and positioning), compromise mechanisms for ensuring at least one crossover per chromosome, and increases in both fragmented and genome-wide equal segregation. Details of these analyses are provided in Fig.10 , Fig.13 and Fig.14 and Example 2, section "Distribution of meiotic crossovers at the chromosome level".

[0423] Distribution of meiotic crossover events in relation to genomic context

[0424] Genomic features regulating exchange heat

[0425] To assess the distribution of crossovers at a finer scale, we collapsed all crossover events to generate “heat maps” along each mouse chromosome. We first compared these maps with single-stranded DNA sequencing (SSDS) maps (Brick et al., 2018; Smagulova et al., 2011, 2016) and Spo11 oligonucleotide composite maps (Lange et al., 2016), which identify meiotic DSB hotspots at the highest resolution ( Fig.15 A). The DSB patterns of these two mapping methods in the B6 strain were strongly correlated with each other along the 100 kb window (rho = 0.87, p < 2e-308). Although our 1C and M2 cell exchange stacks were correlated with each other (rho = 0.67 for the (B6 x Spret) hybrid, and rho = 0.55 for the (B6 x Cast) hybrid, both p < 2e-308, Fig.15 BC), both deviate from the DSB profile. Relatedly, the PRDM9 gene, a major player in hotspot specification, has evolved to bind different motifs between diverse mouse strains and even between mouse subspecies (Davies et al., 2016; Gregorova et al., 2018). We discuss its potential impact on the differences between the two crosses in Example 2, section “Effect of PRDM9 on exchange heats”.

[0426] Only 10% of meiotic-specific DSBs are repaired as exchange-overs. Next, we investigated which factors other than Spo11 contribute to exchange-over formation by building linear models using Bayesian model averaging (BMA) (Clyde et al., 2011). As applied here, BMA performs a weighted average of the over 15,000 variable selection models explored and weights them by the posterior probability of each model, which accounts for uncertainty in model selection, unlike some other variable selection techniques such as Lasso regression. We quantified the marginal inclusion probabilities (MIPs) of approximately 80 potential explanatory variables. Almost all models with high probabilities included features known to be associated with meiotic exchange-overs, such as Spo11 break sites, GC content, etc. ( Fig.16 A, Fig.17 ); for example, regions with high GC content are hotter for crossover formation. We also discovered several more features that have not been previously implicated in meiotic crossovers, such as specific repeat sequence families and chromatin marks, and in particular early replicating domains. The correlation matrix between crossover heat and all features is plotted for each crossover in Figure 18-19 Medium. Includes summary of features used as well as simple linear models and BMA. Breakpoint resolution (median ~150 kb for (B6 x Spret) and ~250 kb for (B6 xCast); Fig.16 B) Comparable to previous work mapping meiotic crossovers by single-cell sequencing (150-500 kb) (Lu et al., 2012; Ottolini et al., 2015; Wang et al., 2012). However, the higher library complexity provided by sci-L3-WGS allowed us to achieve this at a much lower sequencing depth.

[0427] Many features associated with crossover formation were consistent between the (B6 x Spret) and (B6 x Cast) crosses, but some were not. For example, the positional bias of crossover formation appeared to be different. In both crosses of 1C cells and in the (B6 x Cast) cross of M2 cells, crossovers were well represented within 10 Mb of the centromere, but tended to occur near the rightmost “quartile” telomere ( Fig.18 ). However, in M2 cells of the (B6 x Spret) hybrid, centromere and telomeric exchanges were underrepresented and tended to occur in the middle quartile ( Fig.19 ). This trend holds in the linear model, where we consider the contribution of all other features.

[0428] The position of an exchange can greatly influence the amount of tension exerted between chromosome homologs, which in turn promotes proper chromosome segregation. We therefore investigated this in more detail by taking only the rightmost exchange per chromosome in each cell and examining its position along the chromosome arm in each cross (de Boer et al., 2015). Taking into account inter-chromosomal variability with a linear mixed effects model, we estimated that the position of the rightmost exchange in the (B6 x Spret) cross was on average 1.6 Mb more centromere proximal in 1C cells than in the (B6 x Cast) cross. Fig. 20 A, p = 1e-13, F test), but more centromere-proximal 5.5 Mb ( Fig.16 C, p = 2.2e-15). Note that in both crosses, the rightmost exchange in M2 cells is more centromere-proximal than those in 1C cells, but in the (B6 x Spret) cross ( Fig.16 D) to a greater extent than in the (B6 x Cast) cross ( Fig. 20 B). These differences suggest that a subset of M2 cells in the (B6 x Spret) hybrid, whose exchange occurs too close to the centromere, may fail to mature into 1C cells, possibly due to defects in MII segregation. Similarly, although the number of events is limited, we also compared the position of exchange in M2 cells with biased chromosome segregation and found that in both hybrids, exchange in cells with biased equal bias was more centromere distal than those in cells with biased mitotic segregation, with a difference of 13.7 Mb in the (B6 x Cast) hybrid (p=4e-15) and 8.7 Mb in the (B6 x Spret) hybrid (p=6e-14). Fig. 20 CD). This suggests a possible MI segregation defect in cells where the exchange is too close to the telomeres. We propose a hypothetical model to explain Fig. 20 This observation in E.

[0429] Cellular heterogeneity with respect to exchange breakpoints

[0430] Although 1C and M2 cells appear roughly similar in exchange stacking ( Fig.15 ), but we wanted to know if there is any structure in the features that influence the distribution of exchange in subsets of single cells. To investigate this, we summarized the information related to exchange in each single cell for each of the 78 features (Example 2, "Methods for bioinformatics and statistical analysis" section). We then used principal component analysis (PCA) on a matrix with one cell per row and one eigenvalue per column as a summary. For the (B6 x Spret) hybridization, the first two principal components (PCs) captured 26% of the variance, while for the (B6 xCast) hybridization, PC1 and PC3 captured 17% of the variance. In both hybridizations, 1C and M2 cells were divided into two clusters by these PCs. Fig.21 and Fig. 22 In Figure 2, we plotted each feature projected onto these PCs. The chromosomal distribution of the exchange, the single parent chromosome, and the position of the exchange in the chromosome quartile are features that appear to drive the separation of 1C and M2 cells.

[0431] Predicting exchange trajectories based on genomic features

[0432] Finally, we attempted to use the large number of events observed here to build a predictive model for exchange positions. Specifically, we built a linear model of binary reactions where 1 is the exchange trajectory and 0 is a random trajectory sampled from the genome from the same trajectory distribution (Example 2, "Methods for Bioinformatics and Statistical Analysis" section). Using the same 76 features as in the BMA analysis, we can predict exchange trajectories on the retained data with an average receiver operating curve (ROC) area under the curve (AUC) of 0.73 for the (B6 x Spret) hybrid. Using a subset of 25 high inclusion probability (MIP>0.5) variables identified by BMA, we obtained a similar average AUC of 0.72 ( Fig.16 E). Similarly, for the (B6 xCast) hybrid, we obtained an average AUC of 0.85 when using all features or a subset of 25 features with MIP>0.5 ( Fig.16 F).

[0433] discuss

[0434] Here, we describe sci-L3, a framework that combines 3-level single-cell combinatorial indexing and linear amplification. We demonstrate that sci-L3 is applicable to single-cell whole-genome sequencing (sci-L3-WGS), single-cell targeted DNA sequencing (sci-L3-target-seq), and single-cell co-analysis of genomes and transcriptomes (sci-L3-RNA / DNA). Using sci-L3-WGS, at least tens of thousands (and potentially millions) of single-cell genomes can be processed in two days of experiments, with library construction costs of $0.14 per cell for 10k cells and $0.008 per cell for 1 million cells. The throughput of sci-L3-WGS is several orders of magnitude higher than alternative single-cell WGS methods based on linear amplification, such as the “in-tube” LIANTI (Chen et al., 2017). Furthermore, it has increased the number of unique molecules recovered from each single cell from thousands (Pellegrino et al., 2018) or tens of thousands (Vitak et al., 2017) to hundreds of thousands.

[0435] We applied sci-L3-WGS to study male mouse meiosis and identified an unexpected population of M2 cells. The single-cell nature of the data also allowed us to simultaneously characterize meiotic crossovers and chromosome missegregation. Reverse segregation events were previously observed in a complete analysis of human female meiosis (Ottolini et al., 2015), and we observed similar events (i.e., equal segregation of one or a few chromosomes) in the context of mouse male meiosis. In the 292 M2 cells we analyzed from the (B6 x Spret) cross, individual cells favored either equal or reduced chromosome segregation, suggesting an overall sensing mechanism for deciding whether a cell continues meiosis or returns to mitotic segregation of its chromosomes. Similarly, to our knowledge, for the first time in mammalian meiosis, we observed multiple instances of genome-wide equal segregation during MI, suggesting a cell-autonomous mode of equal segregation rather than a chromosome-autonomous mode. We identified such events in both crosses, although they were much rarer in the fertile (B6 x Cast) cross.

[0436] When compared with the chromosome autonomous mechanism (incidence 2 -19 ), particularly in interspecific (B6 x Spret) crosses, raises more questions than it answers. Fig.23 The model is outlined in , and several unresolved issues are highlighted. In normal MI, centromere cohesion is maintained during mesochromatin, and sister chromatids that exchange centromere proximal ends do not split until MII ( Fig.23Equal separation in MI indicates premature centromeric cohesin separation ( Fig.23 Previous work has also suggested that homolog pairing in these F1 crosses may be defective due to erosion of PRDM9 binding sites (Davies et al., 2016; Gregorova et al., 2018; Smagulova et al., 2016), and that pairing problems may be more severe in interspecific crosses. In Example 2, section “Speculations on the causes and consequences of reverse segregation”, we speculate: 1) what might cause premature centromeric cohesin separation, 2) whether one exchange is sufficient for proper melatonin segregation, and 3) what the consequences of equal segregation in MI might be.

[0437] Improved genomic coverage compared to other single-cell sequencing methods enables high-resolution mapping of exchange breakpoints, while the throughput of mapping ~87,000 exchanges allows us to better characterize genomic and epigenomic features associated with exchange heats using stacked data. We discuss how the continuum of exchange heats is formed by multiple factors in Example 2, "Exchange heats and associated (epi)genomic factors".

[0438] A key difference in the development of sci-L3 from simply combining a high-throughput single-cell combinatorial indexing (“sci”) protocol with linear amplification by transposon insertion (LIANTI) is that we introduced a T7 promoter via ligation, which not only enables more than two rounds of cell barcoding and further increases throughput at greatly reduced cost, but also provides the flexibility to generalize the approach to other single-cell analyses with minor protocol adjustments. As a first example, we demonstrate that sci-L3-WGS can be easily adapted to sci-L3-target-seq. Although single-cell targeted sequencing using the 10X Genomics platform has been reported, to our knowledge it was of RNA transcripts, not DNA loci. Although the current “recovery rate” of 10% per haplotype may not be ideal for targeted sequencing, this is mitigated by the large number of cells that can be analyzed. As a second example, we demonstrate that sci-L3-WGS can also be adapted for sci-L3-RNA / DNA co-analysis. We anticipate that it will be further possible to adapt sci-L3 to ATAC-seq, bisulfite-seq, and Hi-C for single-cell analysis of chromatin accessibility, methylome, and chromatin conformation, respectively, which may offer advantages over published scientific methods (Cusanovich et al., 2015; Mulqueen et al., 2018; Ramani et al., 2017) in achieving these goals in terms of throughput and amplification uniformity.

[0439] In summary, sci-L3-WGS, sci-L3-target-seq, and sci-L3-RNA / DNA co-analysis expand the toolset for single-cell sequencing. In this study, we further show how sci-L3-WGS can provide a systematic and quantitative view of meiotic recombination and reveal rare genome-wide chromosome missegregation events with unprecedented throughput combinations. We anticipate that sci-L3 methods will be very useful in other situations where single-cell genome sequencing provides transformational benefits, such as for studying rare homeologous mitotic crossovers, and for dissecting genetic heterogeneity and evolution in cancer.

[0440] References

[0441] Baudat, F., Manova, K., Yuen, JP, Jasin, M. and Keeney, S. (2000). Chromosomesynapsis defects and sexually dimorphic meiotic progression in mice lacking Spo11. Mol. Cell 6, 989-998.

[0442] Baudat, F., Imai, Y. and de Massy, ​​B. (2013). Meiotic recombination inmammals: localization and regulation. Nat. Rev. Genet. 14, 794-806.

[0443] Berletch, JB, Ma, W., Yang, F., Shendure, J., Noble, WS, Disteche, CM, and Deng, X. (2015). Escape from X inactivation varies in mouse tissues. PLoSGenet.11, e1005079.

[0444] de Boer, E., Jasin, M. and Keeney, S. (2015). Local and sex-specific biases incrossover vs. noncrossover outcomes at meiotic recombination hot spots inmice. Genes Dev. 29, 1721-1733.

[0445] Brick, K., Pratto, F., Sun, C.-Y., Camerini-Otero, R. D., and Petukhova, G. (2018). Analysis of Meiotic Double-Strand Break Initiation in Mammals. Methods Enzymol. 601, 391-418.

[0446] Cao, J., Packer, J. S., Ramani, V., Cusanovich, D. A., Huynh, C., Daza, R., Qiu, X., Lee, C., Furlan, S. N., Steemers, F. J., et al. (2017). Comprehensive single-cell transcriptional profiling of a multicellular organism. Science 357, 661-667.

[0447] Cao, J., Spielmann, M., Qiu, X., Huang, X., Ibrahim, D. M., Hill, A. J., Zhang, F., Mundlos, S., Christiansen, L., Steemers, F. J., et al. (2019). The single-cell transcriptional landscape of mammalian organogenesis. Nature.

[0448] Chen, C., Xing, D., Tan, L., Li, H., Zhou, G., Huang, L., and Xie, X. S. (2017). Single-cell whole-genome analyses by Linear Amplification via Transposon Insertion (LIANTI). Science 356, 189-194.

[0449] Choi, K., and Henderson, I. R. (2015). Meiotic recombination hotspots - a comparative view. Plant J. 83, 52-61.

[0450] Clyde, M.A., Ghosh, J., and Littman, M.L. (2011). Bayesian Adaptive Sampling for Variable Selection and Model Averaging. J. Comput. Graph. Stat. 20, 80 - 101.

[0451] Cole, F., Baudat, F., Grey, C., Keeney, S., de Massy, B., and Jasin, M. (2014). Mouse tetrad analysis provides insights into recombination mechanisms and hotspot evolutionary dynamics. Nat. Genet. 46, 1072 - 1080.

[0452] Cusanovich, D.A., Daza, R., Adey, A., Pliner, H.A., Christiansen, L., Gunderson, K.L., Steemers, F.J., Trapnell, C., and Shendure, J. (2015). Multiplex single - cell profiling of chromatin accessibility by combinatorial cellular indexing. Science 348, 910 - 914.

[0453] Davies, B., Hatton, E., Altemose, N., Hussin, J.G., Pratto, F., Zhang, G., Hinch, A.G., Moralli, D., Biggs, D., Diaz, R., et al. (2016). Re - engineering the zinc fingers of PRDM9 reverses hybrid sterility in mice. Nature 530, 171 - 176.

[0454] Eberwine, J., Yeh, H., Miyashiro, K., Cao, Y., Nair, S., Finnell, R., Zettel, M., and Coleman, P. (1992). Analysis of gene expression in single live neurons. Proceedings of the National Academy of Sciences 89, 3010 - 3014.

[0455] Gregorova, S., Gergelits, V., Chvatalova, I., Bhattacharyya, T., Valiskova, B., Fotopulosova, V., Jansa, P., Wiatrowska, D., and Forejt, J. (2018). Modulation of controlled meiotic chromosome asynapsis overrides hybrid sterility in mice. Elife 7.

[0456] Hashimshony, T., Wagner, F., Sher, N., and Yanai, I. (2012). CEL - Seq: single - cell RNA - Seq by multiplexed linear amplification. Cell Rep. 2, 666 - 673.

[0457] Hong, S., Sung, Y., Yu, M., Lee, M., Kleckner, N., and Kim, K. P. (2013). The logic and mechanism of homologous recombination partner choice. Mol. Cell 51, 440 - 453.

[0458] Hou, Y., Fan, W., Yan, L., Li, R., Lian, Y., Huang, J., Li, J., Xu, L., Tang, F., Xie, X. S., et al. (2013). Genome analyses of single human oocytes. Cell 155, 1492 - 1506.

[0459] Keeney, S., Giroux, C. N., and Kleckner, N. (1997). Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88, 375-384.

[0460] Lange, J., Yamada, S., Tischfield, S. E., Pan, J., Kim, S., Zhu, X., Socci, N. D., Jasin, M., and Keeney, S. (2016). The Landscape of Mouse Meiotic Double-Strand Break Formation, Processing, and Repair. Cell 167, 695-708.e16.

[0461] Liu, E. Y., Morgan, A. P., Chesler, E. J., Wang, W., Churchill, G. A., and Pardo-Manuel de Villena, F. (2014). High-resolution sex-specific linkage maps of the mouse reveal polarized distribution of crossovers in male germline. Genetics 197, 91-106.

[0462] Lu, S., Zong, C., Fan, W., Yang, M., Li, J., Chapman, A. R., Zhu, P., Hu, X., Xu, L., Yan, L., et al. (2012). Probing meiotic recombination and aneuploidy of single sperm cells by whole-genome sequencing. Science 338, 1627-1630.

[0463] Mancera, E., Bourgon, R., Brozzi, A., Huber, W., and Steinmetz, L. M. (2008). High-resolution mapping of meiotic crossovers and non-crossovers in yeast. Nature 454, 479 - 485.

[0464] Mulqueen, R. M., Pokholok, D., Norberg, S. J., Torkenczy, K. A., Fields, A. J., Sun, D., Sinnamon, J. R., Shendure, J., Trapnell, C., O’Roak, B. J., et al. (2018). Highly scalable generation of DNA methylation profiles in single cells. Nat. Biotechnol. 36, 428 - 431.

[0465] Ottolini, C. S., Newnham, L., Capalbo, A., Natesan, S. A., Joshi, H. A., Cimadomo, D., Griffin, D. K., Sage, K., Summers, M. C., Thornhill, A. R., et al. (2015). Genome-wide maps of recombination and chromosome segregation in human oocytes and embryos show selection for maternal recombination rates. Nat. Genet. 47, 727 - 735.

[0466] Pellegrino, M., Sciambi, A., Treusch, S., Durruthy-Durruthy, R., Gokhale, K., Jacob, J., Chen, T. X., Geis, J. A., Oldham, W., Matthews, J., et al. (2018). High-throughput single-cell DNA sequencing of acute myeloid leukemia tumors with droplet microfluidics. Genome Res.

[0467] Ramani, V., Deng, X., Qiu, R., Gunderson, K. L., Steemers, F. J., Disteche, C. M., Noble, W. S., Duan, Z., et al. Shendure, J. (2017). Massively multiplex single-cell Hi-C. Nat. Methods 14, 263 - 266.

[0468] Romanienko, P. J., et al. Camerini-Otero, R. D. (2000). The mouse Spo11 gene is required for meiotic chromosome synapsis. Mol. Cell 6, 975 - 987.

[0469] Smagulova, F., Gregoretti, I. V., Brick, K., Khil, P., Camerini-Otero, R. D., and Petukhova, G. V. (2011). Genome-wide analysis reveals novel molecular features of mouse recombination hotspots. Nature 472, 375 - 378.

[0470] Smagulova, F., Brick, K., Pu, Y., Camerini-Otero, R. D., and Petukhova, G. V. (2016). The evolutionary turnover of recombination hot spots contributes to speciation in mice. Genes Dev. 30, 266 - 280.

[0471] Sos, B. C., Fung, H.-L., Gao, D. R., Osothprarop, T. F., Kia, A., He, M. M., and Zhang, K. (2016). Characterization of chromatin accessibility with a transposome hypersensitive sites sequencing (THS-seq) assay. Genome Biol. 17, 20.

[0472] Vitak, S.A., Torkenczy, K.A., Rosenkrantz, J.L., Fields, A.J., Christiansen, L., Wong, M.H., Carbone, L., Steemers, F.J., and Adey, A. (2017). Sequencing thousands of single-cell genomes with combinatorial indexing. Nat. Methods 14, 302 - 308.

[0473] Wang, J., Fan, H.C., Behr, B., and Quake, S.R. (2012). Genome-wide single-cell analysis of recombination activity and de novo mutation rates in human sperm. Cell 150, 402 - 412.

[0474] Wang, S., Kleckner, N., and Zhang, L. (2017a). Crossover maturation inefficiency and aneuploidy in human female meiosis. Cell Cycle 16, 1017 - 1019.

[0475] Wang, S., Hassold, T., Hunt, P., White, M.A., Zickler, D., Kleckner, N., and Zhang, L. (2017b). Inefficient Crossover Maturation Underlies Elevated Aneuploidy in Human Female Meiosis. Cell 168, 977 - 989.e17.

[0476] Yamada, S., Kim, S., Tischfield, S.E., Jasin, M., Lange, J., and Keeney, S. (2017). Genomic and chromatin features shaping meiotic double-strand break formation and repair in mice. Cell Cycle 16, 1870 - 1884.

[0477] Zhang,K.,Wu,X.-C.,Zheng,D.-Q. and Petes,TD(2017).Effects ofTemperature on the Meiotic Recombination Landscape of the Yeast.MBio 8.

[0478] Example 2

[0479] Finite mixture models for fitting three non-1C cell populations

[0480] The non-1C cells recovered from the (B6 x Cast) hybrids of barcode set 2 included 1C doublets, cells that showed a bias toward equal segregation, and cells that showed a bias toward subtractive segregation. To quantify their relative proportions, we fit the data to a mixture of three binomial distributions with probabilities of equal chromosome segregation of 0.01, 0.48, and 0.95, and mixing ratios of 0.28, 0.69, and 0.02 ( Fig.12 A). In contrast, when we tried to fit non-1C cells from barcode group 1 similarly to a mixture of three binomial distributions, we obtained probabilities of equal chromosome segregation of 0.46, 0.5, and 0.53 (all close to 0.5), respectively, with mixing ratios of 0.24, 0.44, and 0.31 ( Fig.12 B).

[0481] To ask whether the proportion of M2 cells that favor equal segregation vs. subtractive segregation differs between fertile and sterile crosses, we can similarly fit the chromosome data from the (B6 x Spret) cross ( Fig. 9 E), which yielded probabilities of equal chromosome segregation of 0.05, 0.39, and 0.91, and admixture ratios of 0.66, 0.2, and 0.14 ( Fig.12 C) These ratios show that the sterile (B6 x Spret) cross has a higher proportion of cells that tend to segregate equally rather than segregate by reduction.

[0482] Distribution of meiotic crossovers at the chromosome level

[0483] We first considered the distribution of meiotic crossovers across chromosomes based on 1,663 1C cells with 19,601 crossover breakpoints and 240 M2 cells with 4,184 crossover breakpoints from the (B6 x Spret) cross and 5,547 1C cells with 60,755 crossover breakpoints and 115 M2 cells with 2,246 crossover breakpoints from the goth (B6 x Cast) cross. The crossover density is defined here as the average number of crossovers per cell per Mb per division multiplied by 2 (in 1C cells) or 1 (in M2 cells). In the (B6 x Spret) cross, we observed a strong negative correlation between chromosome size and crossover density in 1C cells ( Fig.13 A, r = -0.66, p = 0.002). In agreement with previous findings (Lange et al., 2016), this correlation was only partially explained by Spo11 oligoplex density (r = -0.46, p < 0.05), suggesting that smaller chromosomes sustain more DSBs and that those DSBs are more likely to generate crossovers. In M2 cells, this negative correlation was even stronger ( Fig.13 B, r = -0.83, p = 1e-5). Fig.10 In AB, we treated multiple crossovers per chromosome per cell as single events, which even further strengthened the negative correlation (r = -0.87, p = 2e-6 for 1C cells; r = -0.91, p = 8e-8 for M2 cells). These observations suggest that smaller chromosomes are more reactive to crossovers, especially for at least one crossover per cell division. The same trend was observed in the (B6 x Cast) hybrid plots ( Fig.14 AD). In interspecific and intraspecific hybrids, 1C cells had an average of 0.62 and 0.58 crossovers per cell per chromosome, respectively, while M2 cells had an average of 0.92 and 1.03 crossovers per cell per chromosome ( Fig.13CD, 10C-D). The exchange rate of interspecies M2 cells was only 9% lower than the exchange reads measured by the Mlh1 locus in 4C spermatocytes of B6 inbred mice (Froenicke et al., 2002), despite a 2% sequence divergence. The exchange rate in 1C cells was 45% lower than that observed in single human sperm sequencing (Lu et al., 2012; Wang et al., 2012). The latter difference may be mainly due to the telocentromeric nature of mouse chromosomes. Although interspecies (B6xSpret) hybridization detected a higher average exchange number in 1C than (B6 x Cast) hybridization (p=7e-26, Mann-Whitney test), the average exchange number in M2 cells was lower (p=2e-10). We noted that the proportion of all 91 autosomal segregating M2 cells with crossovers on each chromosome was higher in the (B6 x Cast) hybrid (60 / 91 or 66%) than in the (B6 x Spret) hybrid (41 / 80% or 51%) (p = 0.06, Fisher's exact test), which may contribute to the infertility of the latter.

[0484] To examine crossover interference, we took chromosomes with at least two crossovers and plotted the distances between adjacent crossovers and compared this distribution with the expected value based on random simulations ( Fig.13 E, Fig.10 E, Fig.14 E). The median observed distances between crossovers were 82 Mb for (B6 x Spret) and 97 Mb for (B6 x Cast); both greatly exceeded the expected 39 Mb and 42 Mb (p=1e-267 and p<2e-308, respectively, Mann-Whitney test). This is consistent with the repulsion of crossovers in close proximity. Note that crossover interference is stronger in the (B6 x Cast) hybrid than in the (B6 x Spret) hybrid, with longer distances between adjacent crossovers (p=5e-91).

[0485] We also analyzed the expression of each single cell in the (B6 x Spret) hybrid ( Fig.13 F) and each chromosome ( Fig.13 The distribution of uniparental chromosomes (i.e., no observed crossover) in G ((B6 x Cast) hybrids maintains the same trend, as Fig.14 Although shorter chromosomes show elevated exchange rates after normalization for length, the incidence of uniparental chromosomes (which collapses across all cell types) remains inversely correlated with chromosome size ( Fig.13 G; r=-0.91, p=4.6e-8).

[0486] Although we have shown that M2 cells strongly favor either equal or meiotic segregation of their chromosomes, we also observed hundreds of scattered equal segregation events among cells with at least 15 chromosomes that segregated meiotically. This phenomenon has been observed previously and has been termed “reverse segregation” (Ottolini et al., 2015). Fig.13 In H, we show the chromosomal distribution of these back-segregation events. Note that although the back-segregation rate is significantly higher in the (B6 x Spret) cross (mean = 1.1) than in the (B6 x Cast) cross (mean = 0.2, p = 2e-14, Mann-Whitney test), chromosomes 7 and 11 have the highest back-segregation rates in both crosses.

[0487] We then examined the normalized proportion of reads per cell that mapped to the mitochondrial genome ( Fig.13 I, Fig.10 G). 1C cells exhibit a bimodal distribution in mitochondrial DNA "copy number" for which we lack a satisfactory explanation. We observed a modest negative correlation between mitochondrial read fraction ratio and crossover number (rho = -0.11, p = 3e-6). Interestingly, M2 cells, which have at least 15 equally or mitotically segregated chromosomes, have a very different distribution of mitochondrial read fractions, albeit in limited numbers ( Fig.10 G). Consistent with this, the proportion of mitochondrial reads was positively correlated with the number of chromosomes segregating in M2 cells (r=0.18, p=0.005). Note that we could not assess this in the (B6 x Cast) hybridization because more than 90% of the sequenced single cells did not map any read fragments to the mitochondrial genome. The different methods used to isolate nuclei from testis (B6 xCast) vs epididymis (B6 xSpret), coupled with the pre-sorting of nuclei from testis, may have fractionated mitochondria from whole nuclei.

[0488] Effect of PRDM9 on exchange heat

[0489] Based on the heat map of exchange breakpoints by stacking along chromosomes throughout the genome ( Fig.15), we found that in the intraspecific (B6 x Cast) cross, exchange heats correlated better with mapped DSB hotspots in Cast males than in B6 males (rho = 0.28 and 0.12, p < 2e-308 and p = 1e-83, respectively), likely due to the Cast PRDM9 allele being semidominant in the F1 hybrids. This correlation was stronger for mapped DSB hotspots in (B6 x Cast) F1 animals (rho = 0.3, p < 2e-308). For the (B6 x Spret) cross, erosion of PRDM9 consensus binding sites resulted in four types of DSB hotspots defined by Spo11 oligonucleotide-complex mapping: those hotspots conserved between B6 and Spret (termed "symmetric" hotspots), those hotspots present only in B6 or Spret (termed "asymmetric" hotspots), and those hotspots that do not contain PRDM9 binding sites in either species. All four types of DSB hotspots had low correlation with crossover in the (B6 x Spret) cross (rho = 0.13, p = 4e-87 for all Spo11 hotspots mapped in B6; rho = 0.11, p = 3e-63 if only "symmetric hotspots" were used). One possibility is that the DSB sites in the (B6 x Spret) cross are dominated by the SpretPRDM9 alleles, making the DSB hotspots mapped in the B6 strain background unable to predict the crossover sites.

[0490] Speculations on the causes and consequences of reverse separation

[0491] We have observed a high incidence of reverse segregation, particularly in interspecific (B6 xSpret) crosses. Below we speculate: 1) what might cause premature centromeric cohesion segregation; 2) whether one crossover is sufficient for proper mesosynthesis; and 3) what consequences equal segregation might have in MI.

[0492] First, it is possible that due to insufficient homolog pairing between B6 and Spret chromosomes, DSBs that should have been repaired from homologs during meiosis are instead often repaired using sister chromatids as templates. This could lead to disruption of cohesion (Storlazzi et al., 2008) and premature centromeric cohesin dissociation.

[0493] Second, current models suggest that despite initial insufficient homolog pairing in interspecific hybridization, one homolog exchange and adequate sister chromatid cohesion are sufficient to form chiasmata ( Fig.23). Once an exchange is successfully formed, chromosome segregation should not be impaired. In our study, at the level of individual chromosomes, the large number of equally segregated chromosomes observed did have normal exchange, as evidenced by centromeric-distal LOH, which may indicate that defects in initial homolog pairing affect the final outcome. However, at the genomic level, we cannot reliably assess whether those cells with biased equally segregated have similar numbers of exchange as their metrozoologically biased counterparts, because we can detect all exchange in chromosomes that segregate during metrozoology, but we can only detect exchange in equally segregated chromosomes when the two recombined chromatids separate ( Figure 5 BC and Fig.16 D, Patterns 2 and 3). Assuming that recombinant chromatids are equally likely to segregate together or apart, the number of crossovers is not small in those cases of equal segregation at the genome level, although we cannot rule out the possibility that segregation deviates from 50 / 50 due to unresolved recombination intermediates ( Fig.23 , mode 3).

[0494] Third, what is the consequence of these equally segregated chromosomes? Do they return to mitosis, carrying extensive LOH, or do they enter MII, thereby (if so) leading to the formation of 1C gametes? A phenomenon called “reversion to growth” has been characterized in yeast, in which cells that have initiated a meiotic program can revert to normal mitosis in the presence of appropriate nutrients, resulting in extensive LOH events (Dayani et al., 2011). In human female meiosis, chromosomes with reversed segregation enter MII, resulting in a euploid oocyte and a euploid polar body 2, consistent with normal MII segregation; the authors propose that unresolved recombination intermediates may cause reversed segregation in MI by joining otherwise unrelated homologous chromatids and promote correct MII segregation ( Fig.23 , Figure 3 )(Ottolini et al., 2015). Mlh1 is important in mismatch repair (MMR) and resolution of Holliday junction intermediates in meiosis. Given the 2% sequence divergence between B6 and Spret, it is possible that Mlh1 is limiting due to dense MMR and that insufficient Mlh1 may be available to resolve recombination intermediates. However, we emphasize that this would not result in LOH if recombining homologous chromatids co-segregate. Figure 5 C) Therefore, M2 cells with LOH and equal segregation cannot be explained by co-segregation of unresolved intermediates.

[0495] Finally, in Fig.23In the , we also show a possible contribution from gamete formation from chromosomes without any interhomolog exchanges (perhaps due to insufficient homolog pairing) as one of the patterns (pattern 4) is indistinguishable from recombinant chromatids with exchanges but co-segregating (pattern 3). However, if these cells without exchanges significantly constituted 1C cells, we should have observed a higher number of non-exchange chromosomes in 1C cells. The number of chromosomes with and without exchanges in the 1C cells we observed in both crosses was approximately 50-50, suggesting that they are primarily derived from Fig.23 Some combinations of modes 1-3, while 2C cells without interhomolog exchange (modes 4 and 5) do not contribute substantially to the successful completion of MII by 1C cells.

[0496] Exchange heat and related (epi)genomic factors

[0497] Crossover heat is a continuum formed by many factors. Crossovers in the (B6 x Cast) cross correlated more strongly with meiotic DSB hotspots mapped in the F1 cross than in separate mappings of the two parental lines, which was expected based on previous findings that new meiotic hotspots can form in F1 hybrids (Smagulova et al., 2016). In the (B6 x Spret) cross, crossovers were weakly but positively correlated with Spo11 breakage. Note that the Spo11 map only accounts for PRDM9 sites bound by the PRDM9 protein of the B6 allele, and the Spret copy of PRDM9 may bind to different sites and establish new meiotic DSB hotspots, which was not accounted for in our analysis. Genomic features that we observed to be positively correlated with meiotic crossovers included GC-rich regions (as also true for yeast meiosis (Petes, 2001; Petes and Merker, 2002)), CNV growth between strains (Lilue et al., 2018), gene bodies, pseudogene transcripts, CTCF binding sites, replication domains (Marchal et al., 2018), DNA transposons, satellite DNA, and a subset of histone modifications including H3K4me1, H3K27me3, and H3K36me3 (Mu et al., 2017). Interestingly, binding sites for Dmrt6, which is involved in regulating the transition from mitosis to meiosis in male germ cells (Zhang et al., 2014), were strongly correlated with meiotic crossover heat. Genomic features that were significantly negatively correlated with meiotic crossovers included 3'UTRs, LINEs, and low-complexity DNA. Unlike yeast, where rDNA is very cold for meiotic crossovers (Petes and Botstein, 1977), mouse rDNA does not appear to suppress crossovers. Using these genomic features, we were able to distinguish true meiotic crossover initiation sites from randomly sampled loci in the mouse genome with accuracies of 0.73 in (B6 x Spret) and 0.85 in (B6 x Cast), respectively, while the expected accuracy of 0.85 in (B6 x Cast) held for a subset of 25 genomic features. We emphasize that although the behavior of the various features was largely consistent between modeling approaches, we cannot establish any causality without further experiments.

[0498] method

[0499] Methods and molecular design of sci-L3-WGS and sci-L3-target-seq

[0500] Single cell preparation and nucleosome depletion

[0501] Cell suspensions were prepared by trypsinization from a petri dish or from tissue homogenate. According to the protocol approved by the IACUC of the University of Washington, male F1 mice were killed by CO2 followed by cervical dislocation. In order to separate male germ cells, we dissected the epididymis by cutting the tube into thin slices and incubating the tissue in 1 ml of 1xPBS supplemented with 10% FBS for 15 minutes at room temperature. After incubation, the cell suspension was collected by pipetting. Cells isolated from the epididymis were used for (B6 x Spret) hybridization experiments and were also used as a source of mature sperm ("barcode group 3") for (B6 x Cast) hybridization. In order to separate nuclei from whole testes as an enrichment method for 2B cells for (B6 x Cast) hybridization, we first cross-linked the testicular cells with 1% formaldehyde and then extracted the nuclei using a hypotonic buffer. Then, we sorted 1C and 2C nuclei by DNA content FACS mainly based on DAPI signals. Cultured human and mouse cells were pelleted at 550 g for 5 min at 4°C, and male germ cells were pelleted at 2400 g for 10 min at 4°C.

[0502] Nucleosome depletion mainly follows the xSDS method in sci-DNA-seq (Vitak et al., 2017), except that the lysis buffer was changed to be compatible with the downstream LIANTI protocol (Chen et al., 2017). The cells were crosslinked in 10 mL DMEM complete medium containing 406 μL 37% formaldehyde (final concentration 1.5%) at room temperature for 10 minutes (gently invert the test tube). Then 800 μL 2.5M glycine was added and incubated on ice for 5 minutes. The cells were pelleted and washed with 1 mL lysis buffer (60 mM Tris-Ac pH 8.3, 2 mM EDTA pH 8.0, 15 mM DTT). The pellet was resuspended in 1 mL lysis buffer containing 0.1% IGEPAL (I8896, SIGMA) and incubated on ice for 20 minutes. The nuclei were then pelleted, washed with 1xNEBuffer2.1, and resuspended in 800 μL of 1xNEBuffer2.1 containing 0.3% SDS for nucleosome depletion at 42°C (vigorous shaking for 30 minutes, 500 rpm). We then added 180uL of 10% Triton-X and shook vigorously (500 rpm) for 30 minutes at 42°C. The permeabilized nuclei were then washed twice in 1 mL of lysis buffer and then resuspended in lysis buffer at 20,000 nuclei / μL.

[0503] Transposome design and assembly

[0504] Transposon DNA oligomers were synthesized with 5' phosphorylation of both strands, one required for Tn5 insertion (5' / Phos / CTGTCTCTTATACACATCT, IDT, PAGE purified (SEQ ID NO: 1)), similar to LIANTI and Nextera, and the other required for ligation (5' / Phos / GTCTTG XXXXXXXX [first round barcode] AGATGTGTATAAGAGACAG, IDT, standard desalted (SEQ ID NO: 2)). After 1:1 annealing in annealing buffer (10 mM Tris-HCl pH 8.0, 50 mM NaCl, 1 mM EDTA, pH 8.0) with gradient cooling (95°C for 5 min, -0.1°C / cycle, 9 sec / cycle, 700 cycles to 25°C), the Tn5 duplex with 5' overhangs was diluted to 1.5 μM. We then added 7.2 μL of storage buffer (1xTE with 50% glycerol) to 12 μL of approximately 1 μM Tn5 transposase (Lucigen, TNP92110) and incubated 0.79 μL of the diluted transposase with 0.4 μL of 1.5 μM Tn5 duplex at room temperature for 30 min for transposome dimerization to a final concentration of 0.2 μM. Transposome complexes can be stably stored at -20 °C for up to one year. We set up 24 reactions in the first round for barcoding 24 wells, but more wells may be needed depending on the application. For each new biological application, we first further diluted the transposome to 0.1 μM for test experiments. The number of unique read fragments and library complexity were not optimal ( Figure 5 ), but can be used for low-resolution mapping.

[0505] exist Figure 7 In the figure, we show the molecular structure of sci-L3-WGS at each step. In commercial Nextera library preparation, at least half of the sequenceable DNA material is lost due to the following reasons: 1) Tn5 insertion introduces symmetrical transposon sequences at both ends of the fragmented genomic DNA, which can lead to the formation of hairpin loops and prevent PCR amplification when denatured; and 2) if both ends are labeled with both i5 or i7 with a 50% chance, the molecule cannot be sequenced. A key advantage of LIANTI compared to Nextera-based library preparation is that the circular Tn5 design breaks the symmetry introduced by the transposome dimer and promotes reverse transcription (RT) by using intramolecular RT primers (also a feature of circular transposons). However, circular transposons are incompatible with more than two rounds of barcoding, which limits throughput and significantly increases library costs (see Table 2 for comparison). In the changes made to sci-L3-WGS, we retained the advantages brought by circular Tn5 in the ligation step.

[0506] Labeling (first round of barcoding) and concatenation (second round of barcoding)

[0507] We then distributed 1.5 μL of nuclei at a concentration of 20,000 / μL into each well of a lo-bound 96-well plate, added 6.5 μL H2O and 0.7 μL 50 mM MgCl2 (final concentration 3.24 mM, accounting for EDTA in the lysis buffer). 1.2 μL of the transposomes prepared above were added to each well, and the plate was then incubated at 55°C for 20 minutes (a thermomixer is recommended, but not required). We then added 5 μL of stop solution (40 mM EDTA and 1 mM spermidine) and pooled the nuclei in the trough. An additional 1 mL of lysis buffer was added to the nuclei suspension prior to precipitation. After carefully removing the supernatant, we resuspended the nuclei in 312 μL resuspension buffer (24 μL 10 mM dNTPs, 48 ​​μL 10x tagmentation buffer [50 mM MgCl2, 100 mM Tris-HCl pH 8.0], 96 μL H2O, 144 μL lysis buffer) and distributed 4.7 μL of the nuclei mixture to each well of a new lo-binding 96-well plate. The hairpin ligation duplex (1. CAAGAC 2. Y'Y'Y'Y'Y'Y'Y'Y' [reverse complementary sequence of the second round barcode] 3. CAGGAGCGAGCTGCATCCC 4. AATTTTAATACGACTCACTATA 5. GGGATGCAGCTCGCTCCTG 6. YYYYYYY [second round barcode] (SEQ ID N: 3)) was pre-annealed similarly to the Tn5 transposon duplex and diluted to 1.5 μM. Note that the ligation duplex contains five elements: 1) the reverse complement of the ligation adapter on Tn5; 2) the reverse complement of the second round barcode; 3) the reverse complement of the second strand synthesis (SSS) primer; 4) the T7 promoter, note that this is the loop region of the hairpin; 5) the second strand synthesis (SSS) primer region that begins with GGG and is used to enhance T7 transcription ( Figure 4 B);6) Second round barcode ( Figure 4"bc2" in B). We added 0.8 μL of these duplexes to each well with the nucleus suspension and added 1.18 μL of ligation mixture (0.6 μL 10x NEB T4 ligase buffer, 0.48 μL PEG-4000, 0.1 uL T4 DNA ligase [Thermo EL0011]) to each well and incubated at 20°C for 30 minutes. Note that after ligation, the ring structure mimics the structure of LIANTI and promotes the efficiency of the RT step (described below), and the two-round barcode is present at the 3' end of the T7 promoter and is therefore included in the amplified molecule. The ligation reaction was terminated by adding 4 μL of stop solution. The cells were then merged into a new tank (about 630 μL), stained with DAPI at a final concentration of 5 μg / mL, and sorted into 100-300 new wells with 3 μL lysis buffer added before cell sorting. Note that each sorting event using FACS is associated with approximately 3-5 nL of FACS buffer depending on the size of the nozzle, and we recommend keeping the total amount of liquid added to each well to <1 μL to keep the salt concentration low.

[0508] Cell lysis, nick extension, and linear amplification by in vitro transcription

[0509] We then used a total of 3.5-4 μL of sorted nuclei per well for cell lysis by incubating at 75°C for 45 min, cooling to 4°C and treating with freshly diluted Qiagen protease (final concentration 2 mg / ml) at 55°C for 8 h. The protease was then heat-inactivated by incubating at 75°C for 30 min. Cell lysates can be stored at -80°C. For each experiment, we recommend processing no more than 32 wells of sample (approximately 9600 single cells) because the subsequent amplification steps involve RNA and are time-sensitive. For nick extension ( Figure 4C), a polymerase with strand displacement activity is used by adding a mixture of 2 μL H2O, 0.7 μL 10x labeling buffer, 0.35 μL 10mM dNTPs and 0.35 μL Bst WarmStart 2.0 polymerase with strand displacement activity, and incubated at 68°C for 5 minutes. Note that if the connection is successful at both ends, the duplex is symmetrical for the T7 promoter on both sides, but if the connection is successful only at one end, the area in the dashed box is lost at one end. Intermolecular connections are generally inefficient. Although we include pre-annealed hairpin loops to minimize the necessity for intermolecular connections, two molecules (rather than three molecules in the absence of hairpin loops) are still required to find each other. If the connection efficiency is 50%, the connection on both ends has a 25% incidence, but the connection on either end has a 75% incidence. Subsequently in the RT step, we show that only one end is required for successful connection. After nick extension, the PCR product was purified by adding 2 μL H2O, 2 μL T7 Pol mix, and 10 μL rNMP mix (NEB, HiScribe TM Assemble 20 μL of T7 in vitro transcription system using T7 Rapid High Yield RNA Synthesis Kit. Incubate the mixture at 37°C for 10-16 hours.

[0510] RNA purification, RT and SSS (or targeted sequencing)

[0511] Transcription was terminated by adding 2.2 μL 0.5 M EDTA. The amplified RNA molecules were then purified with RCC-5 (ZymoResearch, R1016) and eluted with 18 μL 0.1x TE. The 30 μL RT system was prepared by first adding 0.6 μL RNA RT primer (rArGrArUrGrUrGrUrArUrArArGrArGrArCrArG, IDT (SEQ ID NO: 4)), 2 μL 10 mM dNTPs and 0.5 μL SUPERase·In TM Nase inhibitor (20U / μL, Thermo Fisher AM2696) was assembled. Then, we incubated at 70°C for 1 min, 90°C for 20 s for denaturation and removal of secondary structure, and quenched on ice. SuperScript TM V reverse transcriptase (SSIV, Thermo Fisher 18090050) with 6 μL 5xRT buffer, 1.5 μL 0.1M DTT, 1 μL SUPERase·In TMUse 1 μL SSIV for RT. Incubate the RT reaction at 55°C for 15 min, 60°C for 10 min, 65°C for 12 min, 70°C for 8 min, 75°C for 5 min, and 80°C for 10 min. Cool the reaction to room temperature before adding 0.5 μL RNaseH (NEB) and 0.3 μL RNaseA (Life Technologies, AM2270) and incubate at 37°C for 30 min. Note that Figure 4 E depicts two scenarios in the RT step: 1) If both ends have successful ligation, the RT may be initiated by the reentry loop as in LIANTI. 2) If only one end has successful ligation, the RT may be initiated by the RNA RT primer added before the denaturation step. After cDNA synthesis, excess RNA primer and RNA transcripts are degraded. Finally, we synthesize the second chain with Q5 polymerase by adding 27 μL H2O, 20 μL 5x Q5 buffer, 20 μL Q5 GC enhancer, 1 μL Q5 polymerase and 1 μL SSS primer (NNNN [UMI] ZZZZZZ [third round barcode] GGGATGCAGCTCGCTCCTG, IDT, standard desalting (SEQ ID NO: 5)). The resulting double-stranded DNA can be purified with DCC-5 (Zymo Research, D4014) and used to add sequencing adapters with a minimum of 3 PCR cycles using a library preparation kit (such as NEBNext Ultra II).

[0512] It is noteworthy that by using a single cell barcode primer with a P5 end (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC GACGCTCTTCCGATCTNNNNNNNZZZZZZ [third round barcode] GGGATGCAGCTCGCTCCTG (SEQ ID NO: 6)) and a targeting primer for a region in the genome ( Figure 3 B), the SSS step can be easily modified to enable targeted sequencing. For example, in applications where a lentiviral-based CRISPR library is integrated (Shalem et al., 2014), the guide RNA sequence in each single cell can be sequenced using the P7 end of the CRISPR library primer with the lentiviral integration (CAAGCAGAAGACGGCATACGAGAT TCGCCTTG[Index 1] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGACTCGGT GCCACTTTTTCAA (SEQ ID NO: 7)) read, so there is no need to sequence the entire genome and enrich for specific target regions. In this case, the library preparation step can be omitted and replaced with gel or bead purification to remove primer dimers.

[0513] Methods and molecular design for sci-L3-RNA / DNA co-analysis

[0514] Single cell preparation and nucleosome depletion

[0515] Cell suspensions were prepared with the same protocol as in sci-L3-WGS, except for the differences noted below. HEK293T, BJ-5ta, and 3T3 cells were trypsinized from culture dishes and fixed with 2% PFA in 1x PBS at 1 M / mL cell concentration for 10 minutes at room temperature. Subsequent quenching (with glycine), washing, nuclei isolation (with 0.1% IGEPAL), and nucleosome depletion (xSDS method) steps were the same as for sci-L3-WGS, except that we added 1% Superase-In to all lysis buffers and 1xNEBuffer2. Nuclei were resuspended in lysis buffer containing 1% Superase-In at 20,000 nuclei per microliter.

[0516] Transposome and reverse transcription (RT) primer design

[0517] For the single-cell genome amplification component, the design and assembly of the transposome were the same as for sci-L3-WGS.

[0518] For the single-cell transcriptome profiling component, the reverse transcription primers shared a similar structure to sci-RNA-seq for the reverse transcription aspect (Cao et al., 2017; Cusanovich et al., 2015; Mulqueen et al., 2018; Ramani et al., 2017; Vitak et al., 2017), i.e., the poly-T priming portion of the oligonucleotide, but contained a different barcode structure and landing pad for the subsequent ligation step ( / 5Phos / GTCTTG [same landing pad as in sci-L3-WGS] NNNNNN [UMI1 for tagging unique transcripts] X'X'X'X'X'X'X'X'X' [first round barcode for the transcriptome, which is different in sequence from the Tn5 transposon barcode] TTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, IDT, standard desalted (SEQ ID NO: 8).

[0519] RT and labeling (first round of barcoding), ligation (second round of barcoding), FACS and cell lysis

[0520] We then distributed 1.5 μL of nuclei at a concentration of 20,000 / μL into each well of a lo-bound 96-well plate, added 0.2 μL of H2O, 0.3 μL of 50 mM MgCl2 (to neutralize EDTA in the lysis buffer), 0.25 μL of 10 mM dNTPs, and 1 μL of 25 μM RT primer to prepare for the RT step. The nuclei mixture was then incubated at 55°C for 5 minutes to remove secondary structures and rapidly quenched on ice. We then added 1 μL 5x RT buffer, 0.03 μL 100 mM DTT (note that DTT from the lysis buffer was present, final concentration 5 mM), 0.25 μL SSIV, 0.25 μL RNaseOUT (Thermo Fisher Cat. No. 10777019), and incubated for 1 min at 25°C, 1 min at 37°C, 1 min at 42°C, 1 min at 50°C, and 15 min at 55°C for the RT reaction. Then 0.4 μL MgCl2 and 3.52 μL H2O and 1.2 μL of the transposome prepared above were added to each well. All subsequent steps until cell lysis were the same as for sci-L3-WGS.

[0521] Nick extension and linear amplification by in vitro transcription

[0522] We used random heptamers to perform gap extension with part of the NEBNext Read 1 primer as a 5' overhang (CACGACGCTCTTCCGATCT NNNNNNN (SEQ ID NO: 9)). We added 1 μL of 20 μM oligomers, incubated at 95°C for 3 minutes to denature the DNA, and then gradually cooled to room temperature (about 5 minutes) to allow the oligomers to anneal. Then 2 μL H2O, 0.8 μL 10x NEBuffer2, 0.4 μL 10mM dNTPs, 0.4 μL Klenow fragment (3'→5'exo-, NEB M0212S) were added and incubated at 30°C for 8 minutes and 75°C for 10 minutes. After gap extension, 20 μL T7 in vitro transcription system was assembled by the same sci-L3-WGS protocol.

[0523] RNA purification, RT and SSS

[0524] All steps were the same as for sci-L3-WGS except for the different oligo sequences. In the RT step after IVT, instead of using 0.6 μL RNA RT primer, we used 0.6 μL NEBNext Read 1 primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, P5 end for Illumina sequencing, IDT (SEQ ID NO: 10)). For the SSS primer, we added the adapter using AAGCAGAAGACGGCATACGAGAT[P7 end]NNNN[UMI2]Z'Z'Z'Z'Z'Z'[3rd round barcode]CGTCTCTACGGGATGCAGCTCGCTCCTG (SEQ ID NO: 11). Note that the resulting double-stranded DNA now contains P5 and P7 ends for Illumina sequencing and can be purified and sequenced using 1.1x AmpureXP beads. The library preparation steps and a minimum of 3 PCR cycles in sci-L3-WGS (for adding sequencing adapters) are not necessary for co-analysis.

[0525] Setup of sci-L3-WGS experiments in (B6 x Spret) hybridization and (B6 x Cast) hybridization

[0526] (B6 x Spret) hybrid

[0527] We pooled cells isolated from 6 and 3 epididymis of 70- and 88-day-old (B6 x Spret) F1 males, respectively, in two separate experiments and fixed them with 1% formaldehyde. For each experiment, we distributed 30,000 cells per well after nucleosome depletion and performed in situ indexed Tn5 insertion in 24 wells to add the first round of barcodes. We then pooled all cells and redistributed them to 64 wells to add the second round of barcodes and T7 promoter by ligation. After pooling all cells again, we split the cell mixture 1:6, FACS sorted the majority of cells (6 / 7), and diluted the rest (1 / 7). The resulting wells contained between 100 and 360 cells per well, with an estimated conflict rate of 4–11%.

[0528] (B6 x Cast) hybrid

[0529] From 6 testes, we recovered about 12M 1C round spermatids and about 0.5M 2C cells. However, since the number of 1C cells was >20-fold higher, we still found many 1C cells in the population sorted for 2C cells ( Figure 8F). In one of the sci-L3-WGS experiments where we attempted to enrich for 2C cells, we estimated that ~160k spermatozoa, ~160k 1C round spermatids, and ~70k 2C cells were tagged from the epididymis and further enriched for 2C cells during the FACS step of sci-L3-WGS ( Figure 8 G). However, despite two rounds of enrichment, 1C cells still predominated.

[0530] Table 4. Oligomers of sci-L3.

[0531]

[0532]

[0533]

[0534]

[0535]

[0536]

[0537]

[0538] Methods of bioinformatics and statistical analysis

[0539] Read fragment processing, alignment and SNV calling

[0540] Base calls were converted to fastq files by bcl2fastq with 1 mismatch allowed in the index. We then performed demultiplexing using a custom shell script “sci_lianti_v2.sh” (python script and R Markdown file uploaded as “sci_lianti_inst.tar.gz”, respectively; the R package containing the intermediate data files used to generate all main and supplementary figures can be downloaded and installed via the following link: https: / / drive.google.com / file / d / 19NFubouHrahZ8WoblL-tcDrrTlIZEpJh / view?usp=sharing), which calls the python script or NGS tool for the following steps: 1) ordering read fragment pairs so that all single-cell combined barcodes are in read fragment 1 (R1); 2) demultiplexing third-round (SSS, 6nt, no errors allowed) barcodes and appending the UMI of the barcode and transcript to the read fragment name and splitting the library by third-round barcode. Note that all subsequent steps were performed in parallel for a single library segmented by the third round of barcodes, which contained 100-300 single cells; 3) The barcodes of the first round (Tn5, 8nt, 1 error allowed) and the second round (ligation, 7nt, 1 error allowed) were segmented in R1 using cutadapt, the errors were calculated by Levenshtein distance, and the barcodes of both rounds were attached to the read fragment names. This step was performed in a paired-end manner, that is, if R1 did not have the correct barcode and spacer structure, the paired read fragment 2 (R2) was discarded; 4) R2 was cleaned up using cutadapt; 5) Aligned to the hg19 or mm10 genome using bwa mem in a paired-end manner (Li and Durbin, 2009). For experiments where barcode conflicts were assessed, we used a concatenated reference of hg19 and mm10 and used uniquely aligned reads to determine relative mapping rates to the human or mouse genome; 6) split the bam files into single-cell bam files using the first and second round barcodes appended to the read names; 7) converted the bam files to bed files using bedtools (Quinlan and Hall, 2010) and determined unique insertion positions if R1 or R2 shared the same endpoints. Unique Tn5 insertion sites were defined as where the two ends of a read pair required different fragments; 8) used the “pileup” function in the “lianti” package (https: / / github.com / lh3 / lianti / blob / master / pileup.c) (Chen et al., 2017) to call variants in an allele-aware pattern.Note that in this step, we include the combined batch bam file (generated by merging all ~6900 single cells by samtools (Chen et al., 2017; Li and Durbin, 2009), over 30x) and each single cell bam file so that the threshold of depth at each SNP position only needs to be exceeded in the batch file for SNP calls included in the final vcf file, so the raw counts of REF and ALT alleles are included in the single cell column as long as the variant is present as a heterozygous SNP in the batch file. By converting the problem of de novo SNP calling to a genotyping problem, the problem of high false negatives due to low depth sequencing in single cells is avoided; 9) SNVs identified in each single cell according to SNP quality annotation by Spret's reference SNP vcf file (SPRET_EiJ.mgp.v5.snps.dbSNP142.vcf.gz downloaded from Mouse GenomeProject). The annotated SNP file was then used as input for subsequent exchange breakpoint analysis.

[0541] HMM for identifying breakpoints

[0542] The genotype at a given SNP site was determined by comparing the number of reads supporting the reference and alternative alleles. For 1C cells, the crossover position was determined by fitting a hidden Markov model to three states: reference, alternative, and heterozygous.

[0543] The transition matrix is ​​specified in Table 5.

[0544] Table 5. Transfer matrix.

[0545] From\To refer to Alternative Heterozygous refer to 1-transprob transprob*0.3 transprob*0.7 Alternative transprob*0.3 1-transprob transprob*0.7 Heterozygous transprob*0.5 transprob*0.5 1-transprob

[0546] Parameters were selected manually based on visual assessment that the results did not change significantly when the main parameters were varied by two orders of magnitude. Transprob was taken to be very small [in this case 1e-10 / (total number of SNPs on a given chromosome)] to reflect the idea that state transitions at any single SNP site should be very rare events. Further decomposition of Transprob to fractions of 0.3 and 0.7 aims to suppress rapid successive transitions of the reference-alternative-reference or alternative-reference-alternative type.

[0547] The emission matrix is ​​specified in Table 6.

[0548] Table 6. Emission matrix.

[0549]

[0550]

[0551] After identifying hidden states for each individual SNP, consecutive long state blocks were called by deleting state blocks shorter than 50 kb. The swap position was then determined by the position where the long state block switched to a different state, where the breakpoint track start position was the last SNP position of the previous state block, and the track end position was the first SNP position of the next state block.

[0552] For M2 cells, the average allele frequency was first obtained by averaging the alleles within a window of 40 SNPs. The binned allele frequencies were then used to infer the underlying chromosomal state from a hidden Markov model with a single Gaussian probability distribution.

[0553] The transformation matrix is ​​specified in Table 7.

[0554] Table 7. Transfer matrix.

[0555] From\To refer to Alternative Heterozygous refer to 1–transprob 0 transprob Alternative 0 1-transprob transprob Heterozygous transprob*0.5 transprob*0.5 1-transprob

[0556] The transmit matrix is ​​specified in Table 8

[0557] Table 8. Emission matrix.

[0558] state emission refer to Normal(0.05,0.1) Alternative Normal(0.5,0.1) Heterozygous Normal(0.95,0.1)

[0559] The approximate breakpoint position was determined by removing the state blocks shorter than 50 kb to call consecutive long state blocks, and then by the position where the long state block switched to a different state. The approximate breakpoint position was then refined by the likelihood ratio test, with the goal of finding possible breakpoints within 20 upstream and 20 downstream SNPs near the approximate breakpoint. For each SNP, the probability of observing the observed genotype is specified in Table 9.

[0560] Table 9. Observed probabilities of the observed genotypes.

[0561] Status_Observed refer to Alternative refer to 1-error_prob error_prob Alternative error_prob 1-error_prob Heterozygous 0.5 0.5

[0562] error_prob is assigned to 1e-3, which reflects the probability that the SNP is misidentified. For each SNP near the approximate breakpoint, the probability that it is the actual breakpoint is calculated by the above distribution. All SNPs with a probability greater than 0.01*maximum probability are considered to be within the breakpoint range. The beginning of the break track is determined as the leftmost SNP among these SNPs, and the end point of the break track is determined as the rightmost SNP. As in the case of 1C, all M2 cell break tracks were further manually checked to remove artifacts, such as two adjacent switches present within 50kb. We also performed the same breakpoint identification in mitotic Patski cells. For M2 cells and Patski cells, we also manually checked the breakpoint tracks by comparing the bin sizes of 10 and 40 SNPs of the cells with sparse genome coverage.

[0563] This step generates the crossover breakpoints. We po...

Claims

1. A method for preparing a sequencing library, wherein the sequencing library comprises nucleic acids from a plurality of single nuclei or a single cell, the method comprising: providing a plurality of isolated nuclei or cells in a first plurality of compartments, where each compartment contains a separate nucleus or subset of cells, and wherein the nucleus or cell comprises a nucleic acid fragment; introducing a linear amplification mediator into the cell or cell nucleus; amplifying the nucleic acid fragment by linear amplification; processing each subset of nuclei or cells to generate indexed nuclei or cells, wherein the processing comprises adding a first compartment-specific index sequence to nucleic acid fragments present in the isolated cell nucleus or cell to produce indexed nucleic acids present in the isolated cell nucleus or cell, wherein the processing comprises ligation, primer extension, hybridization, amplification or transposition; combining the indexed nuclei or cells to produce merged indexed nuclei or cells; distributing the merged, indexed subset of nuclei or cells into a second plurality of compartments; and introducing a second compartment-specific indexing sequence into the indexed nucleic acid to generate a dual-indexed nucleus or cell comprising the dual-indexed nucleic acid, The introducing comprises ligation, primer extension, amplification or transposition, thereby generating a sequencing library from the plurality of cell nuclei or cells. The method of claim 1 , wherein said amplifying occurs prior to said treating. The method of claim 1 , wherein said treating occurs prior to said amplifying.

4. A method for preparing a sequencing library, the sequencing library comprising nucleic acids from a plurality of single nuclei or a single cell, the method comprising: Providing multiple isolated nuclei or cells, wherein the nucleus or cells contain nucleic acid fragments; introducing a linear amplification mediator into the isolated nuclei or cells; distributing the separated nuclei or cells into a first plurality of compartments, Each of these compartments contains a separate subset of nuclei or cells; amplifying the nucleic acid fragment by linear amplification; processing each subset of isolated nuclei or cells to generate indexed nuclei or cells, wherein the processing comprises adding a first compartment-specific index sequence to nucleic acid fragments present in the isolated cell nucleus or cell to produce indexed nucleic acids present in the isolated cell nucleus or cell, wherein the processing comprises ligation, primer extension, amplification or transposition; combining the indexed nuclei or cells to produce merged indexed nuclei or cells; distributing the merged, indexed subset of nuclei or cells into a second plurality of compartments; and introducing a second compartment-specific indexing sequence into the indexed nucleic acid to generate a dual-indexed nucleus or cell comprising the dual-indexed nucleic acid, The introducing comprises ligation, primer extension, amplification or transposition, thereby generating a sequencing library from the plurality of cell nuclei or cells.

5. A method for preparing a sequencing library, the sequencing library comprising nucleic acids from a plurality of single nuclei or a single cell, the method comprising: providing a plurality of isolated nuclei or cells in a first plurality of compartments, where each compartment contains a separate nucleus or subset of cells, and wherein the nucleus or cells contain nucleic acid fragments; processing each subset of nuclei or cells to generate indexed nuclei or cells, wherein the processing comprises adding (i) a first compartment-specific index sequence to the nucleic acid fragments present in the isolated cell nucleus or cell to generate an indexed nucleic acid present in the isolated cell nucleus or cell and (ii) a nucleotide sequence recognized by a linear amplification mediator, wherein the processing comprises ligation, primer extension, hybridization, amplification or transposition; introducing a linear amplification mediator into the cell or cell nucleus; amplifying the nucleic acid fragment by linear amplification; combining the indexed nuclei or cells to produce merged indexed nuclei or cells; distributing the merged, indexed subset of nuclei or cells into a second plurality of compartments; and introducing a second compartment-specific indexing sequence into the indexed nucleic acid to generate a dual-indexed nucleus or cell comprising the dual-indexed nucleic acid, The introducing comprises ligation, primer extension, amplification or transposition, thereby generating a sequencing library from the plurality of cell nuclei or cells.

6. The method according to any one of claims 1, 4 or 5, wherein the linear amplification mediator comprises a bacteriophage RNA polymerase or a linear amplification primer, optionally: a) wherein the nucleic acid fragment comprises a T7 promoter, and the bacteriophage RNA polymerase comprises a T7 RNA polymerase, or b) wherein introducing the linear amplification mediator comprises adding the linear amplification primer to the nucleic acid fragments present in the isolated cell nucleus or cell.

7. The method of claim 1 or 5, further comprising exposing the plurality of separated nuclei or cells of each of the first plurality of compartments to predetermined conditions, optionally further comprising isolating nuclei from the plurality of cells after the exposure.

8. The method of claim 4, further comprising exposing the plurality of isolated nuclei or cells to a predetermined condition.

9. The method of any one of claims 1, 4 or 5, further comprising subjecting the isolated cell nucleus to conditions that produce a nucleosome-depleted nucleus while maintaining the integrity of the isolated cell nucleus.

10. The method according to any one of claims 1, 4 or 5, wherein the processing comprises: Each subset is brought into contact with the transposome complex, wherein in each compartment the transposome complex comprises the first indexing sequence which is different from the first indexing sequences in the other compartments; and The nucleic acids in the subset are fragmented into a plurality of nucleic acids, and the first index sequence is incorporated into at least one strand of the nucleic acids to produce the indexed nuclei or cells comprising the indexed nucleic acids.

11. The method according to any one of claims 1, 4 or 5, wherein the processing comprises: Each subset is contacted with a reverse transcriptase and a primer that anneals to the RNA molecules in the isolated cell nuclei, wherein the primer in each compartment comprises the first index sequence that is different from the first index sequence in the other compartments, to generate the indexed cell nuclei or cells comprising the indexed nucleic acids, optionally wherein the contacting further comprises a target-specific primer that anneals to a specific nucleotide sequence.

12. The method of any one of claims 1 , 4 or 5 , wherein the process of adding the first compartment-specific index sequence comprises a two-step process of adding a nucleotide sequence comprising a universal sequence to the nucleic acid fragment and then adding the first compartment-specific index sequence to the nucleic acid fragment, optionally wherein the adding comprises a transposome complex comprising the universal sequence.

13. The method according to any one of claims 1, 4 or 5, wherein the processing comprises adding a first index to a DNA nucleic acid present in the isolated cell nucleus or cell, adding a first index to an RNA nucleic acid present in the isolated cell nucleus or cell, or a combination thereof, optionally a) wherein the adding a first index sequence to the RNA nucleic acid comprises: exposing each subset to a reverse transcriptase and primers that anneal to RNA molecules in the isolated nuclei or cells, wherein said primers in each compartment comprise said first compartment-specific index sequence to produce said indexed nuclei or cells comprising said indexed nucleic acid, or b) wherein said adding the first index sequence to the DNA nucleic acid comprises: Each subset is brought into contact with the transposome complex, wherein the transposome complex in each compartment comprises the first compartment-specific index sequence; and The nucleic acids in the subset are fragmented into a plurality of nucleic acids, and the first compartment-specific index sequence is incorporated into at least one strand of the nucleic acids to generate the indexed nuclei or cells comprising the indexed nucleic acids.

14. A method according to claim 13, wherein in optional step a), the first index sequence added to the DNA nucleic acid and the first index sequence added to the RNA nucleic acid in each compartment are the same, or wherein the first index sequence added to the DNA nucleic acid and the first index sequence added to the RNA nucleic acid in each compartment are different.

15. The method of any one of claims 1, 4 or 5, further comprising reamplification of the nucleic acid fragment, wherein the reamplification comprises a target-specific primer that anneals to a specific nucleotide sequence.

16. The method according to any one of claims 1, 4 or 5, further comprising: combining the dual-indexed nuclei to generate merged dual-indexed nuclei or cells, distributing a subset of the merged dual-indexed nuclei or cells into a third plurality of compartments; and introducing a third compartment-specific indexing sequence into the indexed nucleic acid to generate a triply-indexed nucleus or cell comprising the triply-indexed nucleic acid, The introducing comprises ligation, primer extension, amplification or transposition.

17. The method according to any one of claims 1, 4 or 5, further comprising i) processing the indexed nuclei or cells for methylation analysis to generate nucleic acid fragments suitable for methylation analysis, or ii) further comprising subjecting the indexed nuclei or cells to proximity ligation to generate nucleic acid fragments suitable for analyzing chromatin conformation, or iii) further comprising amplifying the nucleic acid fragments of the sequencing library to produce DNA nanoballs.

18. The method of any one of claims 1 to 17, wherein a compartment of the first plurality of compartments or the second plurality of compartments comprises a well or a droplet, optionally a) wherein each compartment of the first plurality of compartments comprises 50 to 100,000,000 nuclei or cells, or b) wherein each compartment of the second plurality of compartments comprises 50 to 100,000,000 nuclei or cells, or c) further includes: providing a surface comprising a plurality of amplification sites, wherein the amplification site comprises at least two populations of attached single-stranded capture oligonucleotides having free 3' ends, and The surface comprising amplification sites is contacted with the indexed fragments under conditions suitable for generating a plurality of amplification sites, each amplification site comprising a clonal population of amplicons from a single fragment containing the plurality of indexes.

19. A method for preparing a sequencing library comprising nucleic acids from a plurality of single cells, the method comprising: (a) providing isolated cell nuclei from a plurality of cells; (b) chemically treating the isolated cell nucleus to produce a nucleosome-depleted cell nucleus while maintaining the integrity of the isolated cell nucleus; (c) distributing subsets of the nucleosome-depleted nuclei into a first plurality of compartments and contacting each subset with a transposome complex, wherein the transposome complex in each compartment comprises a transposase and a first index sequence that is different from first index sequences in other compartments; (d) fragmenting the nucleic acid in the subset of the nucleosome-depleted nuclei into a plurality of nucleic acid fragments and incorporating the first index sequence into at least one strand of the nucleic acid fragments to generate indexed nuclei comprising indexed nucleic acid fragments, wherein the indexed nucleic acid fragments remain attached to the transposase; (e) combining the indexed nuclei to generate merged indexed nuclei; (f) distributing subsets of the pooled indexed nuclei into a second plurality of compartments and contacting each subset with a hairpin ligated duplex under conditions suitable for ligation of the hairpin ligated duplex to one or both ends of the indexed nucleic acid fragments to produce dual-indexed nucleic acid fragments, wherein the hairpin ligated duplex comprises a second index sequence that is different from the second index sequence in the other compartments; (g) combining the dual-indexed nuclei to generate a merged indexed nucleus comprising the dual-indexed nucleic acid fragments; (h) distributing a subset of the merged dual-indexed nuclei into a third plurality of compartments; (i) lysing the dual-indexed cell nuclei; (j) amplifying the dual-indexed nucleic acid fragments by linear amplification; (k) processing the dual-indexed nucleic acid fragments to include a third index sequence that is different from the third index sequence in the other compartment; and (l) combining the three-indexed fragments to generate a sequencing library comprising whole-genome nucleic acids from the plurality of single cells.

20. The method of any one of claims 1, 4 or 5, wherein the nucleic acid fragment comprises a bacteriophage promoter at one or both ends, and wherein the linear amplification mediator comprises a bacteriophage RNA polymerase.

21. The method according to any one of claims 1, 4 or 5, wherein the linear amplification mediator comprises one primer, or comprises two primers, one of which is in excess.

Images