Anti-PIK3IP1 nano antibody and application thereof

Abstract

The invention discloses an anti-PIK3IP1 nano antibody and application thereof, and relates to the technical field of biological medicines. The anti-PIK3IP1 nano antibody screened from a bactrian camel VHH immune library can be specifically combined with a PIK3IP1 antigen, and it can be known through determination of the affinity of the antibody that the affinity of the obtained nano antibody ranges from 10 <-8 > M to 10 <-7 > M order of magnitude, and the affinity is high. The nano antibody or the antigen binding fragment can be specifically bound with PIK3IP1, can be prepared into medicines for preventing or treating various tumors such as lung cancer, liver cancer, colorectal cancer, breast cancer, glioma, stomach cancer, esophagus cancer, oral squamous cell carcinoma or head and neck cancer, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an anti-PIK3IP1 nanobody and applications thereof. Background Art

[0002] PIK3IP1 (Phosphoinositide-3-kinase interacting protein 1), also known as SKIP (Skeletal Muscle And Kidney-enriched Inositol Phosphatase), is a phosphatase that mainly interacts with phosphatidylinositol 3-kinase (PI3K) to regulate the PI3K signaling pathway and plays an important role in biological processes such as cell signaling, apoptosis, and metabolic regulation. The expression of PIK3IP1 is specific in different tissues and is mainly enriched in skeletal muscle and kidney tissues, suggesting that it may play an important physiological function in these tissues.

[0003] However, multiple studies have found that abnormal expression of PIK3IP1 is associated with tumors, including breast cancer, lung cancer, liver cancer, and colorectal cancer. Xin He et al. reported that overexpression of PIK3IP1 in mouse hepatocytes leads to reduced PI3K signaling and inhibits the development of hepatocellular carcinoma. LP Kane first reported that PIK3IP1 plays an inhibitory role in T cell activation, and PIK3IP1 oligomerization degrades SLP76, thereby inhibiting TCR signaling in T cells. In addition, there are reports that PIK3IP1's response to glutaminase-dependent metabolism determines the fate of T cells, which enhances the role of PIK3IP1 in regulating T cell activation. At the same time, there are also articles reporting that PIK3IP1 participates in tumor immunity by regulating PI3K signaling in T cells and B cells, and the inventors have also confirmed that PIK3IP1 is a new negative immune regulator. Due to the potential role of PIK3IP1 in tumor development, the inventors also proposed methods and applications of PIK3IP1 protein in regulating T cell responses and for individual cancer treatment. Collectively, PIK3IP1 is a key negative regulator in cancer and plays an important role in cell signaling and metabolic regulation, especially by inhibiting the activity of the PI3K signaling pathway.

[0004] In view of the potential role of PIK3IP1 in tumor development, in order to use PIK3IP1 to develop new anti-tumor or autoimmune disease strategies, especially diseases related to the PI3K / Akt signaling pathway. At present, there is no research on nano antibodies targeting human PIK3IP1, so the present invention is proposed. Summary of the invention

[0005] The technical problem to be solved by the present invention is that there is a lack of nano-antibodies targeting the PIK3IP1 target, which urgently needs to be developed.

[0006] The technical solution of the present invention to solve the above technical problems is: to provide an anti-PIK3IP1 nanobody. The heavy chain variable region of the nanobody comprises CDR1, CDR2 and CDR3, and the amino acid sequences of CDR1, CDR2 and CDR3 are any one of SEQ ID NOs: 1 to 3, SEQ ID NOs: 6 to 8 or SEQ ID NOs: 11 to 13, respectively.

[0007] The above-mentioned anti-PIK3IP1 nanobody also includes a framework region, and the structure of its heavy chain variable region is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0008] Preferably, in the above-mentioned anti-PIK3IP1 Nanobody, when the Nanobody is a monovalent Nanobody, the amino acid sequence of the Nanobody is as shown in any one of SEQ ID NO:4, SEQ ID NO:9 or SEQ ID NO:14.

[0009] In a second aspect, the present invention further provides an antibody comprising the above-mentioned anti-PIK3IP1 nanobody or the heavy chain variable region of the anti-PIK3IP1 nanobody.

[0010] Wherein, the antibody is any one of a full-length antibody, a heavy-chain antibody, a chimeric antibody, a multispecific antibody, a mouse antibody, a humanized antibody or an antigen-binding fragment.

[0011] Furthermore, the multispecific antibody is a bispecific antibody, a trispecific antibody or a tetraspecific antibody, etc.

[0012] Furthermore, the antigen-binding fragment includes any one selected from F(ab')2, Fab', Fab, Fv and scFv of an antibody, as long as they exhibit the desired antigen-binding activity.

[0013] The above antigen-binding fragments, i.e., functional fragments of antibodies, generally have the same binding specificity as the antibodies from which they are derived. It is easy for a person skilled in the art to understand based on the contents described in the present invention that the functional fragments of the above antibodies can be obtained by, for example, enzymatic digestion (including pepsin or papain) and / or by chemical reduction to split disulfide bonds. Based on the structure of the complete antibody disclosed in the present invention, a person skilled in the art can easily obtain the above functional fragments.

[0014] The above antigen-binding fragments can also be synthesized by recombinant genetic techniques also known to those skilled in the art or by, for example, an automatic peptide synthesizer, such as those sold by Applied BioSystems and the like.

[0015] The "chimeric antibody" described in the present invention is an antibody formed by fusing the variable region of a non-human antibody with the constant region or framework region of a human antibody, which can reduce the immune response induced by the non-human antibody.

[0016] Furthermore, in the above-mentioned antibody, the human heavy chain constant region is the heavy chain constant region of hIgG1, hIgG2, hIgG3 or hIgG4 or a mutation thereof.

[0017] In a third aspect, the present invention also provides a nucleic acid encoding the above-mentioned nanobody.

[0018] Wherein, the nucleotide sequence of the nucleic acid is shown as SEQ ID NO:5, SEQ ID NO:10, and SEQ ID NO:15.

[0019] SEQ ID No.5 Encoding nucleotide sequence of anti-PIK3IP1 nanobody Nb10

[0020] CAGGTGCAGCTGCAGGAGTCTGGGGGAGACTTGGTGCAGCCTGGGGGGTCTCTGAAAC

[0021] TCTCCTGTGCGGCCTCTGTAATCACCTGCAGTAGCGCATACATGGACTGGCTCCGCCGGC

[0022] CTCCAGGGAAGGGACTCGAGTGGGTCTCAAGTATCGACAGCGACGGCAGCACCTTGTA

[0023] TCGAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTG

[0024] TATCTGCAAATGAACAGCCTGAAAACTGAGGACACGGCCATGTATTACTGTGCCAGGGACAGGGCCGGCAACTACGAGGGCCAGGGGACCCAGGTCACCGTCTCCTCA.

[0025] SEQ ID No.10 Encoding nucleotides of anti-PIK3IP1 nanobody Nb23

[0026] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGAC

[0027] TCTCCTGTACAGCCTCTATCAAGAGTAACGACGGCATCACCATGGGCTGGTTCCGCCAG

[0028] GCTCCAGGGAAGGAGCGCGAGGGGGTCGCTAGTATCACCGCCAACGCCATGCCCAGCT

[0029] ATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAAAGACAACGCCAAGATCACGCTG

[0030] TTTCTCCAAATGAACAGCCTGAAACCTGAGGACACTGCCATGTACTACTGTGCCGCCGA

[0031] CTACCTGTGGTACGGCAGCAGCTGGTACAGGTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0032] Coding nucleotide of nanobody Nb45 against PIK3IP1, SEQ ID No.15

[0033] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCCGGCTGGAGGGTCTCTGAGAG

[0034] TCTCCTGTGCAGCCTCTGCCACCAACAGCAACGGCTACAGCATCAGCTGGTACCGCCAG

[0035] GCTCCAGGGAGGGAGCGCGAGTTCGTCTCAGCTGTGGACACCGCCAGGGGCTACAGTT

[0036] ACGCATACTCCGTGAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAACACGGT

[0037] GTATCTGCAAATGAACACCCTGAAACCTGAGGACACGTCCATGTATTACTGTTTCGGCGT

[0038] GGACTGCAGCGACTACACCAGCCTGCTGGGCGGCATCTCGTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA.

[0039] In a fourth aspect, the present invention also provides a recombinant vector containing the nucleic acid encoding the above-mentioned nanobody.

[0040] The recombinant vector is an expression vector or a cloning vector, preferably an expression vector, which may refer to any recombinant polynucleotide construct that can directly introduce the target DNA fragment into the host cell by transformation, transfection or transduction to express the target gene.

[0041] In a fifth aspect, the present invention also provides a host cell containing the above-mentioned recombinant vector.

[0042] In the sixth aspect, the present invention also provides a method for preparing an antibody, comprising: transducing the recombinant vector containing the anti-PIK3IP1 nanobody of the fourth aspect of the present invention into the host cell of the fifth aspect by transfection or infection, collecting the culture supernatant or host cells after expanded culture, and further purifying to obtain the recombinant nanobody. Specifically, the present invention does not specifically limit the culture conditions of the host cells, and the culture conditions that enable the host cells to express and produce the antibodies can be obtained based on conventional technical knowledge.

[0043] In the seventh aspect, the present invention also provides a recombinant protein or a pharmaceutical composition thereof, which includes the above-mentioned anti-PIK3IP1 nanoantibody or the above-mentioned antibody, and also includes an active agent; the active agent includes at least one of an immune checkpoint-related preparation, an antibody-drug conjugate, a bispecific antibody, a multispecific antibody, a radionuclide or a kinase inhibitor.

[0044] In an optional embodiment, the therapeutic agent includes at least one of: a chemotherapeutic drug, a radionuclide, a photosensitizer, a photothermal agent, an immune checkpoint inhibitor, a toxin, a factor, a kinase inhibitor, an antibody to an inhibitory second signal molecule, a PD-L1 inhibitor, and a PD-1 / PD-L1 monoclonal antibody drug.

[0045] In an eighth aspect, the present invention also provides the use of the above-mentioned anti-PIK3IP1 nanobody, antibody, nucleic acid, recombinant vector, host cell, recombinant protein or pharmaceutical composition thereof in the preparation of a drug for preventing or treating tumors or autoimmune diseases.

[0046] Among them, in the above-mentioned use, the tumor includes at least one of brain glioma, neuroblastoma, medulloblastoma, meningioma, lung cancer, esophageal cancer, pancreatic cancer, liver cancer, bile duct cancer, kidney cancer, bladder cancer, ureteral cancer, prostate cancer, skin cancer, melanoma, ovarian cancer, endometrial cancer, cervical cancer, soft tissue sarcoma, acute and chronic leukemia, Hodgkin's and non-Hodgkin's lymphoma, gastric cancer or head and neck tumors.

[0047] Among them, in the above-mentioned use, the autoimmune disease includes at least one of lupus erythematosus, ankylosing spondylitis, multiple sclerosis, psoriasis, antiphospholipid antibody syndrome, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, autoimmune hepatitis, arthritis, rheumatoid arthritis, pemphigus, Guillain-Barre syndrome, Crohn's disease, vasculitis or autoimmune diabetes.

[0048] Among them, in the above-mentioned use, the medicine includes the following forms: immune cells, reagents, kits or compositions.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The present invention specifically screened the anti-PIK3IP1 nanobody from the Bactrian camel VHH immune library, which can specifically bind to the PIK3IP1 antigen, and the affinity of the nanobody is 10 -8 ~10 -7 The nano-antibodies of the present invention can be made into drugs for preventing or treating tumors or autoimmune diseases, and have broad application prospects in the fields of tumor prevention and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0052] Figure 1 Schematic diagram of the structure of pcDNA3.1-hFc-His eukaryotic expression vector;

[0053] Figure 2 Indirect ELISA was used to identify the reactivity of recombinant nanobodies with antigens;

[0054] Figure 3 ELISA was used to identify the reactivity of recombinant nanobodies with antigens;

[0055] Figure 4Identification of specific binding of PIK3IP1 nanoantibodies to PIK3IP1+-Hela cells

[0056] Figure 5 The in vivo anti-tumor activity of PIK3IP1 antibody was evaluated using an immune reconstitution mouse xenograft model; Figure A shows the changes in tumor volume after subcutaneous implantation of FaDu cells in NCG mice; Figure B shows the changes in tumor volume in mice after administration; Figure C shows the tumor inhibition rates of the three nanoantibodies. DETAILED DESCRIPTION

[0057] The present invention screened for the first time a nano antibody with high affinity for the PIK3IP1 target. PIK3IP1 is a key factor in the intracellular signal transduction pathway. Its structure and function are relatively complex, and it is extremely difficult to screen for specific nano antibodies. The present invention finally obtains specific nano antibodies through appropriate screening technology and large-scale screening, and at the same time identifies the stability and adaptability of the obtained nano antibodies; finally, the present invention also provides a method for the stable production of the obtained nano antibodies.

[0058] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0059] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc., 1987). Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0060] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0061] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0062] Example 1 Preparation of PIK3IP1 recombinant protein

[0063] The purchased plasmid encoding human pCMV3-untagged-PIK3IP1 was used as a template for PCR amplification. The extracellular domain (ECD) fragment was obtained by agarose gel electrophoresis. The pcDNA3.1 vector was used as a backbone to clone the extracellular domain of PIK3IP1 into a pcDNA3.1 expression vector with an Fc or His tag at the C-terminus. The Fc tag includes human Fc (hFc) and mouse Fc (mFc). Then, 293FT was transiently transfected and FreeStyle TM The cells were cultured in shake flasks in serum-free medium (Life Technologies) for 5-7 days, and the supernatant was collected and purified by Protein A / G or nickel column affinity chromatography and molecular sieve chromatography column to purify the recombinant PIK3IP1 protein carrying Fc or His tag.

[0064] Example 2 Construction, panning and preliminary ELISA screening of phage nanobody library

[0065] (1) Bactrian camel immunization

[0066] Take 2 mg of the expressed and purified PIK3IP1 extracellular domain recombinant protein, add 2 mL of Freund's complete adjuvant, and fully emulsify it using an emulsifier; immunize it subcutaneously at multiple points in the neck of Bactrian camels, and then immunize it once every two weeks (2 mg protein) with Freund's incomplete adjuvant, for a total of 4 immunizations. After the last immunization, collect peripheral blood to test the titer. One week after the impact immunization, collect peripheral blood from Bactrian camels to isolate lymphocytes.

[0067] (2) Construction of Nanobody Library

[0068] When the camel reaches a certain immune titer, it will be subjected to the last impact immunization. After 7 days, 200 mL of peripheral blood will be collected in a blood collection bag for lymphocyte separation. Take out the above-isolated lymphocytes and extract RNA according to the steps of Promega's RNA extraction kit. Immediately after RNA extraction from lymphocytes, reverse transcribe cDNA using the TaKaRa reverse transcription kit, and then amplify the VHH gene using nested PCR; insert the amplified VHH gene into the pMECS phage display vector and electrotransform TG1 competent cells. Take the culture solution after electroporation and dilute it in multiples (10-fold dilution) using LB / Amp-GLU medium, and then take 10 -4 , 10 -5 , 10 -6 , 10 -7 100 μL of the dilution solution was spread on LB / Amp-GLU plates and incubated at 37°C. After 8 h of incubation, the number of colonies at different dilutions was counted to calculate the capacity of the antibody library, which was 6.56×10 9At the same time, 50 colonies with similar morphology and size were randomly selected and cultured for 4-6 hours, and PCR was performed on the bacterial solution to identify the positive rate of the library, that is, the insertion rate of the library reached 97%.

[0069] (3) Screening of Nanobodies Targeting PIK3IP1

[0070] First, the preparation and concentration of auxiliary phages and the rescue of phage libraries were performed. The panning steps of the nanoantibody phage library are as follows: ① Antigen coating: After diluting the PIK3IP1-mFc recombinant protein with PBS, 20 μg per well (the antigen coating amount for the subsequent two rounds of panning was 10 μg / well and 5 μg / well, respectively) was coated in a 96-well ELISA plate and coated overnight at 4°C; ② Washing: After overnight coating, the liquid in the well was discarded and each well was washed 5 times with 200 μL PBST; ③ Blocking: Add 200 μL 5% skimmed milk powder to each well and place it at 37°C for 1 hour; ④ Washing: Discard the liquid in the well and wash each well 3 times with 200 μL PBST; ⑤ Incubation of recombinant phage: Dilute the recombinant phage to 5×10 with 5% skimmed milk powder. 11 pfu / mL, add 100 μL to each well and incubate at room temperature for 2 h; ⑥ Washing: discard the liquid in the wells and wash each well with 200 μL PBST for 15 times. Add 100 μL of freshly prepared 0.1 M triethylamine to each well, let it stand at room temperature for 10 min, aspirate the eluate into a 1.5 mL centrifuge tube and quickly add an equal volume of 1 M Tris-HCl (pH = 7.4) for neutralization; ⑦ Determination of recombinant phage titer: collect the neutralized phage solution and determine the phage titer; infect 2 mL of TG1 in the logarithmic growth phase with the remaining phage solution, let it stand at 37°C for 30 min; add 8 mL of 2×YT / Amp GLU culture medium, and culture at 37°C 220 rpm until the logarithmic growth phase; ⑧ Rescue: add 8 mL of 2×YT ampicillin resistance culture medium, add 4% glucose, and culture at 37°C 220 rpm; ⑨ Phage concentration; ⑩ Repeat the above steps ①-⑨ for the second and third rounds of screening.

[0071] (4) Detection of specific recombinant phage enrichment

[0072] Antigen coating: After diluting the two antigens with PBS, 400 ng per well was coated in a 96-well ELISA plate and coated overnight at 4°C. Washing: After overnight coating, the liquid in the wells was discarded and each well was washed three times with 200 μL PBST. Blocking: 200 μL 5% skim milk powder was added to each well and placed at 37°C for blocking for 1 hour. Washing: The liquid in the wells was discarded and each well was washed three times with 200 μL PBST. Incubation of recombinant phages: Dilute the phage concentrate (1:10), add 100 μL to each well, and incubate at 37°C for 1 hour. Washing: The liquid in the wells was discarded and each well was washed three times with 200 μL PBST. Secondary antibody: HRP-labeled mouse anti-M13 secondary antibody was diluted 1:2000, 100 μL / well, and incubated at 37°C for 1 hour. Washing: The liquid in the wells was discarded and each well was washed three times with 200 μL PBST. Color development: Add 100 μL of TMB color development solution to each well and place at room temperature in the dark for 10-15 minutes. Stop and read: After color development, add 50 μL of 2M H2SO4 to each well to stop the reaction; read the absorbance at 450 nm. Analyze the data.

[0073] (5) Sequencing analysis of specific nanobodies

[0074] Through the ELISA test results, clones with a value greater than 3 times the negative value were determined to be positive, and the bacterial solution was sent for sequencing and comparison analysis, and finally 3 PIK3IP1 nanobody sequences were obtained. The sequences of the nanoantibodies are shown in Table 1 below.

[0075] Table 1 Amino acid sequences of anti-PIK3IP1 nanobodies

[0076]

[0077]

[0078] Example 3 Expression, purification and reactivity of PIK3IP1-specific nanobodies with antigens

[0079] The Nanobody-hFc fusion protein expression platform was constructed based on the pcDNA3.1 eukaryotic expression vector, and the PIK3IP1-specific nanobody sequence was cloned into the pcDNA3.1-hFc-His vector ( Figure 1 ). The constructed expression vector was expressed and purified using the HEK293T eukaryotic protein expression system. SDS-PAGE results showed that a Nanobody-hFc fusion protein of high purity was obtained after affinity chromatography purification, and the band size was about 55 kDa.

[0080] To identify the reactivity of the recombinant nanobody-hFc fusion protein with the antigen, 200 ng / well of PIK3IP1 recombinant protein was coated on the ELISA plate in advance, the plate was blocked after overnight at 4°C, and different amounts of recombinant nanobody (dilution: 10 -5 ~10 2 μg / mL), added secondary antibody for washing, color development, terminated reaction, and measured the optical density (OD450) at 450nm using a microplate reader, and determined the binding capacity using a four-parameter nonlinear regression curve fitting. The results showed that all three recombinant nanobodies of PIK3IP1 could bind to the recombinant PIK3IP1 protein with high specificity ( Figure 2 ).

[0081] In order to further identify high-affinity nanobodies, PIK3IP1 was quantitatively diluted using the ELISA method and then coated on an ELISA plate. High-affinity nanobodies were identified by adding PIK3IP1 nanobodies. The experiment showed that all three nanobodies obtained from the preliminary screening showed high affinity for the PIK3IP1 antigen ( Figure 3 ).

[0082] Example 4 Flow cytometry detection of recombinant nanobodies and PIK3IP1 + -HeLa cell binding

[0083] First, Hela cells were infected with a lentivirus containing the full-length PIK3IP1 gene, and high-purity PIK3IP1 cells that stably expressed the PIK3IP1 gene were obtained by flow cytometry. + -Hela cells, and then the recombinant nanobody prepared in Example 3 was combined with PIK3IP1 + -Hela cells were incubated at 37°C for 40 min, washed 3 times with PBS, and then incubated with APC@goat anti-human secondary antibody. After washing 3 times with PBS, the cells were detected by flow cytometry. The results are shown in Figure 4 As shown, the results showed that recombinant nanoantibodies Nb10, Nb23 and Nb45 could bind well to the above cells.

[0084] Example 5 PIK3IP1 Nanobody Affinity Determination

[0085] The affinity of the three nanobodies against PIK3IP1 was verified by surface plasmon resonance, and their binding kinetic constants (Kd) were determined. TM8K instrument, the anti-mouse IgG antibody was fixed on the surface of CM5 chip using the coupling buffer in the amino coupling kit, and then PIK3IP1(ECD)-mFc was captured on the CM5 chip in a 2-fold serial dilution; then the purified PIK3IP1 nanobody was allowed to flow over the surface of the chip, and the machine read Ka(1 / Ms), kd(1 / s), and KD(M), that is, the affinity of the recombinant nanobody was measured. The affinity measurement results showed that the three candidate humanized nanobodies of PIK3IP1 were able to specifically bind to the PIK3IP1(ECD)-mFc protein, with an affinity of 10 -8 ~10 -7 The values ​​between the orders of magnitude of M are all high-affinity antibodies. The kinetic characteristics show that the three humanized nanoantibodies all have relatively slow dissociation rates. The specific data of the detection are shown in Table 2.

[0086] Table 2 Summary of affinity data of nanobodies

[0087] Antibody Ka(1 / Ms) kd(1 / s) KD(M) Nb10 <![CDATA[1.50×10 2 ]]> <![CDATA[1.10×10 -4 ]]> <![CDATA[7.34×10 -7 ]]> Nb23 <![CDATA[1.05×10 4 ]]> <![CDATA[2.60×10 -4 ]]> <![CDATA[2.49×10 -8 ]]> Nb45 <![CDATA[5.86×10 3 ]]> <![CDATA[8.78×10 -4 ]]> <![CDATA[1.50×10 -7 ]]>

[0088] Example 6 Evaluation of the in vivo anti-tumor activity of PIK3IP1 antibody using an immune reconstitution mouse xenograft model

[0089] This example uses an immune reconstitution mouse xenograft model to evaluate the in vivo anti-tumor activity of PIK3IP1 antibody. Before constructing a pharyngeal squamous cell carcinoma immune system humanized mouse model, 2×10 NCG cells were subcutaneously implanted in severe combined immunodeficient mice. 6 FaDu cells and their growth was monitored regularly (see Figure 5 A) The results showed that the tumor volume reached 100mm in the second week after the implantation of FaDu cells. 3 Left and right, and Hu - PBMC mouse model (humanized-peripheral blood mononuclear cells, Hu - The reconstruction time of PBMC is generally about 3 weeks. Therefore, in the subsequent mouse model construction of this study, PBMC and FaDu cells were inoculated into NCG mice at similar time points. In the third week after PBMC implantation, the tumor volume reached 100-200mm 3 Flow cytometry was performed to evaluate the effect of human immune system reconstruction. After obtaining fresh human PBMC, they were resuspended in PBS and placed on ice, and injected into NCG mice via the tail vein. The injection dose for each mouse was 1×10 7 , construct a mouse model with humanized immune system. After about 14 days, the tumor grows to 150mm 3Afterwards, mice with uniform tumor volumes were randomly divided into 5 groups, with 5 mice in each group. A blank control group was set up with an equal volume of PBS as the drug, and an irrelevant antibody was set up as the Control group. The antibody was administered by tail vein injection, 30 μg / mouse, once every 5 days, for a total of 4 times. The mice were weighed and the tumor size was measured every 3 days. The average volume of the transplanted tumor was calculated according to the formula V=1 / 2(L×W2), where L represents the length of the tumor and W represents the width of the tumor. When the mouse tumor volume reaches 1500mm 3 Or if the tumor surface showed obvious ulceration, the mouse was killed and the animal experiment was terminated. The tumor inhibition rate of PIK3IP1 antibody was calculated based on the tumor volume of the experimental group and the control group mice. The calculation formula was: tumor inhibition rate (%) = [1-(tumor volume of the experimental group / tumor volume of the control group)] × 100%. The experimental results are as follows Figure 5 B and 5C, compared with the control group, the tumor volume of the group given the three PIK3IP1 antibodies was significantly smaller than that of the control group (PBS and Control), and the three PIK3IP1 antibodies had a significant inhibitory effect on the growth of FaDu (human pharyngeal squamous cell carcinoma cell) cells. The data were analyzed using one-way ANOVA analysis, ns indicates no statistical difference, **** indicates P < 0.0001.

[0090] The above experiments collectively illustrate that the anti-PIK3IP1 nanoantibodies screened by the present invention can specifically bind to the PIK3IP1 target with high affinity, and can be widely used in the prevention and treatment of tumors or autoimmune diseases, providing a new option for the prevention or treatment of tumors or autoimmune diseases.

Claims

1. An anti-PIK3IP1 nanobody, characterized in that: The heavy chain variable region of the nanobody comprises CDR1, CDR2 and CDR3, and the amino acid sequences of CDR1, CDR2 and CDR3 are any one of SEQ ID NOs: 1 to 3, SEQ ID NOs: 6 to 8 or SEQ ID NOs: 11 to 13, respectively.

2. The anti-PIK3IP1 nanobody according to claim 1, characterized in that The nanobody also includes a framework region; the structure of the nanobody is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4; Preferably, the nanobody is at least one of a monovalent nanobody, a multivalent nanobody, a multispecific antibody or a fusion nanobody; Preferably, when the Nanobody is a monovalent Nanobody, the amino acid sequence of the heavy chain variable region is as shown in any one of SEQ ID NO:4, SEQ ID NO:9 or SEQ ID NO:

14.

3. An antibody, characterized in that: A nanobody comprising the anti-PIK3IP1 according to any one of claims 1 or 2 or any heavy chain variable region of the nanobody comprising the anti-PIK3IP1 according to claim 1 or 2.

4. The antibody according to claim 3, characterized in that: The antibody is any one of a full-length antibody, a heavy chain antibody, a chimeric antibody, a multispecific antibody, a mouse antibody, a humanized antibody or an antigen-binding fragment; preferably, the antigen-binding fragment comprises any one selected from the group consisting of F(ab')2, Fab', Fab, Fv or scFv of an antibody.

5. A recombinant vector comprising a nucleic acid encoding the antibody according to any one of claims 1 to 4; preferably, the recombinant vector is a plasmid or a virus; the virus is an adenovirus, an adeno-associated virus, a retrovirus, a lentivirus or an oncolytic virus. A host cell comprising the recombinant vector according to claim 5.

7. A recombinant protein or a pharmaceutical composition thereof comprising the anti-PIK3IP1 Nanobody according to claim 1 or 2 or the antibody according to claim 3 or 4.

8. The pharmaceutical composition according to claim 7, characterized in that: It also contains an active agent; the active agent includes at least one of an immune checkpoint-related preparation, an antibody-drug conjugate, a bispecific antibody, a multispecific antibody, a radionuclide or a kinase inhibitor.

9. Use of the anti-PIK3IP1 nanobody according to claim 1 or 2, the antibody according to claim 3 or 4, the recombinant vector according to claim 5, the host cell according to claim 6, the recombinant protein according to claim 7 or a pharmaceutical composition thereof in the preparation of a medicament for preventing or treating tumors or autoimmune diseases.

10. The use according to claim 9, characterized in that: The tumor includes at least one of brain glioma, neuroblastoma, medulloblastoma, meningioma, lung cancer, esophageal cancer, pancreatic cancer, liver cancer, bile duct cancer, kidney cancer, bladder cancer, ureteral cancer, prostate cancer, skin cancer, melanoma, ovarian cancer, endometrial cancer, cervical cancer, soft tissue sarcoma, acute and chronic leukemia, Hodgkin's and non-Hodgkin's lymphoma, gastric cancer or head and neck tumors; The autoimmune disease includes at least one of lupus erythematosus, ankylosing spondylitis, multiple sclerosis, psoriasis, antiphospholipid antibody syndrome, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, autoimmune hepatitis, arthritis, rheumatoid arthritis, pemphigus, Guillain-Barre syndrome, Crohn's disease, vasculitis or autoimmune diabetes; The medicine includes the following forms: immune cells, reagents, kits or compositions.

Images