Aspergillus oryzae and application thereof

Abstract

The invention relates to the field of microorganisms, and discloses an Aspergillus oryzae strain and application thereof.The Aspergillus oryzae can produce protease, aminopeptidase, glutaminase, cellulase, amylase and pectinase at high yield, and when the Aspergillus oryzae is applied to soy sauce brewing, the utilization rate of raw materials can be increased, the content of amino acid in soy sauce can be increased, and the flavor of the soy sauce can be increased.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to Aspergillus oryzae and applications thereof. Background Art

[0002] As one of the core condiments on people's tables, soy sauce is one of the most consumed condiments. The soy sauce market has maintained a certain growth trend in recent years. According to my country's national standards for soy sauce brewing (GB / T 18186-2000 and SB / T 10173-1993), the production process of soy sauce can be clearly divided into two categories: low-salt solid-state brewing method and high-salt dilute brewing method. Both methods mainly use soybeans or soybean meal as the core raw materials, supplemented with flour, wheat, bran and other materials. After careful steaming, they are fermented and brewed using a variety of microorganisms such as Aspergillus oryzae, yeast and lactic acid bacteria.

[0003] In addition to traditional soybeans, the protein sources for brewing soy sauce also widely include a variety of plant materials such as broad beans, peas, bean cakes, peanut cakes, sunflower seed cakes, rapeseed cakes, sesame cakes, coconut cakes, and molasses. Among them, peanut meal, as a byproduct of peanut oil extraction, has a protein content of nearly 50%, and is rich in amino acid species and balanced in proportion. Only the methionine (Met) content is slightly lower, and the contents of other amino acids are close to or meet the standards of the Food and Agriculture Organization of the United Nations (FAO). Peanut meal protein is rich in acidic, hydrophobic and aromatic amino acids. At the same time, it also contains a variety of minerals, flavonoids, tannins, phenolic compounds, and triterpenoid or steroid active substances. These characteristics make peanut meal one of the ideal raw materials for brewing high-quality soy sauce. CN202310030142.1 discloses a method for preparing peanut meal soy sauce and its application, which uses steam explosion technology to pre-treat peanut meal, increase the extraction rate of protein, and improve the total nitrogen utilization rate of peanut protein and the antioxidant activity of soy sauce. There are few existing technologies for brewing soy sauce using peanut meal, and they are mainly focused on optimizing the pre-treatment process of raw materials. Flaxseed meal contains 37% protein, which is mainly composed of high-quality vegetable protein such as albumin and globulin; 8% fat, 0.95% α-linolenic acid; 1% linoleic acid, and 1.2% lignans. The linolenic acid contained in it is not as high as that in other commonly used vegetable oils. It is a prerequisite for ω-3 highly unsaturated fatty acids that cannot be synthesized by the human body but are necessary for life activities. CN201910699444.1 discloses an improved method for brewing functional soy sauce and paste with flaxseed cake. It adopts extrusion puffing treatment and enzymolysis technology to produce functional flaxseed soy sauce with delicious taste and rich aroma. The product contains amino acid nitrogen ≥0.8g / 100ml, total nitrogen ≥1.5g / 100ml, active calcium content ≥0.57g / 100ml, linolenic acid 0.08-0.13mg / 100g, lignans 0.2-0.28mg / 100g, and contains trace linoleic acid. However, it also focuses on the optimization of the pretreatment process of raw materials. Rapeseed meal is one of the main by-products after rapeseed oil extraction, which is divided into ordinary rapeseed meal and double-low rapeseed meal. Rapeseed meal contains rapeseed protein, rapeseed polyphenols, phytic acid, rapeseed polysaccharides and other ingredients. These ingredients have high utilization value. Rapeseed meal contains high levels of sulfur-containing amino acids such as methionine, cystine and histidine, and is rich in selenium and phosphorus, but has a slightly lower protein content and a higher crude fiber content. It also contains some anti-nutritional substances such as glucosinolates, tannins, phytic acid, sinapinic acid, etc. It has been reported that double-low rapeseed meal is used as a material to extract oil through a water enzymatic method and ferment to prepare soy sauce. CN201210443981.8 discloses a method of treating rapeseed meal with a composite microbial fermentation combined with an enzyme preparation, which has a higher protein content. At present, there are few reports on research related to making soy sauce by fermenting meal with natural microorganisms alone. Summary of the invention

[0004] The purpose of the invention is to overcome the problems existing in the prior art and provide an Aspergillus oryzae strain and application thereof.

[0005] In order to achieve the above object, the present invention provides a strain of Aspergillus oryzae in a first aspect, wherein the Aspergillus oryzae has a deposit number of CGMCC No.41729.

[0006] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising Aspergillus oryzae and koji material as described above.

[0007] A third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: inoculating the Aspergillus oryzae described above into koji material for culturing.

[0008] A fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method comprises: preparing soy sauce koji according to the above method; mixing the soy sauce koji with salt water for fermentation.

[0009] The fifth aspect of the present invention provides use of the Aspergillus oryzae or the composition as described above in preparing condiments.

[0010] Through the above technical scheme, the Aspergillus oryzae can produce high levels of protease, aminopeptidase, glutaminase, cellulase, amylase and pectinase. The Aspergillus oryzae is applied to soy sauce brewing, which can improve the utilization rate of raw materials, increase the amino acid content in the soy sauce, and enhance the flavor of the soy sauce.

[0011] According to several preferred embodiments of the present invention, the koji material contains flaxseed meal, and the obtained soy sauce koji has higher pectinase and saccharifying enzyme activities; the koji material contains rapeseed meal, and the obtained soy sauce koji has higher saccharifying enzyme activities; the koji material contains peanut meal, and the obtained soy sauce koji has higher protease and saccharifying enzyme activities. Based on this, the koji material formula can be selected as needed to obtain soy sauce koji with different enzyme activities.

[0012] Biological Deposit The strain provided by the present invention is classified and named as Aspergillus oryzae Aspergillus oryzae , was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (abbreviated as CGMCC) on December 23, 2024. Its deposit number is CGMCC No.41729, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The colony morphology of Aspergillus oryzae CCNH232 of the present invention on malt juice medium; Figure 2 The present invention is a strain morphology of Aspergillus oryzae CCNH232 under an optical microscope. DETAILED DESCRIPTION

[0014] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0015] The first aspect of the present invention provides an Aspergillus oryzae strain, the Aspergillus oryzae has a deposit number of CGMCC No. 41729, and is numbered CCNH232 in the present invention.

[0016] The Aspergillus oryzae of the present invention is cultured in a malt juice medium for 72 hours, and the colonies are full of the dish, the colonies are light yellow-green, round, the mycelium grows vigorously, the texture is loose, and the initial white and yellow color, and then turns to yellow-brown to light green-brown. Figure 1 As shown. The conidia of Aspergillus oryzae are spherical or nearly spherical, yellow-green, with a diameter of 4.5-7 μm, and some large ones can reach 8-10 μm. The conidiophore is about 2 mm long, and the top capsule is nearly spherical or flask-shaped (40-50 μm). The strain morphology of Aspergillus oryzae described in the present invention under an optical microscope is as follows Figure 2 shown.

[0017] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising Aspergillus oryzae and koji material as described above.

[0018] According to the present invention, preferably, the content of Aspergillus oryzae is 0.5-1 wt % of the koji material in terms of spore content.

[0019] Furthermore, the koji material is a mixture of meal raw materials, bran and water.

[0020] A third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: inoculating the Aspergillus oryzae described above into koji material for culturing.

[0021] According to the present invention, preferably, the culture conditions include: a culture temperature of 28-32° C., a culture environment humidity of 80-90%, and a culture time of 48-96 h.

[0022] Furthermore, the culture conditions include: a culture temperature of 28-30°C, a culture environment humidity of 85-90%, and a culture time of 48-72h.

[0023] Furthermore, the koji material is a mixture of meal raw materials, bran and water.

[0024] According to the present invention, preferably, the mass ratio of meal raw material, water and bran is 2-4:1-3:1.

[0025] Furthermore, the mass ratio of meal raw materials, water and bran is 3-4:2-3:1.

[0026] According to the present invention, the meal raw material may be a byproduct remaining after common seed oils and fats are extracted in the art. Preferably, the meal raw material is at least one of flax meal, rapeseed meal and peanut meal.

[0027] A fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method comprises: preparing soy sauce koji according to the above method; mixing the soy sauce koji with salt water for fermentation.

[0028] According to the present invention, the method of mixing the soy sauce koji and the brine can refer to the conventional mixing method in the art, as long as the purpose of the present invention can be achieved.

[0029] According to the present invention, preferably, the mass ratio of the soy sauce koji to the brine is 1:1-2.

[0030] Furthermore, the mass ratio of the soy sauce koji to the brine is 1:1-1.5.

[0031] According to the present invention, preferably, the concentration of the brine is 10-17 wt %.

[0032] Further, the concentration of the brine is 10-13 wt %.

[0033] According to the present invention, the salt water refers to a sodium chloride aqueous solution.

[0034] According to the present invention, preferably, the fermentation conditions include: a fermentation temperature of 40-50° C. and a fermentation time of 15-25 days.

[0035] Furthermore, the fermentation conditions include: a fermentation temperature of 43-48° C. and a fermentation time of 18-22 days.

[0036] The fifth aspect of the present invention provides use of the Aspergillus oryzae or the composition as described above in preparing condiments.

[0037] According to the present invention, the condiments include but are not limited to soy sauce, soybean paste, bean paste and fermented black beans.

[0038] According to the present invention, the method for preparing the seasoning can be a conventional method in the art, and those skilled in the art can select one according to their needs.

[0039] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention, and are not intended to limit the present invention.

[0040] Unless otherwise specified, the reagents and materials used in the following examples were purchased from regular chemical reagent suppliers and were of analytical grade.

[0041] In the following embodiments: The definition of protease activity is: 1 unit of enzyme activity is the amount of 1 nmol of tyrosine produced by the hydrolysis of casein per gram of soy sauce koji per minute at 30°C. Protease hydrolyzes casein to produce tyrosine; tyrosine reduces phosphomolybdic acid to produce tungsten blue; tungsten blue has a characteristic absorption peak at 680nm. The protease activity is obtained by measuring the increase rate of absorbance at 680nm under alkaline (pH=10.5), acidic (pH=3.0), and neutral (pH=7.5) conditions and adding the results.

[0042] The definition of amylase activity is: the amount of enzyme required to catalyze the α-1,4-glycosidic bond in starch to produce 1 mg of reducing sugar per gram of soy sauce koji per minute at 4°C and pH 5.2 is defined as one unit of enzyme activity. Reducing sugar reduces 3,5-dinitrosalicylic acid to produce a brown-red substance. α-amylase is not acid-resistant, and β-amylase is not heat-resistant. Based on the above characteristics, the enzyme activity of another amylase can be measured after passivation at 70°C for 15 minutes. The absorbance at 540nm is detected by an enzyme reader or a visible light spectrophotometer, and quantification is performed by the standard curve method.

[0043] The definition of saccharifying enzyme activity is: the amount of enzyme required to decompose soluble starch per gram of soy sauce koji to produce 1 mg of glucose per minute at 40°C and pH 4.6 is one unit of enzyme activity. Saccharifying enzyme hydrolyzes soluble starch to produce glucose, and reacts with 3,5-dinitrosalicylic acid to produce a reddish-brown compound with maximum light absorption at 540nm. Within a certain range, the color depth of the reaction solution is proportional to the amount of glucose, and is quantified by the standard curve method. The definition of lipase activity is: one unit of enzyme activity is the amount of 1 μmol of fatty acid produced per minute by hydrolyzing olive oil per gram of soy sauce koji at 37°C and pH 7.5. Lipase catalyzes the hydrolysis of oil esters into fatty acids, and the rate of fatty acid production can be measured by the copper soap method to calculate the lipase activity.

[0044] The cellulase activity is defined as: the amount of enzyme required to catalyze sodium carboxymethyl cellulose to produce 1 μg of reducing sugar per gram of soy sauce koji per minute at 37°C and pH 5.5 is defined as one unit of enzyme activity. The content of reducing sugar produced by the degradation of sodium carboxymethyl cellulose by cellulase is determined by anthrone colorimetry. The absorbance at 620 nm is detected by an ELISA reader or a visible light spectrophotometer, and quantification is performed by the standard curve method.

[0045] The activity of glutaminase is defined as: one unit of enzyme activity is defined as the amount of glutamine produced by one gram of soy sauce koji per minute at 37°C and pH 7.0. Glutamine is hydrolyzed into L-glutamic acid and ammonia by glutaminase, and the rate of ammonia increase is detected by Nessler's reagent. The absorbance at 420 nm is detected by an ELISA reader or a visible spectrophotometer, and quantification is performed by the standard curve method.

[0046] The activity of pectinase is defined as: under the conditions of 50°C and pH 3.5, one unit of enzyme activity is the amount of galacturonic acid produced by decomposing pectin per gram of soy sauce koji per hour. Pectinase hydrolyzes pectin to produce galacturonic acid, which has a reducing aldehyde group and reacts with DNS reagent to produce a reddish-brown substance. The absorbance at 540 nm is detected by an ELISA reader or a visible light spectrophotometer, and quantification is performed by the standard curve method.

[0047] Tannase activity is defined as: the amount of enzyme required to hydrolyze 0.01µmol of substrate propyl gallate per gram of soy sauce koji per minute at 40°C and pH 5.0 is defined as one unit of enzyme activity. Antioxidant propyl gallate is used as the substrate for tannase enzymatic reaction, and the optical density change before and after the substrate reaction is measured at 270nn, and quantification is performed by the standard curve method.

[0048] Aminopeptidase activity uses the double antibody sandwich method to determine the level of aminopeptidase in the sample. The microplate is coated with purified aminopeptidase antibodies to make solid-phase antibodies. Aminopeptidase is added to the microwells coated with monoclonal antibodies in sequence, and then combined with HRP-labeled aminopeptidase antibodies to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB is added for color development. TMB is converted into blue under the catalysis of HRP enzyme, and converted into the final yellow under the action of acid. The depth of color is positively correlated with the aminopeptidase in the sample. The absorbance is measured at a wavelength of 450nm using an enzyme reader, and the aminopeptidase activity in the sample is calculated using a standard curve.

[0049] The test methods for amino acid nitrogen and total nitrogen refer to GBT18186-2000.

[0050] The test methods for total acid and pH refer to GB 12456-2021.

[0051] The test method for glutamic acid content refers to GB 5009.124-2016.

[0052] The culture medium formula used in the following examples is as follows: Malt extract medium: 20g malt powder, 10g peptone, 2g glucose, 1g dipotassium hydrogen phosphate, 5g sodium chloride, 1L distilled water.

[0053] PDA medium: 200 g potato, 20 g glucose, 15 g agar, 1 L distilled water.

[0054] The reference strain Huniang 3.042 (Aspergillus oryzae) was purchased from the Chinese Institute of Food Fermentation Industries, and the collection number of the strain is CICC 2339.

[0055] Example 1 This example is used to illustrate the screening and identification of Aspergillus oryzae CCNH232 described in the present invention.

[0056] (1) Screening of strains: The Aspergillus oryzae described in the present invention was isolated from the liquor brewing process. The dilution solution of the crushed Daqu was spread on PDA solid culture medium by gradient dilution method and cultured at 30°C for 5 days. After the colonies grew, colonies with phenotypic differences in morphology, color and size were picked and streaked on the plate to obtain single colonies of multiple strains. A single strain was obtained by purification and numbered CCNH232.

[0057] (2) Morphological identification: After 72 hours of culture in malt extract medium, the colonies fill the dish. They are light yellow-green in color, round in shape, with vigorous mycelium growth and loose texture. They are initially white or yellow, then turn yellow-brown to light green-brown. Figure 1 As shown in Figure 1. The conidia of Aspergillus oryzae are spherical or nearly spherical, yellow-green, with a diameter of 4.5-7μm, and some large ones can reach 8-10μm. The conidiophores are about 2mm long, and the top capsule is nearly spherical or flask-shaped (40-50μm), such as Figure 2 shown.

[0058] (3) Molecular identification: The ITS sequence of the above single strain was sequenced, and its ITS sequence is shown in SEQ ID NO.1.

[0059] SEQ ID NO.1: CCTTCCGGTAAGGTAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAGCCGGAAGA。

[0060] The β-tubulin gene sequence of the above single strain was sequenced, and its β-tubulin gene sequence is shown in SEQ ID NO.2.

[0061] SEQ ID NO.2: .

[0062] The obtained ITS sequences were compared with the NCBI database, and strain CCNH232 had the highest homology with Aspergillus oryzae (GenBank: MN010539.1), with a sequence identity of 99.98%.

[0063] The obtained β-tubulin sequence was compared with the NCBI database, and the strain CCNH232 had the highest homology with Aspergillus oryzae (GenBank: HQ285487.1), with a sequence identity of 100%.

[0064] Based on the above morphological and molecular identification results, it was finally determined that strain CCNH232 belonged to Aspergillus oryzae ( Aspergillus oryzae ), the Aspergillus oryzae CCNH232 was sent to a depository institution for preservation, and the deposit number was CGMCC No.41729.

[0065] Example 2 This example is used to illustrate the preparation process of soy sauce koji and the enzyme activity in soy sauce koji.

[0066] (1) Crush the large block and cake-like meal materials (Table 1) to a particle size of 2 mm and a powder amount of 10 wt%. Mix the meal materials with bran (mass ratio of 7:3) and add distilled water to reach a water content of 45 wt%. Steam the resulting koji material at 120 °C for 20 min and cool to about 30 °C for use.

[0067] (2) The strain was purified and cultured using PDA medium. After culturing at 30°C for 72 hours, mature Aspergillus oryzae CCNH232 spores were collected and inoculated into the koji material with 0.06 wt% of the spores. The koji material was incubated in a constant temperature and humidity incubator at 30°C and 90% humidity for 72 hours in the dark to obtain Aspergillus oryzae CCNH232 soy sauce koji. According to the same method, spores of Shanghai Niang 3.042 were inoculated into the koji material to obtain Shanghai Niang 3.042 soy sauce koji as a reference. The enzyme activities of protease, aminopeptidase, amylase, saccharifying enzyme, lipase, glutaminase, cellulase, tannase and pectinase in the soy sauce koji were measured.

[0068] (3) The results are shown in Table 1. The parameters of the soy sauce koji of Aspergillus oryzae CCNH232 were converted into corresponding ratios, with the various indicators of Shanghai Niang 3.042 as the standard and expressed as 1.00. The enzyme activities of protease, aminopeptidase, amylase, saccharifying enzyme, lipase, glutaminase, cellulase, tannase and pectinase in the soy sauce koji of Aspergillus oryzae CCNH232 were significantly higher than those in the soy sauce koji of Shanghai Niang 3.042, indicating that the comprehensive enzyme activity of Aspergillus oryzae CCNH232 was stronger.

[0069] Table 1

[0070] Example 3 This example is used to illustrate the application of Aspergillus oryzae CCNH232 in salt-reduced fermented soy sauce.

[0071] (1) Aspergillus oryzae CCNH232 and Shanghai Niang 3.042 as a reference were made into koji according to the method of Example 2 to obtain finished koji. The finished koji and 11wt% brine were mixed evenly in a mass ratio of 1:1.3, and fermented at 45°C for 20 days to obtain sauce mash. During the fermentation, water was added and stirred once every 48 hours to keep the moisture content of the sauce mash constant. After the fermentation was completed, 11wt% brine with a mass of 70wt% of the finished koji mass was added to the sauce mash, and the oil was poured twice to obtain crude oil, and the amino acid nitrogen, total acid, pH, total nitrogen, and glutamic acid content in the crude oil were determined.

[0072] (2) The amino acid nitrogen content of crude soy sauce from peanut meal prepared by Aspergillus oryzae CCNH232 was 0.80 g / 100 mL, and the total nitrogen content was 1.64 g / 100 mL; the amino acid nitrogen content of crude soy sauce from rapeseed meal was 0.78 g / 100 mL, and the total nitrogen content was 1.44 g / 100 mL; the amino acid nitrogen content of crude soy sauce from flax cake meal was 0.79 g / 100 mL, and the total nitrogen content was 1.64 g / 100 mL.

[0073] (3) Taking the parameters of Shanghai Brewing 3.042 crude oil as the standard and expressing them as 1.00, the parameters of Aspergillus oryzae CCNH232 crude oil were converted into corresponding ratios, and the test results are shown in Table 2. The contents of amino acid nitrogen, total nitrogen and glutamic acid in Aspergillus oryzae CCNH232 crude oil were significantly higher than those in the crude oil made from Shanghai Brewing 3.042, and both reached the first-class level.

[0074] Table 2

[0075] Example 4 This example is used to illustrate the sensory evaluation of soy sauce fermented by Aspergillus oryzae CCNH232.

[0076] The color, flavor and state of Shanghai Brewing 3.042 fermented soy sauce and Aspergillus oryzae CCNH232 fermented soy sauce (prepared according to the method of Example 3) were blindly evaluated. The test results are shown in Table 3.

[0077] Table 3

[0078] As shown in Table 3, compared with the soy sauce fermented by Shanghai Brewing 3.042, the soy sauce fermented by Aspergillus oryzae CCNH232 has a stronger salty and fresh taste and a weaker astringency, which is related to the relatively higher glutamate content. In summary, compared with Shanghai Brewing 3.042, Aspergillus oryzae CCNH232 is more suitable for low-salt solid soy sauce fermentation.

[0079] Example 5 The present invention is used to illustrate the application of Aspergillus oryzae CCNH232 in condiments.

[0080] According to the same method as in Example 2, Aspergillus oryzae CCNH232 was used to make koji to obtain finished koji, and the finished koji and 11wt% saline were mixed evenly in a mass ratio of 1:1.3, and fermented at 45°C for 20 days to obtain sauce mash, during which water was replenished and stirred once every 48 hours to keep the moisture content of the sauce mash constant. Add saline with a salt concentration of 20wt% twice the weight of the sauce mash, and after salting for 22 days, the brine was separated, and the solid sauce mash was salted and pressed on a plate, and matured at room temperature to obtain the sauce mash. After the sauce mash was blended and sterilized, the soybean paste was obtained. The amino acid nitrogen content of peanut meal paste prepared by Aspergillus oryzae CCNH232 is 0.87g / 100g, and the total nitrogen content is 1.66g / 100g; the amino acid nitrogen content of flax cake meal paste is 0.83g / 100g, and the total nitrogen content is 1.64g / 100g; the amino acid nitrogen content of rapeseed meal paste is 0.84g / 100g, and the total nitrogen content is 1.65g / 100g.

[0081] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A strain of Aspergillus oryzae ( Aspergillus oryzae ), characterized in that, The deposit number of the Aspergillus oryzae is CGMCC No.41729.

2. A composition for preparing soy sauce koji, characterized in that: The composition comprises the Aspergillus oryzae described in claim 1 and koji material.

3. The composition according to claim 2, wherein The content of Aspergillus oryzae is 0.5-1wt% of the koji material in terms of spore content; And / or, the koji material is a mixture of meal raw materials, bran and water.

4. A method for preparing soy sauce koji, characterized in that: The preparation method comprises: inoculating the Aspergillus oryzae described in claim 1 into koji material for culturing.

5. The preparation method according to claim 4, wherein The culture conditions include: a culture temperature of 28-32°C, a culture humidity of 80-90%, and a culture time of 48-96h; And / or, the koji material is a mixture of meal raw materials, bran and water.

6. The preparation method according to claim 5, wherein: The mass ratio of meal raw materials, water and bran is 2-4:1-3:

1.

7. A method for brewing soy sauce, characterized in that: The method comprises: preparing soy sauce koji according to the method according to any one of claims 4 to 6; mixing the soy sauce koji with salt water for fermentation.

8. The brewing method according to claim 7, wherein: The mass ratio of the soy sauce koji to the brine is 1:1-2; And / or, the concentration of the brine is 10-17 wt %.

9. The brewing method according to claim 7 or 8, wherein: The fermentation conditions include: a fermentation temperature of 40-50° C. and a fermentation time of 15-25 days.

10. Use of the Aspergillus oryzae according to claim 1 or the composition according to claim 2 or 3 in preparing condiments.

Images