Porcine muscle stem cell line capable of being cultured in vitro for long time and application of porcine muscle stem cell line

Abstract

The invention discloses a porcine muscle stem cell line capable of being cultured in vitro for a long time and application of the porcine muscle stem cell line, and belongs to the technical field of stem cells and cell culture meat. The porcine muscle stem cell line is prepared by the following steps: performing CDKN2A gene knockout on porcine muscle stem cells by using a CRISPR / Cas9 gene editing technology, performing monoclonal screening and genotype identification to obtain a cell strain with successful CDKN2A knockout, and then performing carrier-free and serum-free suspension culture domestication on the cell strain. And a carrier-free and serum-free porcine muscle stem cell line capable of being subjected to in-vitro long-term suspension culture is obtained. Verification shows that the CDKN2A knockout porcine muscle stem cell line subjected to carrier-free and serum-free suspension culture domestication not only can be subjected to carrier-free and serum-free suspension culture in a shake flask for a long time, but also can maintain a good differentiation characteristic. The porcine muscle stem cell line which can be cultured on a large scale, is derived from edible animals and can be cultured in vitro for a long time is created, and excellent cell resources are provided for commercial production of cultured meat.

Description

Technical Field

[0001] The present application belongs to the technical field of stem cells and cell cultured meat, and specifically relates to a pig muscle stem cell line that can be cultured in vitro for a long time and its application. Background Art

[0002] Cultured meat, also known as cell cultured meat, cultivated meat, etc., is meat obtained by culturing edible animal cells in vitro based on the growth and repair mechanism of animal muscles using cell culture engineering and tissue engineering technologies. It does not require animal breeding and directly uses cell factories to produce meat. Compared with traditional breeding methods, cell cultured meat is a new type of meat production method that is efficient, environmentally friendly and sustainable, and can meet the future human meat supply.

[0003] The seed cells required for the production of cultured meat are mostly derived from edible animal cells. The initially isolated seed cells are primary cells. Due to the influence of the Hayflick limit, the proliferation ability of primary cells will gradually decrease during the passage process, and the relevant functions of the cells themselves will also be lost. Although some cells are derived from stem cells isolated from native tissues, such as embryonic stem cells, muscle stem cells, mesenchymal stem cells, etc., these cells have relatively strong proliferation capabilities, but the accumulation of cell mutations or the influence of cell aging-related factors during the proliferation process will eventually lead to cell aging and stop growth. In order to obtain cell lines that can be cultured for a long time or continuously in vitro, cell lines that can be cultured for a long time in vitro can be obtained by spontaneous immortalization, physical and chemical treatment, or genetic modification. However, as cells proliferate in vitro for a long time, they will lose related physiological functions such as differentiation, such as the myogenic differentiation ability of muscle stem cells.

[0004] In addition, the traditional method of culturing with serum under adherent conditions is more complicated to operate, has limited cell survival space, and cannot be cultured on a large scale. The use of serum also brings many uncertain risks, including high cost, unclear chemical composition, unstable batches, pathogens, and ethical issues, which makes industrial-scale production of cultured meat difficult. With the development of animal cell culture technology, serum-free culture systems have been widely used in the field of antibody production due to their advantages such as clear and definite culture medium components, easy separation, and safer and more reliable quality control. In the production process of cell-cultured meat, the use of serum-free culture medium and the use of bioreactor culture systems for the amplification of food-derived cells can not only save costs, but also avoid problems caused by the animal source of serum and batch variability.

[0005] Therefore, there is an urgent need to domesticate muscle stem cells into a stem cell line that is adapted to carrier-free and serum-free suspension growth. This cell line can not only scale up suspension culture to expand a sufficient number of muscle stem cells, but also maintain its differentiation potential after suspension domestication and attach and differentiate on 3D scaffolds, thereby promoting the commercial production of cell-cultured meat. Summary of the invention

[0006] 1. Purpose of the Invention

[0007] The purpose of this application is to provide a porcine muscle stem cell cell line that can be cultured in vitro for a long time and its application. The porcine muscle stem cell cell line is an excellent cell line with sustained proliferation ability and differentiation stemness screened out after knocking out the CDKN2A gene using CRISPR-Cas9. In addition, the porcine muscle stem cell cell line is subjected to serum-free suspension acclimation to obtain a cell line adapted to carrier-free serum-free suspension culture. The cell line can be cultured in vitro for a long time, solving the problems of limited in vitro amplification of primary muscle stem cells, decreased proliferation ability during amplification, and loss of differentiation ability, etc., and providing high-quality seed cell resources for the large-scale production of cultured meat.

[0008] 2. Technical solution

[0009] In order to achieve the above-mentioned invention object, the technical solution adopted in this application is as follows:

[0010] The present application provides a porcine muscle stem cell cell line that can be cultured for a long time in vitro, named as young pig muscle stem cell line SC px330-CDKN2A KO-Clone2 2DSus scrofa, which was deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, and the deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: C2024256; the porcine muscle stem cell cell line that can be cultured for a long time in vitro is based on muscle stem cells YP-S4-SC (deposited in the China Center for Type Culture Collection, with a deposit number of CCTCCNO: C2022256, and a deposit date of August 6, 2022) as primary cells, and the CDKN2A gene is knocked down or knocked out using the CRISPR / Cas9 system to reduce or eliminate the expression of p16 protein in the primary cells, thereby obtaining a porcine muscle stem cell cell line that can be cultured for a long time in vitro, and the porcine muscle stem cell cell line that can be cultured for a long time in vitro has improved cell proliferation ability without reducing cell differentiation ability.

[0011] The present application also provides the use of the above-mentioned porcine muscle stem cell line that can be cultured in vitro for a long time in the preparation of a stem cell line that is adapted to carrier-free and serum-free suspension growth.

[0012] Furthermore, the preparation of the stem cell line adapted to carrier-free and serum-free suspension growth comprises: acclimating the porcine muscle stem cell line that can be cultured in vitro for a long time in serum-free suspension in a shake flask and amplifying the culture in a bioreactor.

[0013] The present application also provides a stem cell line adapted to carrier-free and serum-free suspension growth obtained by preparing the stem cell line adapted to carrier-free and serum-free suspension growth as described above.

[0014] Furthermore, the above-mentioned stem cell line adapted to carrier-free and serum-free suspension growth is a young pig muscle stem cell line SCpx330-CDKN2A KO-C2 3D Sus scrofa, which was deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, and the deposit address is Wuhan University, Wuhan, China, with the deposit number CCTCC NO: C2024217; the stem cell line adapted to carrier-free and serum-free suspension growth can maintain relatively stable proliferation during suspension culture; at the same time, it retains the myogenic differentiation potential and the differentiation potential produced by extracellular matrix.

[0015] The present application also provides a porcine muscle stem cell line adapted to carrier-free and serum-free suspension growth, named as the young pig muscle stem cell line SC px330-CDKN2A KO-C2 3DSus scrofa, which was deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, at Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: C2024217.

[0016] The present application also provides the use of the above-mentioned porcine muscle stem cell line that can be cultured in vitro for a long time or the above-mentioned porcine muscle stem cell line that is adapted to carrier-free and serum-free suspension growth in the preparation of dietary consumables.

[0017] Furthermore, the above-mentioned dietary consumables include cell-cultured meat and the like.

[0018] Furthermore, the above application includes: culturing the above-mentioned pig muscle stem cell line that can be cultured in vitro for a long time or culturing the above-mentioned pig muscle stem cell line that is adapted to carrier-free and serum-free suspension growth in an in vitro culture medium, and preparing cell-cultured meat after proliferation and induction of differentiation.

[0019] Furthermore, the above application includes: culturing the above porcine muscle stem cell line adapted to carrier-free and serum-free suspension growth in an in vitro culture medium, wherein the in vitro culture medium includes a serum-free proliferation medium and a serum-free differentiation medium.

[0020] Furthermore, the above application includes: culturing the above porcine muscle stem cell line that can be cultured in vitro for a long time in an in vitro culture medium, and the in vitro culture medium includes: DMEM / F12 complete culture medium and low serum differentiation culture medium.

[0021] The present application also provides a cell cultured meat product, including the above-mentioned porcine muscle stem cell line that can be cultured in vitro for a long time or the above-mentioned porcine muscle stem cell line that is adapted to carrier-free and serum-free suspension growth.

[0022] 3. Beneficial effects

[0023] Compared with the prior art, the present application has the following beneficial effects:

[0024] (1) The present application provides a porcine muscle stem cell line that can be cultured in vitro for a long time and its application. The porcine muscle stem cell YP-S4-SC (deposit number is CCTCC NO: C2022256) is used as the primary cell, and the CDKN2A gene is knocked down or knocked out by using the CRISPR / Cas9 system to reduce or eliminate the expression of p16 protein in the primary cells, thereby obtaining a porcine muscle stem cell line that can be cultured in vitro for a long time. The porcine muscle stem cell line maintains differentiation potential while maintaining efficient cell proliferation.

[0025] (2) The present application provides a porcine muscle stem cell line that can be cultured in vitro for a long time and its application. The porcine muscle stem cell line can be used to prepare a stem cell line that is adapted to carrier-free serum-free suspension growth. By subjecting the porcine muscle stem cell line to serum-free suspension acclimation and amplification culture, a porcine muscle stem cell line that is adapted to carrier-free serum-free suspension growth can be obtained. The stem cell line that is adapted to carrier-free serum-free suspension growth can maintain good proliferation and differentiation capabilities in serum-free proliferation medium and serum-free differentiation medium, can utilize a complete serum-free medium system to complete proliferation and differentiation, maintain relatively stable proliferation during suspension culture, and retain the myogenic differentiation potential and the differentiation potential (collagen differentiation) produced by the extracellular matrix, thereby overcoming the technical problem in the prior art that muscle stem cells cannot differentiate into myogenic cells after serum-free suspension culture.

[0026] (3) The present application provides a porcine muscle stem cell line that can be cultured in vitro for a long time and its application, and provides a porcine muscle stem cell line that is suitable for carrier-free and serum-free suspension growth. It is the world's first porcine muscle stem cell line that can be suspended and scaled up and can differentiate into myoblasts. This cell line can be suspended and scaled up on a large scale and can also provide excellent cell resources for cell-cultured meat production. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 map used to construct CDKN2A gene knockout.

[0028] Figure 2 SCs grow to 75-85% confluence.

[0029] Figure 3 This is the result of monoclonal genotype identification after CDKN2A gene was knocked out in SCs.

[0030] Figure 4 This is the expression of myogenic factors in different monoclonal cells after CDKN2A gene was knocked out in SCs.

[0031] Figure 5 This is the proliferation of monoclonal cell lines after CDKN2A gene knockout in SCs.

[0032] Figure 6 This is the differentiation status of different monoclonal cells induced by serum-containing differentiation medium after CDKN2A gene was knocked out in SCs (qPCR detection).

[0033] Figure 7 This is the differentiation status of different monoclonal cells induced by serum-containing differentiation medium after CDKN2A gene was knocked out in SCs (immunofluorescence detection).

[0034] Figure 8 This is the early suspension-cultured cell proliferation of the monoclonal cell line SC px330-KO-2 after SCs knocked out the CDKN2A gene.

[0035] Fig. 9 The SC px330-KO-C2 3D long-term suspension culture cell morphology is adapted to carrier-free and serum-free suspension culture.

[0036] Fig.10 This is the proliferation of SC px330-KO-C2 3D long-term suspension culture cells adapted to carrier-free and serum-free suspension culture.

[0037] Fig.11 Figure 3D myogenic differentiation of SC px330-KO-C2 adapted to carrier-free and serum-free suspension culture.

[0038] Fig.12 Figure 3D collagen differentiation of SC px330-KO-C2 adapted to carrier-free serum-free suspension culture.

[0039] Fig.13 The adhesion of SC px330-KO-C2 3D adapted to carrier-free and serum-free suspension culture on soybean protein scaffolds.

[0040] Fig.14 Survival of SC px330-KO-C2 3D adapted to carrier-free and serum-free suspension culture on soy protein scaffolds.

[0041] Fig.15The results are as follows: Serum-free differentiation of SC px330-KO-C2 3D adapted to carrier-free and serum-free suspension culture on soy protein scaffolds. DETAILED DESCRIPTION

[0042] The present application is further described below in conjunction with specific embodiments.

[0043] It should be noted that the terms such as "upper", "lower", "left", "right", "middle", etc. cited in this specification are only for the convenience of description and are not used to limit the scope of implementation. Changes or adjustments to their relative relationships should be regarded as the scope of implementation of this application without substantially changing the technical content.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application belongs; the term "and / or" used herein includes any and all combinations of one or more of the associated listed items.

[0045] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0046] As used herein, the term "about" is used to provide flexibility and imprecision associated with a given term, measurement or value. The degree of flexibility for a particular variable can be easily determined by one skilled in the art.

[0047] As used herein, the term "at least one of" is intended to be synonymous with "one or more of." For example, "at least one of A, B, and C" expressly includes only A, only B, only C, and combinations of each thereof.

[0048] Concentration, amount and other numerical data can be presented in range format herein.It should be understood that such range format is only used for convenience and simplicity, and should be flexibly interpreted as not only including the numerical value clearly described as range limit, but also including all single numerical values ​​or sub-ranges contained in the range, just as each numerical value and sub-range are clearly described.For example, the numerical range of about 1 to about 4.5 should be interpreted as not only including the limit value of 1 to about 4.5 clearly described, but also including single numerals (such as 2,3,4) and sub-ranges (such as 1 to 3,2 to 4, etc.).The same principle is applicable to the scope of only narrating a numerical value, such as "less than about 4.5", which should be interpreted as including all the above-mentioned values ​​and ranges.In addition, no matter how the breadth of the described range or feature is, this explanation should be applicable.

[0049] As used herein, "SCs" refers to porcine muscle stem cells.

[0050] As used herein, "a porcine muscle stem cell line that can be cultured for a long time in vitro" is sometimes also referred to as an "immortalized porcine muscle stem cell line", which means that the cell line breaks through the Hayflick limit and proliferates for a long time in vitro.

[0051] As used herein, "serum-free medium" refers to a synthetic medium to which no serum is added, and is divided into "serum-free proliferation medium" and "serum-free differentiation medium" and the like according to its function.

[0052] In this application, "serum-free proliferation medium" can refer to the Chinese invention patent with publication number CN114574433A and invention name "a culture medium with clear chemical composition for in vitro proliferation of myogenic cells". As an example, the culture medium 1 with clear chemical composition is used in this application.

[0053] The “serum-free myogenic differentiation induction medium” can refer to the Chinese invention patent with publication number CN117603905A and invention name “a serum-free differentiation medium with clear chemical composition and its application”. As an example, the improved serum-free myogenic differentiation medium in the embodiment is used in this application.

[0054] The “serum-free medium for inducing in vitro matrix protein production” can refer to the Chinese invention patent with publication number CN116769702A and invention name “a modified medium with clear chemical composition for inducing in vitro matrix protein production and its application”. As an example, the modified medium with clear chemical composition in Example 5 thereof is used in this application.

[0055] Example 1

[0056] This embodiment provides a method for constructing a porcine muscle stem cell line that can be cultured in vitro for a long time and the constructed porcine muscle stem cell line that can be cultured in vitro for a long time.

[0057] In this embodiment, the method for constructing a porcine muscle stem cell cell line that can be cultured for a long time in vitro is to reduce or eliminate the expression of p16 protein in primary porcine muscle stem cells. Specifically, the CDKN2A gene is knocked down or knocked out using the CRISPR / Cas9 system to obtain a porcine muscle stem cell cell line that can be cultured for a long time in vitro. This cell line has improved cell proliferation ability without reducing cell differentiation ability.

[0058] The method for constructing a porcine muscle stem cell line that can be cultured in vitro for a long time can refer to the Chinese invention patent with publication number CN117603975A previously applied by the applicant. In this embodiment, the difference lies in the different vectors and monoclonal screening methods, which specifically include the following steps:

[0059] Construction of recombinant vector px330-gRNA-CDKN2A:

[0060] (1) pX330-U6-Chimeric_BB-CBh-hSpCas9 (pX330) vector (addgene42230, Figure 1 ), and linearized with restriction endonuclease BbsI at 37°C overnight; the enzyme digestion system included: BbsI 1μL, 10×bμffer4μL, pX3305μg, supplemented with ddH 2 0 to 40 μL;

[0061] (2) Prepare a pair of gRNAs for knocking out the CDKN2A gene in pig muscle stem cells. The sequences are as follows:

[0062] CDKN2A gRNA-3F1: 5-CACCGTCGTGTACCGGTCGGGTGA-3 (SEQ ID NO.1),

[0063] CDKN2A gRNA-3R1: 5-AAACTCACCCGACCGGTACACGAC-3 (SEQ ID NO. 2);

[0064] (3) Ligation: After briefly centrifuging the designed and synthesized sgRNA-oligo-F and sgRNA-oligo-R primer powders, add ddH 2 O was diluted to 100 μM; 5 μL of each group of sgRNA-oligo-F and sgRNA-oligo-R was taken and mixed (i.e., ds Oligo concentration was 50 μM); the PCR instrument ran the annealing program (95°C 30s, 72°C 2min, 37°C 2min, 25°C 2min, 4°C Hold); ds Oligo was diluted 100 times to 0.5 μM; the ligation system was prepared: 0.5 μL of linearized pX330 vector, 3 μL of diluted annealed ds Oligo (0.5 μM), 1 μL of 5×T4 DNA ligase buffer, 0.5 μL of T4 DNA ligase, and ligated at 16°C overnight.

[0065] Plasmid extraction and transfection of SCs using liposome transfection method:

[0066] (1) The connected CDKN2A gene knockout vector, fluorescent positive plasmid: pRetroQ-AcGFP1-N1, negative plasmid: pX330, experimental group pX330+gRNA, were transformed into DH5α Escherichia coli, inoculated into ampicillin-resistant LB medium, and cultured at 37°C overnight; the bacteria were picked for detection and then sent to the company for sequencing;

[0067] (2) After the sequencing results were correctly aligned with the plasmid map sequence, they were inoculated into 200 mL of ampicillin-resistant LB liquid culture medium and cultured at 37°C overnight; the high-concentration plasmid was extracted using an endotoxin-free plasmid extraction kit and filtered through a 0.45 μm filter. The concentration was measured and the plasmid concentration used for transfection was not less than 450 ng / mL;

[0068] (3) When SCs (deposited in China Center for Type Culture Collection, with the deposit number CCTCCNO: C2022256, deposit date August 6, 2022, and classified as porcine muscle stem cells YP-S4-SC) grow to 75-85% confluence ( Figure 2 ) and then digested for transfection. Aspirate the culture supernatant, rinse once with PBS, digest with 0.25% trypsin (about 1 mL) at 37°C for 1-3 min, terminate the digestion with DMEM / F12 medium containing 15% fetal bovine serum (without double antibody), centrifuge at 330g for 5 min, and resuspend the cells with 1 mL of DMEM / F12 medium containing 15% fetal bovine serum (without double antibody);

[0069] (4) Liposome transfection: premix two systems, each with a volume of 250 μL. Tube 1: exogenous expression plasmid (positive control: pRetroQ-AcGFP1-N1, negative control: pX330, experimental group pX330+gRNA) 2 μg, P3000 4 μL, Opti-MEM supplemented to 250 μL; Tube 2: Lipo3000 4 μL, Opti-MEM supplemented to 250 μL. Gently mix the two tubes with a gun and let stand at room temperature for 5 min. Add tube 1 to tube 2, mix gently and let stand at room temperature for 20 min. Inoculate SCs into 6-well plates (6 × 10 4 / well), add 1.5 mL of DMEM / F12 basal medium (without double antibody) containing 15% fetal bovine serum to each well, add the transfection mixture drop by drop evenly to the 6 wells, and gently mix back and forth and left and right;

[0070] (5) About 6 to 8 hours after transfection, replace the culture medium with DMEM / F12 complete medium (containing double antibodies) containing 15% fetal bovine serum and recombinant human fibroblast growth factor (Basic Fibroblast Growth Factor, bFGF) at a final concentration of 5 ng / mL, and continue to culture in an incubator;

[0071] (6) 24±2 hours after transfection, replace the complete medium. Continue to culture the cells for 24-72 hours. Observe the normal cell proliferation under a microscope. When the cell state is good, perform monoclonal selection.

[0072] Monoclonal screening - from SCs population cells transfected with gRNA:

[0073] (1) When the cells grow to a confluence of about 80%, digestion is terminated and the cell suspension after centrifugation and resuspension is counted. If the count result is 1×10 5 cells / mL, perform two 10-fold serial dilutions of the cell suspension: centrifuge two 1.5 mL tubes (labeled tube 1 and tube 2), add 900 μL of complete medium to each tube, take 100 μL of the cell suspension and add it to tube 1, mix well and take 100 μL to tube 2, then the number of cells in tube 2 is 1000 cells;

[0074] (2) Take an appropriate volume of cells (80 cells / plate) into the sample tank, add complete culture medium at a rate of 20 mL / plate, and mix well;

[0075] Use an 8-channel pipette to pipette 200 μL of cell suspension into a 96-well plate;

[0076] The liquid was changed every other day. After culturing for about 5 to 7 days, the cells were observed under a microscope and the wells of the single-cell colonies were selected and marked. When the colonies grew to 1 / 3 of the bottom area of ​​the well plate, they were digested and expanded to 24-well plates for culture. Genomic DNA was extracted from the rapidly proliferating single-cell colonies, PCR amplified, gel-recovered and purified, and sent to the company for sequencing and genotyping ( Figure 3 ), and two cell lines with successful knockout were screened out and named SC px330-CDKN2A KO-Clone2 and SC px330-CDKN2A KO-Clone9, abbreviated as SCpx330-KO-2 and SCpx 330-KO-9.

[0077] Monoclonal cell performance evaluation:

[0078] (1) Monoclonal proliferation characteristics

[0079] The cell lines with successful CDKN2A knockout were amplified, and the cells in the proliferation stage were collected to detect the expression of myogenic factor genes ( Figure 4 ), including PAX7, MYOD, MYOG, and the detection primer sequences are as follows:

[0080] The specific qPCR primers for PAX7 are (5'-3'):

[0081] PAX7-F:GTGCCCTCAGTGAGTTCGATT(SEQ ID NO.3),

[0082] PAX7-R:TCCAGACGGTCCCTTTGTC (SEQ ID NO.4);

[0083] The specific qPCR primers for MYOD are (5'-3'):

[0084] MYOD-F:GCTCCGCGACGTAGATTTGA(SEQ ID NO.5),

[0085] MYOD-R: GGAGTCGAAACACGGGTCAT (SEQ ID NO. 6);

[0086] The specific qPCR primers for MYOG are (5'-3'):

[0087] MYOG-F:AACCCCACTTCTATGACGGG(SEQ ID NO.7),

[0088] MYOG-R:TTATTCTTCCAGGGGCACTCG(SEQ ID NO.8);

[0089] The specific qPCR primers for GAPDH are (5'-3'):

[0090] GAPDH-F:GTCGGAGTGAACGGATTTGGC (SEQ ID NO.9),

[0091] GAPDH-R:CTTGCCGTTGGGTGGAATCAT (SEQ ID NO. 10).

[0092] The results showed that during the proliferation stage, the expression levels of stemness maintenance genes PAX7 and MOYD in SC px330-KO-2 cells were significantly upregulated compared with primary muscle stem cells (S4P17) and SC px330-KO-9, indicating that SCpx330-KO-2 cells, as muscle stem cells, maintained good cell stemness characteristics.

[0093] Subsequently, the obtained SCs monoclonal clone (SCpx 330-KO-2) and untransfected SCs were cultured in DMEM / F12 complete medium (containing double antibodies), with the medium changed every two days and passaged every three days to verify the proliferation capacity ( Figure 5 ).

[0094] The results showed that after monoclonal screening, the CDKN2A gene knockout cell line SCpx 330-KO-2 was able to maintain good cell proliferation in serum-containing culture medium (P>20), compared with SCs cells without gene editing ( Figure 5 ). This shows that after knocking out the CDKN2A gene, long-term culture of porcine muscle stem cells in vitro was achieved, and a porcine muscle stem cell line with good cell stemness characteristics was obtained.

[0095] (2) SCs differentiation experiment

[0096] Matrigel plating: Prepare a solution of Matrigel:PBS=1:50 (Val), add 1 mL / plate to a 3.5 cm culture dish, and place in a CO 2 Incubate in the incubator for about 1 hour, take out and drain the liquid, wash twice with PBS and drain.

[0097] Inoculation: CDKN2A gene knockout cell lines SCpx330-KO-2, SCpx330-KO-9 and untransfected SCs, at 6×10 4 ~1.2×10 5 The cells were inoculated at a density of 100 cells / plate in a 3.5 cm culture dish after being plated with matrix gel, and cultured with DMEM / F12 complete medium (containing double antibodies) for two days before changing the medium. Two samples were prepared for each cell type, respectively, for qPCR and immunofluorescence detection.

[0098] Induced differentiation: After the cells proliferate and divide to cover the entire culture dish (expand to a density of more than 90%), the proliferation medium is removed. SCs, SCpx330-KO-2, and SCpx330-KO-9 are differentiated with low serum differentiation medium (2% horse serum + DMEM), and the corresponding differentiation medium is added at a volume of 2mL / well to induce differentiation. The medium is changed every 2 days, and the differentiation effect of differentiation into muscle fibers is observed on the 5th day.

[0099] Collect samples for qPCR detection: Collect cells at the differentiation stage to detect myogenic factor gene expression ( Figure 6 ), including MYOD, MYOG, and MYHC detection primer sequences are as follows:

[0100] The specific qPCR primers for MYOD are (5'-3'):

[0101] MYOD-F:GCTCCGCGACGTAGATTTGA(SEQ ID NO.5),

[0102] MYOD-R: GGAGTCGAAACACGGGTCAT (SEQ ID NO. 6);

[0103] The specific qPCR primers for MYOG are (5'-3'):

[0104] MYOG-F:AACCCCACTTCTATGACGGG(SEQ ID NO.7),

[0105] MYOG-R:TTATTCTTCCAGGGGCACTCG(SEQ ID NO.8);

[0106] The specific qPCR primers for MYHC are (5'-3'):

[0107] MYHC-F:CCGTGCTCCGTCTTCTTTCC (SEQ ID NO.11),

[0108] MYHC-R:CGCTCCTTCTCTGACTTGCG (SEQ ID NO. 12);

[0109] The specific qPCR primers for GAPDH are (5'-3'):

[0110] GAPDH-F:GTCGGAGTGAACGGATTTGGC (SEQ ID NO.9),

[0111] GAPDH-R:CTTGCCGTTGGGTGGAATCAT (SEQ ID NO. 10).

[0112] Collect samples for immunofluorescence experiment: remove the culture medium, wash once with PBS, add 4% by weight paraformaldehyde and fix at 4°C overnight.

[0113] MYHC protein and DAPI immunofluorescence staining: remove 4% paraformaldehyde, wash 3 times with PBS, add about 1mL of 0.5% Triton, permeabilize for 20min at room temperature, and then wash 3 times with PBS. Add about 1mL of 5% BSA solution to block for about 30min at room temperature, add MYHC primary antibody (1:800), and incubate at 4℃ for 16h. Wash 3 times with PBS, add secondary antibody (1:500), incubate for 1h in the dark, wash 3 times with PBS, add DAPI mounting medium, cover with coverslip, and take pictures.

[0114] The results showed that compared with the cell line SCpx330-KO-9 and primary muscle stem cells, the CDKN2A gene knockout cell line SCpx330-KO-2 had significant MYOD, MYOG and MYHC expression after differentiation in low serum differentiation medium ( Figure 6 ) and showed obvious myotubes formed by cell fusion ( Figure 7 ), while the corresponding generation of untransfected SCs and cell line SCpx330-KO-9 had no obvious expression of differentiation-related myogenic factors and no myotube formation, which indicates that after knocking out the CDKN2A gene, the muscle stem cells of the SCpx330-KO-2 offspring can effectively maintain the cell myogenic differentiation ability, while the corresponding generation of untransfected SCs and cell line SCpx330-KO-9 almost lost their differentiation ability ( Figure 6-7). This further shows that the porcine muscle stem cell line SCpx330-KO-2 not only has good in vitro proliferation ability and stemness characteristics, but also can maintain good myogenic differentiation ability.

[0115] SC px330-KO-2 in this example is named as young pig muscle stem cell line SC px330-CDKN2A KO-Clone22DSus scrofa (SCpx330-KO-2), which was deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: C2024256.

[0116] Example 2

[0117] This example provides the application of SC px330-KO-2 obtained in Example 1.

[0118] In this example, the SC px330-KO-2 obtained in Example 1 was used to prepare a stem cell line adapted to carrier-free and serum-free suspension growth.

[0119] The stem cell line adapted to carrier-free and serum-free suspension growth is a stem cell line obtained by acclimating the SC px330-KO-2 obtained in Example 1. The stem cell line adapted to carrier-free and serum-free suspension growth can maintain the cell proliferation ability without reducing the cell differentiation ability. The acclimation method includes: serum-free suspension acclimation and amplification culture of the stem cell line in a shake flask. The suspension acclimation method can refer to the Chinese invention patent with publication number CN116555171A, and the serum-free culture medium can refer to the Chinese invention patent with publication number CN114574433A, which specifically includes the following steps:

[0120] (1) Adherent culture of porcine muscle stem cells (2D culture):

[0121] The porcine muscle stem cell cell line SC px330-KO-2, which can be cultured in vitro for a long time, was used as the original cell line. The cells were taken out of the liquid nitrogen tank, quickly fused in a 37°C water bath, and then added to 4 mL of DMEM / F12 complete medium (Gibco, C11330500BT) (containing double antibodies) containing 15% fetal bovine serum (Sigma, F8318) and 5 ng / mL bFGF, centrifuged at 330g for 5 minutes, and the freezing solution was removed to obtain a cell pellet; the cells were resuspended with DMEM / F12 complete medium (containing double antibodies), and then the cells were inoculated into a 10 cm culture dish covered with collagen, cultured in a 37°C incubator for 2 days, and the medium was changed. The cell density was about 60% on the 3rd day, and digestion and passage were performed. Digestion was performed with trypsin for 2 minutes, and then serum culture medium was added to terminate digestion, and centrifuged at 330g for 5 minutes to separate the cell pellet.

[0122] (2) Suspension culture of porcine muscle stem cells in a shake flask (3D culture)

[0123] The collected adherent cultured cells were placed in a 125 mL shake flask, and 20 mL of serum-free medium containing 0.01% hydroxypropyl methylcellulose (Selleck, S4444) and 0.1% anti-agglomerating agent (Gibco, 01-0057AE) was added. The number of cells was 4 × 10 6 ~6×10 6 The cell density was 2×10 5 ~3×10 5 / mL, the rotation speed was 90rpm, and 120rpm was used for high density suspension acclimation; on the 2nd and 4th days, 10mL of serum-free culture medium was added, and samples were taken and counted at the same time to monitor the growth of cells; on the 6th day, the cell suspension was collected into a 50mL centrifuge tube, centrifuged at 330g for 5min, the supernatant was recovered, and 4mL of trypsin substitute TrypLE TM Express (Gibco, 12604-021), digested at 37℃ for 2min. Add 6mL DMEM / F12 to stop digestion and blow off the cells, centrifuge again, add 10mL culture medium to resuspend, take the cell suspension for cell counting, the cells are in a proliferative state. According to the counting results, take 5×10 6 The remaining resuspended cells were placed in a shake flask at a cell density of 2×10 5 ~3×10 5 Count the cells / mL and continue to culture. According to the cell counting results, calculate the expansion multiple and doubling time of each cell subculture batch ( Figure 8 ).

[0124] According to the results, the porcine muscle stem cell line SC px330-KO-2 can maintain proliferation for at least 4 generations in a carrier-free serum-free suspension culture system, and the suspension cultured SC px330-KO-2 can reach a maximum proliferation of 11.16 times in 8 days. In the early stage of suspension acclimation, the doubling time of SC px330-KO-2 cells was relatively long, about 290 to 355 hours in the first 34 days of suspension acclimation. As the acclimation time increased, the cells gradually adapted to the carrier-free serum-free suspension culture system, and the doubling time of the cells was also shortened to 50 to 45 hours. The porcine muscle stem cell line SCpx330-CDKN2A KO-C2 3D adapted to carrier-free serum-free suspension culture was obtained, referred to as SC px330-KO-C2 3D.

[0125] (3) Long-term suspension culture of porcine muscle stem cells (3D culture)

[0126] The SC px330-KO-C2 3D porcine muscle stem cell line adapted to carrier-free and serum-free suspension culture was obtained and cultured at 2.5 × 10 5 The cells were cultured continuously by replenishing the culture fluid every 2 days and digesting and subculturing every 6 days. The cell status was observed during the continuous culture process, and a cell doubling graph was drawn with the number of subculture days as the horizontal axis (d) and the number of cell doublings in each generation as the vertical axis (Fold). A cell doubling time graph was drawn with the number of subculture days (d) as the horizontal axis and the doubling time as the vertical axis (h).

[0127] The results showed that the SC px330-KO-C2 3D porcine muscle stem cell line adapted to carrier-free and serum-free suspension culture showed a regular spherical shape during long-term suspension culture and the cells were round and transparent and in good condition ( Fig. 9 During long-term suspension culture, the proliferation of cells was continuously monitored ( Fig.10 ), the results showed that the SC px330-KO-C2 3D porcine muscle stem cell line maintained relatively stable proliferation during the culture process. In the early stage of suspension acclimation (before D50), the cells gradually increased their characteristics after experiencing a decrease in the number of divisions. After 50 days, the total number of cells increased exponentially, maintaining an expansion of about 1.1 to 2.7 times per day. The porcine muscle stem cell line SC px330-KO-C2 3D was continuously suspended for 243 days, and cell proliferation gradually stabilized, with a 7- to 10-fold increase in 3 days and a doubling time of about 22 to 25 hours.

[0128] (4) Differentiation characteristics after suspension acclimation

[0129] The SC px330-KO-C2 3D porcine muscle stem cell line adapted to carrier-free and serum-free suspension culture was obtained and cultured at 3 × 10 5 The cells were inoculated into a 3.5 cm cell culture dish after being plated with matrix gel at a cell density of 100 cells / dish, and cultured for 2 to 3 days using serum-free proliferation medium (reference Chinese invention patent with publication number CN114574433A) to allow the cells to cover the entire culture dish. After the cells are fully grown, the cells are induced to differentiate using serum-free myogenic differentiation induction medium (reference Chinese invention patent with publication number CN117603905A), and the medium is half-changed every 2 days. On the 5th day of differentiation, the cultured cells are washed with PBS, fixed with 4% paraformaldehyde, and immunofluorescence stained with MYHC antibody to identify whether the cells can differentiate into myotubes.

[0130] The results showed that after suspension acclimation, the SC px330-KO-C2 3D porcine muscle stem cell line was differentiated into myogenic cells using serum-free myogenic differentiation induction medium for 5 days, and obvious MYHC expression was observed ( Fig.11 ), demonstrating that this cell line still retains myogenic differentiation potential.

[0131] The SCpx330-KO-2 3D porcine muscle stem cell line adapted to carrier-free and serum-free suspension culture was obtained and cultured at 3×10 5 The cells were inoculated into a 3.5 cm cell culture dish after being plated with matrigel at a cell density of 100 cells / dish, and cultured in a serum-free medium for 2-3 days to allow the cells to cover the entire culture dish. After the cells are fully grown, a serum-free medium inducing in vitro matrix protein production is used to induce differentiation (reference publication number is CN116769702A Chinese invention patent). Half of the medium is changed every 2 days, and the cultured cells are washed with PBS on the second day of differentiation and collected, and Sirius red staining and qPCR detection are performed to identify the potential of cells to secrete extracellular matrix.

[0132] The results showed that after 2 days of induction of matrix protein formation, obvious Sirius red positive (red) cells were observed ( Fig.12 A), indicating that the cells can form collagen. The qPCR test results showed that after 2 days of induced differentiation, the expression of type III collagen gene increased by 2.38 times compared with the proliferation stage ( Fig.12 B), there was a very significant change, indicating that the cell line still retained the differentiation potential of extracellular matrix production.

[0133] In this example, the SC px330-KO-C2 3D cells adapted to carrier-free and serum-free suspension culture are named as young pig muscle stem cell line SC px330-CDKN2A KO-C2 3DSus scrofa (SC px330-KO-C2 3D), which were deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: C2024217.

[0134] Example 3

[0135] This example provides a carrier-free and serum-free suspension amplification culture of the porcine muscle stem cell line SCpx330-KO-C2 3D obtained in Example 2 adapted to carrier-free and serum-free suspension culture in a bioreactor, specifically comprising the following steps:

[0136] (1) The successfully suspended muscle stem cells were transferred to a 1L bioreactor for scale-up culture. 1.5×10 8 Cells were added into 600 mL serum-free proliferation medium at a cell density of 2.5 × 10 5 cells / mL, the rotation speed is 120rpm.

[0137] (2) After 6 days of culture, the cell growth and metabolic indicators were tested.

[0138] (3) On the 6th day, collect 10 mL of cell suspension into a 15 mL centrifuge tube, centrifuge at 330 g for 5 min, recover the supernatant, add 1 mL of trypsin substitute, and digest at 37°C for 3 min. Add 9 mL of PBS to stop digestion and blow the mixed cells apart, and take the cell suspension for cell counting (Table 1).

[0139] Table 1 Results of suspension culture of SC px330-KO-C2 3D in a bioreactor

[0140]

[0141] The porcine muscle stem cell line SC px330-KO-C2 3D adapted to carrier-free and serum-free suspension culture can proliferate normally in the bioreactor and the cells are in good condition during the proliferation process, indicating that the porcine muscle stem cell line SC px330-KO-C2 3D adapted to carrier-free and serum-free suspension culture can be suspended and scaled up in the bioreactor.

[0142] Example 4

[0143] This example provides an application of a porcine muscle stem cell line SC px330-KO-C2 3D adapted to carrier-free and serum-free suspension culture in the preparation of cell cultured meat, focusing on evaluating its reattachment and differentiation ability on a soy protein scaffold, specifically comprising the following steps:

[0144] (1) Preparation of soybean protein scaffolds: The scaffolds were provided by Nanjing Agricultural University and sterilized by electron beam β-ray irradiation at a third-party irradiation company with an irradiation dose of 10 kGy. The irradiated scaffolds were added to the basal culture medium DMEM / F12 and placed in a shaker at 37°C overnight for use;

[0145] (2) Cell inoculation: Soy protein scaffolds were placed in 125 mL shake flasks for standby use, with 2 pieces per shake flask; 4×10 cells per scaffold 7 The cells were inoculated in a shake flask and serum-free proliferation medium was added to make the final volume 20 mL. After the cells were inoculated, the flask was transferred to 37°C, 120 rpm, 5% CO 2 Continue to culture in a shaking incubator;

[0146] (3) Cell adhesion on soybean protein scaffolds: After cell inoculation, the cells were cultured with shaking at 120 rpm for 1 h, 3 h, and 4 h. After 24 h, 20 μL of the cell suspension was taken for counting. After 24 h of culture, the remaining culture solution was centrifuged at 330 g for 5 min, and 1 mL of TryPLE was added for digestion and counting, and the adhesion rate was calculated (Table 2).

[0147] Table 2 Adhesion of cells to the scaffold at different attachment times

[0148]

[0149] (4) Observe the cell adhesion and detect cell survival: Observe the adhesion of muscle stem cells SC px330-KO-C23D on the soybean protein scaffold ( Fig.13 ), and observed and recorded the survival of muscle stem cells SC px330-KO-C23D on the scaffold under a microscope ( Fig.14 ).

[0150] (5) Detection of cell differentiation on the soybean protein scaffold: After the cells were suspended and attached on the scaffold for 24 h, fresh serum-free proliferation medium was replaced and static culture was continued for 6 days. The medium was changed every 2 days. On D6, serum-free differentiation medium was replaced and static culture was carried out for 4 days. On D4, cell samples were collected for qPCR detection ( Fig.15 ).

[0151] The results showed that the porcine muscle stem cell line SC px330-KO-C2 3D adapted to carrier-free and serum-free suspension culture can attach, grow and differentiate on the surface of the protein scaffold to prepare cell-cultured meat.

Claims

1. A porcine muscle stem cell cell line that can be cultured for a long time in vitro, named as young pig muscle stem cell line SC px330-CDKN2A KO-Clone2 2D Sus scrofa, was deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: C2024256.

2. Use of the porcine muscle stem cell line capable of long-term in vitro culture as claimed in claim 1 in the preparation of a stem cell line adapted to carrier-free and serum-free suspension growth.

3. The use according to claim 2, characterized in that: The preparation of the stem cell line adapted to carrier-free and serum-free suspension growth comprises: acclimating the porcine muscle stem cell line that can be cultured in vitro for a long time in serum-free suspension in a shaking bottle and amplifying and culturing it in a bioreactor.

4. The stem cell line adapted to carrier-free and serum-free suspension growth obtained by preparing the stem cell line adapted to carrier-free and serum-free suspension growth as described in claim 3.

5. The stem cell line adapted to carrier-free and serum-free suspension growth according to claim 4, characterized in that: The stem cell line is a young pig muscle stem cell line SC px330-CDKN2A KO-C2 3D Sus scrofa, which was deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: C2024217.

6. A porcine muscle stem cell cell line adapted to carrier-free and serum-free suspension growth, named as young pig muscle stem cell line SC px330-CDKN2A KO-C2 3D Sus scrofa, was deposited in the China Center for Type Culture Collection (CCTCC) on August 8, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: C2024217.

7. Use of the porcine muscle stem cell line capable of long-term in vitro culture as claimed in claim 1 or the porcine muscle stem cell line adapted to carrier-free and serum-free suspension growth as claimed in claim 6 in the preparation of dietary consumables.

8. The use according to claim 7, characterized in that: The application includes: culturing the porcine muscle stem cells that can be cultured in vitro for a long time or the porcine muscle stem cell line that is adapted to carrier-free and serum-free suspension growth in an in vitro culture medium, and preparing cell cultured meat after proliferation and differentiation induction.

9. The use according to claim 8, characterized in that: The application comprises culturing the porcine muscle stem cell line adapted to carrier-free and serum-free suspension growth in an in vitro culture medium, wherein the in vitro culture medium comprises a serum-free proliferation culture medium and a serum-free differentiation culture medium.

10. A cell cultured meat product, comprising the porcine muscle stem cell line capable of long-term in vitro culture as claimed in claim 1 or the porcine muscle stem cell line adapted to carrier-free and serum-free suspension growth as claimed in claim 6.

Images