Biomarker related to zeaxanthin content character of sweet corn kernels and application of biomarker

Abstract

The invention relates to the technical field of molecular markers, in particular to a biomarker related to the zeaxanthin content character of sweet corn kernels and application of the biomarker. The RIL population is used for performing QTL positioning on the corn kernel zeaxanthin content character, it is found that a major QTL related to the sweet corn kernel zeaxanthin content exists on the sixth chromosome of corn, the major QTL is located between SNP sites Schr6: 83027949 and Schr6: 84835891, the phenotype contribution rate of the corn kernel zeaxanthin content is 18.69%, and the major QTL is a major QTL related to the sweet corn kernel zeaxanthin content. The major QTL can be used for screening or auxiliary screening of sweet corn with relatively high zeaxanthin content, when the genotype of Schr6: 83027949 is GG and the genotype of Schr6: 84835891 is AA, the zeaxanthin content is relatively high, technical support is provided for molecular marker-assisted breeding, and the major QTL has important significance in improving the nutritional quality of the sweet corn.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, in particular to biomarkers related to the zeaxanthin content trait of sweet corn kernels and applications thereof. Background Art

[0002] Zeaxanthin, also known as lutein, is an important carotenoid. Its chemical name is 3,3'-dihydroxyβ-carotene. It is a fat-soluble terpene compound with a yellow color. It has multiple physiological functions, including antioxidant, vision-protecting, and anti-inflammatory properties. It is widely found in nature, particularly in high concentrations in plants such as corn and wolfberry. Sweet corn is an important type of fresh corn. Dietary intake or supplementation of zeaxanthin has significant benefits for human health. Improving the zeaxanthin content of sweet corn is currently a key focus of sweet corn breeding for nutritional quality.

[0003] Zeaxanthin content is an important component of carotenoid content. Zeaxanthin content in grains is a complex quantitative trait controlled by multiple genes. Traditional breeding methods rely on phenotypic selection, which is time-consuming, inefficient, and easily affected by environmental factors. Molecular marker-assisted selection, on the other hand, allows for early screening of target genes or QTLs, significantly improving breeding efficiency. Although previous studies have also mapped QTLs for sweet corn kernel carotenoid content, and detected some quantitative trait loci controlling corn kernel carotenoid content, relatively few studies have specifically mapped QTLs for zeaxanthin. Research on zeaxanthin has focused more on its physiological functions, metabolic pathways, and associations with other pigments. Identifying QTLs associated with sweet corn kernel zeaxanthin content is of great significance for improving the nutritional quality of sweet corn. Summary of the Invention

[0004] To address these issues, the present invention provides biomarkers associated with sweet corn kernel zeaxanthin content and their applications. The biomarkers provided herein are major QTLs associated with sweet corn kernel zeaxanthin content and can be used to screen or assist in screening sweet corn with relatively high zeaxanthin content, resulting in more accurate screening results and significant benefits for improving the nutritional quality of sweet corn.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides biomarkers related to the zeaxanthin content trait of sweet corn, wherein the biomarkers include SNP01 and SNP02;

[0007] The SNP01 is located at 83027949bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is G or C; the SNP02 is located at 84835891bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is A or G;

[0008] When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of the sweet corn is relatively high.

[0009] Preferably, the biomarker comprises a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown as SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown as SEQ ID NO.2.

[0010] The present invention provides the use of the biomarker described in the above technical solution or the product for detecting the biomarker described in the above technical solution in 1) and / or 2):

[0011] 1) Screening or assisting in screening sweet corn with relatively high zeaxanthin content;

[0012] 2) Cultivate or assist in the cultivation of sweet corn varieties with high zeaxanthin content;

[0013] When the genotype of SNP01 in the biomarkers is GG and the genotype of SNP02 is AA, the zeaxanthin content of the sweet corn is relatively high.

[0014] Preferably, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0015] Preferably, the product comprises a primer set and / or a kit.

[0016] The present invention provides a primer set for the biomarker described in the above technical solution, wherein the primer set comprises a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.6.

[0017] The present invention provides a method for screening or assisting in screening sweet corn with a relatively high zeaxanthin content, comprising the following steps:

[0018] Determining the genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution of the sweet corn to be tested;

[0019] According to the genotype results of the determination, sweet corns with a genotype of SNP01 of GG and a genotype of SNP02 of AA were screened, that is, sweet corns with a relatively high zeaxanthin content.

[0020] The present invention provides a method for cultivating or assisting in cultivating a sweet corn variety with a high zeaxanthin content, comprising the following steps:

[0021] Determining the genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution of the sweet corn to be tested;

[0022] Discard the sweet corns with the genotype of SNP01 being CC and the genotype of SNP02 being GG, self-pollinate and / or hybridize the remaining sweet corns, and retain the sweet corns with the genotype of SNP01 being GG and the genotype of SNP02 being AA in the offspring, which are the sweet corns with relatively high zeaxanthin content.

[0023] Preferably, the determination includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification products; the primer set for PCR amplification includes the primer set described in the above technical solution.

[0024] Preferably, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0025] Beneficial effects:

[0026] The present invention provides biomarkers associated with the zeaxanthin content trait of sweet corn, wherein the biomarkers include SNP01 and SNP02; the SNP01 is located at 83027949bp of chromosome 6 of the corn B73 RefGen_V3 genome, and the base is G or C; the SNP02 is located at 84835891bp of chromosome 6 of the corn B73 RefGen_V3 genome, and the base is A or G; when the genotype of the SNP01 is GG and the genotype of the SNP02 is AA, the zeaxanthin content of the sweet corn is relatively high. The present invention uses sweet corn inbred lines SHL01 and SHL03 as parents to construct a RIL population (permanent population), detects sweet corn kernel zeaxanthin content trait data by high performance liquid chromatography, and uses the RIL population to perform QTL mapping on the kernel zeaxanthin content trait. It is found that a major QTL associated with the kernel zeaxanthin content of sweet corn exists on maize chromosome 6 and is located between SNP sites S_chr6:83027949 and S_chr6:84835891. The QTL contributes 18.69% to the kernel zeaxanthin content phenotype. The major QTL can be used for screening or auxiliary screening of sweet corn with relatively high zeaxanthin content, resulting in more accurate screening results. This provides technical support for molecular marker-assisted breeding and is of great significance for improving the nutritional quality of sweet corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0028] Figure 1 This is a map showing the location of the SNPs closely linked to the major QTL related to the zeaxanthin content in sweet corn kernels on maize chromosomes. DETAILED DESCRIPTION

[0029] The present invention provides biomarkers related to the zeaxanthin content trait of sweet corn, wherein the biomarkers include SNP01 and SNP02;

[0030] The SNP01 is located at 83027949bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is G or C; the SNP02 is located at 84835891bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is A or G;

[0031] When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of the sweet corn is relatively high.

[0032] The present invention uses RIL populations to locate QTLs for the zeaxanthin content trait in kernels, and screens out a major-effect QTL associated with the zeaxanthin content trait in sweet corn kernels. This QTL is suitable for predicting the zeaxanthin content trait in sweet corn kernels, and a combination of two SNP markers can be used to predict the zeaxanthin content in sweet corn kernels, providing technical support for molecular marker-assisted breeding.

[0033] In one embodiment, the biomarker includes a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.2, specifically as follows:

[0034] SEQ ID NO.1:

[0035] 5'-TTGGAGCTGCTCAAATTTGACTTTGTCTTCTACAGTACTGCAGGC GGCTTGCTGCCTGCTGCCAAGGCTGCCAGCTTTTGAGGACGACGGCTGTGGACATSACATGCACATGCATGCAGATCTTAGCTTACCGATCGATCATACCTGACAGTGAACTATATCATCTTGTTGCGCTGCATCTGTGAGGGCTGAGGCAGGTTC-3';

[0036] SEQ ID NO.2:

[0037] 5'-ACCCGTGATTTGGATCGCACCAAGGTGCCAGACTCTGGCATTGTT CCTGCTGCTGGTGGTGATGGAGGCGTGCACGATGCGGATGCCGATGGAACACGAARGCAGCTGAAGGTTCCTAGTTCAATGTTGGTTTCGGAGATGAATGACAGTGCTGTCGAAGCTGCGCCTATAGAAGAGGATCATGCTCAAGACATGTCTTGAA-3';

[0038] Among them, bases S and R are both degenerate bases, base S is G / C, and base R is A / G.

[0039] Using the biomarkers provided by the present invention for molecular marker-assisted selection, it is possible to predict the zeaxanthin content trait in sweet corn kernels by simply detecting the genotype of the SNP base at a specific site, or by detecting the genotype at position 101 of the first and second nucleic acid molecules. This method is simple to identify, with high selection efficiency and a clear selection target, unaffected by environmental factors. SNP markers also enable high throughput. Molecular marker-assisted breeding for the zeaxanthin content trait in sweet corn kernels can be used during the sweet corn seedling stage, and can also be used for molecular polymerase breeding for traits.

[0040] Based on the above advantages, the present invention provides the use of the biomarkers described in the above technical solution or the products for detecting the biomarkers described in the above technical solution in 1) and / or 2):

[0041] 1) Screening or assisting in screening sweet corn with relatively high zeaxanthin content;

[0042] 2) Cultivate or assist in the cultivation of sweet corn varieties with high zeaxanthin content;

[0043] When the genotype of SNP01 in the biomarkers is GG and the genotype of SNP02 is AA, the zeaxanthin content of the sweet corn is relatively high.

[0044] The present invention can cultivate or assist in cultivating sweet corn varieties with high zeaxanthin content by discarding sweet corns with SNP01 genotype of CC and SNP02 genotype of GG in the biomarkers, and retaining SNP01 genotype of GG and SNP02 genotype of AA.

[0045] As an embodiment, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0046] As an embodiment, the product includes a primer set and / or a kit.

[0047] Based on the above advantages, the present invention provides a primer set for the biomarker described in the above technical solution, wherein the primer set comprises a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.6, specifically as follows:

[0048] SEQ ID NO.3: 5'-TTGGAGCTGCTCAAATTTGA-3';

[0049] SEQ ID NO.4: 5'-GAACCTGCCTCAGCCCTCAC-3';

[0050] SEQ ID NO.5: 5'-ACCCGTGATTTGGATCGCAC-3';

[0051] SEQ ID NO. 6: 5'-TTCAGACATGTCTTGAGCAT-3'.

[0052] The primer set provided by the present invention can specifically amplify the first nucleic acid molecule and the second nucleic acid molecule in the above technical solution, and then through sequencing analysis of the first nucleic acid molecule and the second nucleic acid molecule, the genotype of SNP01 in the biomarker is selected as GG and the genotype of SNP02 is selected as AA, thereby screening sweet corn with a relatively high zeaxanthin content. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. The SNP marker can also achieve high-throughput detection.

[0053] Based on the above advantages, the present invention provides a method for screening or assisting in screening sweet corn with a relatively high zeaxanthin content, comprising the following steps:

[0054] Determining the genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution of the sweet corn to be tested;

[0055] According to the genotype results of the determination, sweet corns with a genotype of SNP01 of GG and a genotype of SNP02 of AA were screened, that is, sweet corns with a relatively high zeaxanthin content.

[0056] Based on the above advantages, the present invention provides a method for cultivating or assisting in cultivating a sweet corn variety with a high zeaxanthin content, comprising the following steps:

[0057] Determining the genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution of the sweet corn to be tested;

[0058] Discard the sweet corns with the genotype of SNP01 being CC and the genotype of SNP02 being GG, self-pollinate and / or hybridize the remaining sweet corns, and retain the sweet corns with the genotype of SNP01 being GG and the genotype of SNP02 being AA in the offspring, which are the sweet corns with relatively high zeaxanthin content.

[0059] In one embodiment, the assay comprises: performing PCR amplification on the sweet corn sample to be tested, and sequencing the resulting PCR amplification product; the primer set for the PCR amplification comprises the primer set described in the above technical solution. In one embodiment, the PCR amplification system comprises: 25 μL of 2×PCR mix, 22 μL of ddH₂O, 1 μL each of upstream and downstream primers, and 1 μL of DNA template. In one embodiment, the PCR amplification procedure comprises: denaturation at 95°C for 3 minutes; 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds; and a final extension at 72°C for 5 minutes.

[0060] As an embodiment, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0061] To further illustrate the present invention, the biomarkers related to the zeaxanthin content trait of sweet corn kernels and their applications provided by the present invention are described in detail below with reference to the examples and drawings, but they should not be construed as limiting the scope of protection of the present invention.

[0062] Example 1

[0063] 1. Construction of genetic map of sweet corn RIL population.

[0064] A RIL population was constructed using the sweet corn inbred lines SHL01 and SHL03 as parents and planted at the Zhuanghang Experimental Station of the Shanghai Academy of Agricultural Sciences. Leaf tissue was collected from the RIL population after seedling emergence for DNA extraction. Genotyping by target sequencing (GBTS) was used to genotype 236 F7 plants, yielding 10,000 single-nucleotide polymorphisms (SNPs). Quality control and filtering using PLINK software identified markers with a deletion rate less than 20%, a minimum allele frequency greater than 0.05, and a heterozygosity rate less than 20%. The resulting genetic map contained 4,253 high-quality SNP markers, grouped into 10 linkage groups. The total genetic distance on the map was 3,052.3 cM, with an average genetic distance of 0.7 cM between SNP markers.

[0065] 2. Detection of Zeaxanthin Content in Sweet Corn Kernels

[0066] A RIL population was constructed using the sweet corn inbred lines SHL01 and SHL03 as parents. This RIL population was planted at the Zhuanghang Experimental Station of the Shanghai Academy of Agricultural Sciences using a randomized block design. Each RIL family was planted in two-row plots with three replicates under normal field management. After harvest, the sweet corn kernels were analyzed for zeaxanthin content using high-performance liquid chromatography. Three ears were sampled from each replicate, and 15 intact, pest-free kernels were selected from each ear for zeaxanthin extraction and determination. The average of the three replicates was used as the phenotypic data.

[0067] Table 1 Comparison of phenotypic variation and heritability of RIL populations

[0068] Traits Average value (μg / g) Variation (μg / g) Skewness Kurtosis Coefficient of variation Zeaxanthin content 2.53 0～8.65 1.05 -0.04 86％

[0069] 3. Obtaining the main QTL for zeaxanthin content in sweet corn kernels

[0070] The QTL IciMapping 4.2 software and the composite interval mapping method (CIM) were used to perform QTL analysis on the average value of the zeaxanthin content in the RIL population. 1000 random tests were performed at a significance level of P < 0.05 to determine the logarithm of the odds (LOD) of the likelihood function ratio. The 2-LOD interval method was used to determine the confidence interval (QTL interval) of the QTL. The format for naming QTL is: the prefix is ​​"q" + the English abbreviation of the trait + the chromosome number where the QTL is located + the serial number of the QTL on the same chromosome, and the number is connected to the chromosome number with "-". QTL analysis of the zeaxanthin content in the grain was performed, such as Figure 1 As shown, two QTLs were detected, located on chromosomes 2 and 6, with LOD values ​​of 2.90 and 5.74, respectively. The individual QTLs contributed 8.81% and 18.69% to the phenotypic variation, respectively. A single QTL with a contribution of 10% or more to the phenotypic variation was considered a major QTL. qZEA6, located on chromosome 6, contributed 18.69% and was considered a major QTL.

[0071] Table 2 QTL results for kernel zeaxanthin content

[0072]

[0073] 4. Development and application of SNP markers tightly linked to the zeaxanthin content trait in sweet corn kernels

[0074] qZEA6 is a major QTL regulating the zeaxanthin content in kernels located on chromosome 6 of maize. It is located between SNP sites S_chr6:83027949 and S_chr6:84835891. The SNP site S_chr6:83027949 mutates to G / C, and the SNP site S_chr:6_84835891 mutates to A / G. The physical location is chr6:83027949-84835891 in the maize RefGen_V3 genome. These two SNP sites can be used to predict the zeaxanthin content in sweet corn kernels.

[0075] Example 2

[0076] A primer set for screening sweet corn with a relatively high zeaxanthin content in the kernels was designed based on the two SNP sites screened in Example 1. The primer set consists of a first primer pair and a second primer pair. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO. 3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO. 4. The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO. 5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO. 6. The screening method is as follows:

[0077] DNA was extracted from maize leaves using conventional methods. PCR amplification was performed using the first and second primer pairs, respectively. The PCR amplification system consisted of 25 μL of 2× PCR mix, 22 μL of ddH₂O, 1 μL of each upstream and downstream primer, and 1 μL of DNA template. The PCR reaction conditions were: denaturation at 95°C for 3 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds. Finally, an extension at 72°C for 5 minutes was performed. PCR products were sequenced. Plants with a G at S_chr6:83027949 and an A at S_chr6:84835891 were considered candidates for high kernel zeaxanthin content and were retained. Plants that did not meet these two conditions were discarded.

[0078] PCR amplification and sequencing were performed on 82 sweet corn materials from the Shanghai Academy of Agricultural Sciences Corn Center, and the zeaxanthin content in the kernels was determined. The results are shown in Table 3.

[0079] When the SNP site S_chr6:83027949 base is G and S_chr6:84835891 base is A, the zeaxanthin content of the sweet corn kernels to be tested is higher. When the SNP site S_chr6:83027949 base is C and S_chr6:84835891 base is G, the zeaxanthin content of the sweet corn kernels to be tested is lower. The average values ​​of the two phenotypes showed a significant difference, with a P value of 2.04×10 -17 .

[0080] Table 3 Corresponding results of SNP genotypes and zeaxanthin content phenotypes of sweet corn materials tested

[0081]

[0082]

[0083] Note: The blank cells in Table 4 indicate no data. 6_83027949 is the SNP site S_chr6:83027949, and 6_84835891 is the SNP site S_chr6:84835891.

[0084] In summary, the tightly linked SNP markers for the major QTL associated with zeaxanthin content in sweet corn screened using the present invention can assist in the selection of corn with high zeaxanthin content. Simply by detecting the genotype of the SNP base at a specific site, or by detecting the genotype at position 101 of the first and second nucleic acid molecules, the zeaxanthin content trait in the sweet corn kernels can be predicted. This method is simple, efficient, and targets a clear selection target, unaffected by environmental factors. Furthermore, the SNP markers can achieve high throughput. The markers can be used for molecular marker-assisted breeding of sweet corn kernel zeaxanthin content at the seedling stage, and can also be used for molecular polymerized breeding of traits.

[0085] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A biomarker associated with the zeaxanthin content trait of sweet corn, characterized in that: The biomarkers include SNP01 and SNP02; The SNP01 is located at 83027949bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is G or C; the SNP02 is located at 84835891bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is A or G; When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of the sweet corn is relatively high.

2. The biomarker according to claim 1, characterized in that The biomarker includes a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.

2.

3. Use of the biomarker according to claim 1 or 2, or a product for detecting the biomarker according to claim 1 or 2, in 1) and / or 2): 1) Screening or assisting in screening sweet corn with relatively high zeaxanthin content; 2) Cultivate or assist in the cultivation of sweet corn varieties with high zeaxanthin content; When the genotype of SNP01 in the biomarkers is GG and the genotype of SNP02 is AA, the zeaxanthin content of the sweet corn is relatively high.

4. The use according to claim 3, characterized in that The zeaxanthin content is the zeaxanthin content in sweet corn kernels.

5. The use according to claim 3, characterized in that The products include primer sets and / or kits.

6. A primer set for detecting the biomarker according to claim 1 or 2, characterized in that: The primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown as SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is shown as SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown as SEQ ID NO.

6.

7. A method for screening or assisting in screening sweet corn with a relatively high zeaxanthin content, characterized in that: The following steps are involved: Determining the genotypes of SNP01 and SNP02 in the biomarker of claim 1 or 2 of the sweet corn to be tested; According to the genotype results of the determination, sweet corns with a genotype of SNP01 of GG and a genotype of SNP02 of AA were screened, that is, sweet corns with a relatively high zeaxanthin content.

8. A method for cultivating or assisting in cultivating a sweet corn variety with a high zeaxanthin content, characterized in that: The following steps are involved: Determining the genotypes of SNP01 and SNP02 in the biomarker of claim 1 or 2 of the sweet corn to be tested; Discard the sweet corns with the genotype of SNP01 being CC and the genotype of SNP02 being GG, self-pollinate and / or hybridize the remaining sweet corns, and retain the sweet corns with the genotype of SNP01 being GG and the genotype of SNP02 being AA in the offspring, which are the sweet corns with relatively high zeaxanthin content.

9. The method according to claim 7 or 8, characterized in that The determination comprises: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification products; the primer set for PCR amplification comprises the primer set according to claim 6.

10. The method according to claim 7 or 8, characterized in that The zeaxanthin content is the zeaxanthin content in sweet corn kernels.

Images