Primer for detecting leishmania infection of infants and application thereof

Abstract

The invention provides a primer for detecting leishmania infection of infants and an application of the primer, and belongs to the technical field of biology. According to the invention, VL-HLH can be sensitively and accurately diagnosed, the obtained amplification product can be used for sequencing, comparison in an NCBI database and phylogenetic tree analysis and identification according to the sequencing result, the variety of leishmania can be rapidly diagnosed and identified, and great guiding significance is provided for treatment and prognosis of the leishmania. According to the present invention, the qPCR is adopted to amplify and quantify the kDNA, such that the load of the leishmania in the sample can be further obtained, the large reference value is provided for clinical treatment and prognosis, and the popularization and the application of the PCR diagnosis of the VL-HLH are easily achieved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a primer for detecting infants infected with Leishmania and an application thereof. Background Art

[0002] Leishmania parasites live in human tissues and are intratissue flagellates. They are classified as Kinetoplastida, Suborder Trypanosomatina, Family Trypanosomatidae, Genus Leishmania. Leishmania has two life cycles: promastigote and amastigote. The former parasitizes the digestive tract of arthropods (sand flies), while the latter parasitizes the mononuclear phagocytes of humans and vertebrates and is transmitted by sand flies. There are more than 54 species of Leishmania worldwide, of which more than 20 species can infect humans. The disease caused by Leishmania is called Leishmaniasis. Different types of Leishmania infection cause different diseases. Visceral Leishmaniasis is related to infection with Leishmania donovani and Leishmania infantum.

[0003] According to a large number of research reports, visceral leishmaniasis (VL) is prone to secondary hemophagocytic lymphohistiocytosis HLH (VL-HLH), especially in VL-endemic areas. VL-HLH is a type of immune system disease in which the immune system is abnormally activated and loses control, leading to a series of excessive inflammatory reactions and ultimately multiple organ system damage. It is mainly manifested by abnormal activation and proliferation of lymphocytes, monocytes, and macrophages, and the secretion of a large number of inflammatory cytokines to cause cytokine storms. The main clinical symptoms are pancytopenia, persistent fever, hepatosplenomegaly, poor mental state, malnutrition, abdominal distension, etc. If not diagnosed and treated in time, 41.7% of VL children will develop into VL-HLH. If VL-HLH is not diagnosed and treated in time and accurately, its mortality rate can reach 100%. Currently, the diagnosis of VL-HLH is often misdiagnosed and missed, with 30% of VL-HLH patients misdiagnosed at initial diagnosis, especially in areas where leishmaniasis is not endemic, where the misdiagnosis rate is even higher.

[0004] At present, bone marrow smear microscopy is a common method for diagnosing VL-HLH, that is, microscopic examination of the patient's bone marrow smear to directly find the Leishmania amastigote pathogen and confirm the diagnosis. However, this method requires high professional knowledge and experience of the inspector. If Leishmania is not observed in one sampling, multiple bone marrow punctures are required, which brings great pain to the patient. Therefore, rapid and accurate diagnosis of whether infants and young children are infected with Leishmania is crucial for the treatment of VL or VL-HLH. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a primer for detecting Leishmania infection in infants and young children, which can sensitively and accurately diagnose VL-HLH.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: A primer for detecting Leishmania infection in infants and young children, comprising primer set 1 and / or primer set 2; In the primer set 1, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.1, and the downstream primer has a nucleotide sequence as shown in SEQ ID NO.2; In the primer set 2, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3, the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4, and the probe has a nucleotide sequence as shown in SEQ ID NO.5.

[0007] Preferably, the primer set 1 is used to specifically amplify Leishmania kDNA and to sequence it; the primer set 2 is used to quantitatively detect the amount of Leishmania kDNA in a sample.

[0008] Another object of the present invention is to provide a reagent for detecting Leishmania infection in infants and young children, wherein the reagent comprises the above-mentioned primers.

[0009] Another object of the present invention is to provide the use of the primer or the reagent in preparing a product for detecting Leishmania infection in infants and young children.

[0010] Preferably, the primers or reagents are used to perform PCR amplification on the analyte.

[0011] Preferably, the amplification system for quantitatively detecting the kDNA content of Leishmania in a sample using primer set 2 is: 10 µL of 2×Probe qPCR Mix, 0.4 µL of each of the upstream and downstream primers of primer set 2, 0.8 µL of the probe of primer set 2, 0.4 µL of 50×ROX Reference Dye, 2 µL of DNA template, and 6 µL of sterile water.

[0012] Preferably, the amplification system for specifically amplifying Leishmania kDNA using primer set 1 is: 25 μL of 2×PCR MasterMix, 19 μL of water, 1 μL each of the upstream and downstream primers of primer set 1, and 4 μL of DNA template.

[0013] Preferably, the amplification conditions for specifically amplifying Leishmania kDNA using primer set 1 are: 94°C for 2 min, 94°C for 30 s, 56°C for 30 s, 72°C for 15 s, 35 cycles, and incubation at 72°C for 1 min.

[0014] Preferably, after the PCR amplification, the amplified product is subjected to agarose gel electrophoresis, and if a 139 bp specific identification band appears in the electrophoresis spectrum, the object to be tested is infected with Leishmania.

[0015] Preferably, the specific identification band is recovered, the amplified product is purified, the amplified product and the PCDND3.1(+) plasmid are digested separately and then connected, and the connected product is transformed into Enterobacter DH5α cells and then sequenced.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a primer for detecting infants infected with Leishmania and its application. The present invention performs kinetoplast minicircle DNA (kDNA) PCR on total DNA in bone marrow samples, which can sensitively and accurately diagnose VL-HLH. The obtained amplified product can be used for sequencing. According to the sequencing results, the comparison in the NCBI database and the phylogenetic tree analysis and identification can quickly diagnose and identify the type of Leishmania, which has a great guiding significance for the treatment and prognosis of the disease. The present invention uses qPCR to amplify and quantify kDNA, which can further detect the load of Leishmania in the sample, has a great reference value for clinical treatment and prognosis, and is more conducive to the promotion and application of PCR diagnosis of VL-HLH. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Bone marrow smear examination of 3 children, among which, a is Leishmania amastigotes in the bone marrow of patient 1; b is hemophagocytic cells in the bone marrow of patient 1; c is Leishmania amastigotes in the bone marrow of patient 2; d is hemophagocytic cells in the bone marrow of patient 2; e is Leishmania amastigotes in the bone marrow of patient 3; f is hemophagocytic cells in the bone marrow of patient 3; red arrows indicate Leishmania amastigotes, and black arrows indicate hemophagocytic cells (×1000, Wright staining); Figure 2The electrophoresis results of kDNA and ITS-1 PCR products of 3 patients, among which, a is kDNA PCR of DNA extracts from bone marrow smears of 3 patients; b is kDNA PCR of plasmids cloned from kDNA amplification products of 3 patients after transformation into Escherichia coli; c is ITS-1 PCR of DNA extracts from bone marrow smears of 3 patients; Lane M: DNA2000 Marker, Lane 1: Patient 1, Lane 2: Patient 2, Lane 3: Patient 3, Lane C: Negative control; Figure 3 kDNA sequences of the three children were compared using Snapgene (version 5.3); Figure 4 This is a phylogenetic tree of 14 Leishmania kDNA sequences, where purple dots represent patients 1, 2, and 3; Figure 5 Real-time fluorescence quantitative PCR amplification curves of kDNA standards and kDNA from three children; Figure 6 is the linear regression equation of kDNA standard and the kDNA load of 3 children; Figure 7 is the linear regression equation of kDNA standards; Figure 8 Figure 3 is the kDNA real-time fluorescence quantitative PCR amplification curve after dilution of kDNA standard and patient 2 sample. DETAILED DESCRIPTION

[0018] The present invention provides primers for detecting Leishmania infection in infants and young children, comprising primer set 1 and / or primer set 2; in primer set 1, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.1, and the downstream primer has a nucleotide sequence as shown in SEQ ID NO.2; in primer set 2, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3, the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4, and the probe has a nucleotide sequence as shown in SEQ ID NO.5.

[0019] In the present invention, PCR amplification primers are designed using the Leishmania kDNA minicircle gene sequence as a template, wherein primer set 1 is used for specific amplification of Leishmania kDNA and for sequencing; and primer set 2 is used for quantitative detection of the Leishmania kDNA load in a sample.

[0020] The present invention also provides a reagent for detecting infants and young children infected with Leishmania, wherein the reagent comprises the above primers.

[0021] The present invention also provides the use of the primer or the reagent in preparing a product for detecting infants and young children infected with Leishmania.

[0022] In the present invention, the primers or reagents are used to perform PCR amplification on the object to be detected.

[0023] In the present invention, the amplification system for quantitatively detecting the kDNA content of Leishmania in the sample using primer set 2 is: 2×Probe qPCR Mix 10µL, 0.4µL of each of the upstream and downstream primers of primer set 2, 0.8µL of the probe of primer set 2, 0.4µL of 50×ROX Reference Dye, 2µL of DNA template, and 6µL of sterile water. In a specific embodiment of the present invention, in the amplification system, the concentration of the upstream and downstream primers of primer set 2 is 10µM, and the concentration of the probe is 4µM. The primer concentration provided by the present invention can accurately detect low-load Leishmania.

[0024] In the present invention, primer set 2 is used for quantitative detection, which can accurately detect low-load Leishmania parasites, and VL-HLH Leishmania infection can be diagnosed and the parasite species can be identified in the early stage of infection with high sensitivity.

[0025] In the present invention, the amplification system for specifically amplifying Leishmania kDNA using primer set 1 is: 2×PCR Master Mix 25 μL, water 19 μL, 1 μL of each of the upstream and downstream primers of primer set 1, and 4 μL of DNA template. In a specific embodiment of the present invention, in the amplification system, the concentration of the upstream and downstream primers of primer set 1 is 10 μM.

[0026] In the present invention, the amplification conditions for specifically amplifying Leishmania kDNA using primer set 1 are: 94° C. for 2 min, 94° C. for 30 s, 56° C. for 30 s, 72° C. for 15 s, 35 cycles, and 72° C. for 1 min.

[0027] In the present invention, after the PCR amplification, the amplified product is subjected to agarose gel electrophoresis, and if a 139 bp specific identification band appears in the electrophoresis pattern, the test object is infected with Leishmania. As an practicable method, the PCR amplified product in the present invention is subjected to electrophoresis on 1% agarose gel, and the size of the target band is observed on a gel imager.

[0028] In the present invention, the specific identification band is recovered, the amplified product is purified, the amplified product and the PCDND3.1 (+) plasmid are respectively digested and then connected, and the connection product is transformed into Enterobacter DH5α cells and then sequenced.

[0029] After infection with different types of Leishmania, the severity of the disease and the treatment plan will be different. Therefore, rapid diagnosis and identification of the type of Leishmania have a great guiding significance for the treatment and prognosis of the disease. The product amplified by the primer set 1 provided by the present invention can be used for sequencing, which can more accurately identify the type of parasite.

[0030] In clinical practice, when clinical symptoms are highly suspected of VL-HLH, and no Leishmania is detected in the initial bone marrow sampling, the primers provided in the present invention can be used for detection to assist clinical diagnosis and treatment.

[0031] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] Example 1 A primer for detecting Leishmania infection in infants and young children and its detection effect.

[0033] 1. Materials.

[0034] Three children were admitted to Kunming Children's Hospital in Yunnan Province, China at different times, and their clinical symptoms, laboratory tests and other data were collected for retrospective analysis. Bone marrow samples were obtained from Kunming Children's Hospital in Yunnan Province for DNA extraction, PCR and qPCR testing. This study was approved by the Ethics Committee of Kunming Children's Hospital in Yunnan Province.

[0035] 2. Laboratory examination.

[0036] The three children underwent routine laboratory examinations after admission, including blood routine, biochemical indicators, pathogens, bone marrow puncture, etc. Among them, the bone marrow cell smear was stained with Rigel stain, and the microscopic examination and diagnosis were performed by experienced pathologists and diagnostic experts according to relevant procedures.

[0037] All three children were female, of whom case 1 and case 3 were both 2 years old, and case 2 was 9 months old. Case 1 was from Guizhou, China, and case 2 and case 3 were from Yunnan, China. All three children were hospitalized for repeated fever. Before admission, they had persistent high fever (38.9-40℃), poor mental state, abdominal distension, liver and spleen enlargement, and other symptoms. They all had a history of mosquito bites and travel to Leishmaniasis epidemic areas. Biochemical examinations showed that all three children had typical VL-HLH blood routine and biochemical characteristics, manifested as pancytopenia or bilineage reduction, significant increase in high-sensitivity C-reactive protein, procalcitonin, ferritin, and alanine aminotransferase, and significant decrease in fibrinogen.

[0038] The diagnosis of VL-HLH was confirmed by traditional etiological examination based on bone marrow cell smear microscopy. No Leishmania amastigotes were found in the three children during the first bone marrow puncture. Leishmania amastigotes were found in all three children after the second bone marrow puncture. Among them, two Leishmania amastigotes were found in patient 2 after six consecutive bone marrow cell smears were observed. Figure 1 As shown, the bone marrow of patients 1 and 3 contained more Leishmania, as shown in Figure 1 a and Figure 1 e in the bone marrow of patient 2. Leishmania was rare, see Figure 1 c in the figure. The amastigotes of Leishmania in patients 1 to 3 were round or oval, with a diameter of about 2 to 5 μm. The cytoplasm was light blue, with a large round nucleus inside, which was purple-red. Small, rod-shaped, darkly colored kinetoplasts were visible in the middle of the parasite next to the nucleus. Hemophagocytic cells were easily seen in the bone marrow of the three patients. Figure 1 b in Figure 1 d and Figure 1 f in Figure 1. Other pathogen tests showed that only patient 1 was infected with Epstein-Barr virus among the three children, and the other pathogen tests were negative. The results are shown in Table 1. According to the microscopic results of Lemaniform amastigotes in the bone marrow and the diagnostic guidelines for HLH (HLH-2004 diagnostic criteria), all three patients were diagnosed with VL-HLH.

[0039] Table 1 Pathogen examination of three children

[0040] In the experiment of the present invention, 3 children were diagnosed with VL-HLH after 3-5 days of bone marrow microscopy. After treatment with special drugs and treatment plans, patients 1 and 3 recovered and were discharged from the hospital quickly. However, due to the low Leishmania load of patient 2, he was misdiagnosed in other hospitals in the early stage, which led to untimely diagnosis and severe drug rash on the 10th day of treatment. He died of multiple organ failure on the 13th day of treatment. Therefore, for VL-HLH, a rare disease that is easily misdiagnosed, missed, and has a high mortality rate, rapid and accurate diagnosis and timely symptomatic treatment are the key to avoiding death.

[0041] 3. Gene extraction, amplification and sequencing.

[0042] 3.1 Extraction of Leishmania DNA: The bone marrow samples on the bone marrow smears of the three children were washed with 0.01 mol / L PBS, the eluate was collected, centrifuged at 12000 r / min for 5 min, the supernatant was discarded, 500 μL of deionized water was added, and the samples were centrifuged at 12000 r / min for 2 min, the supernatant was discarded, and the above operation was repeated twice to wash the samples. 500 μL of lysis buffer (100 mMTris–HCl, pH 8.0; 100 mM EDTA; 100 mM NaCl), 1% SDS and 4 μL of 10 mg / mL proteinase K (Sigma) were added to each sample and incubated at 37°C overnight. Then an equal volume of phenol-chloroform was added for extraction, and after centrifugation, the aqueous phase was taken and 2 volumes of anhydrous ethanol were added to precipitate DNA, and then the DNA precipitate was washed with 70% ethanol, dried, and 50 μL of deionized water was added to fully dissolve the DNA, and stored below -20°C for use.

[0043] 3.2 ITS-1 amplification: PCR primers were designed with ITS-1 gene as the amplification region. The upstream primer sequence was (F:5 / to3 / ): CTGGATCATTTTCCGATG (SEQ ID NO.6), and the downstream primer sequence was (R:5 / to3 / ): TGATACCACTTATCGCACTT (SEQ ID NO.7). The reaction system was: 1µL of upstream and downstream primers, 25µL of 2×PCR Master Mix (purchased from TAKARA, Beijing, China), 4µL of DNA template (40ng / µL), 19µL of sterile deionized water, and a total volume of 50µL. The reaction conditions were: 94℃2min, 94℃30sec, 52℃30sec, 72℃1min, 35 cycles, and 72℃1min. The amplified product was electrophoresed on 1% agarose gel, and the size of the target band was observed on a gel imager.

[0044] like Figure 2 In c, no specific band was produced by PCR targeting IST-1.

[0045] 3.3 kDNA amplification: The PCR primers were designed with the Leishmania kDNA minicircle gene sequence as the template. The upstream primer sequence was (F:5 / to3 / ): GGCAAGCTTCTTTTCTGGTCCCGCGGGTAGG (SEQ ID NO.1), and the downstream primer sequence was (R:5 / to3 / ): GGCGGATCCCCACCTGGCCTATTTTACACCA (SEQ ID NO.2). The reaction system was: 1µL of upstream and downstream primers, 25µL of 2×PCR Master Mix (purchased from TAKARA, Beijing, China), 4µL of DNA template (40ng / µL), 19µL of sterile deionized water, and a total volume of 50µL. The reaction conditions were: 94℃ 2min, 94℃ 30sec, 56℃ 30sec, 72℃ 15sec, 35 cycles, and 72℃ insulation for 1min. The amplified product was electrophoresed on 1% agarose gel, the size of the target band was observed on a gel imager, and the target band was recovered and purified according to the instructions of the kit (gel recovery kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0046] The DNA extracts from the bone marrow smears of the three children were subjected to PCR amplification with kDNA as the target. The PCR for kDNA amplified specific bands in all three children, with a band size of 139 bp. The results are shown in Figure 2 a in.

[0047] 3.4 Gene cloning and sequencing: The gel-recovered and purified PCR amplification products and PCDND3.1 (+) plasmid were double-digested with BamHI and HindIII (purchased from TAKARA, Beijing, China), and the digestion products were gel-recovered and purified again. Then, the digested PCR fragments and plasmids were ligated with T4 ligase. The specific operation was carried out according to the instructions of the T4 ligase kit (TAKARA, Beijing, China). The ligation products were transformed into Escherichia coli DH5α cells, and the cells were spread on LB medium (Luria-Bertani) plates containing ampicillin and cultured overnight. The next day, colonies were selected and cultured with LB medium and then PCR identified with the above primers. PCR positive clones were selected and sent to Sangon Biotech Co., Ltd. (Sangon Biotech, Shanghai, China) for sequencing.

[0048] The results showed that after the kDNA amplification product was double-digested with BamHI and HindIII and cloned into the PCDNA3.1 (+) vector, after transformation into E. coli, specific bands of the same size could still be amplified in the colonies. Figure 2 b in.

[0049] Homology analysis of kDNA PCR amplified sequences from the three cases showed that the homology between case 1 and case 2, case 1 and case 3, and case 2 and case 3 was 97.84%, 87.14%, and 87.77%, respectively. The highest homology was between case 1 and case 2 (97.84%). Figure 3 .

[0050] 3.5 Sequence consistency analysis and phylogenetic tree construction.

[0051] The three sequences were submitted to GeneBank to obtain accession numbers, and each sequence was entered into NCBI for comparison. A total of 11 sequences with high homology (greater than 93%) with each sequence were downloaded, and the homology between these sequences and the three sequences was compared using Snapgene software (version 5.3). All sequences were imported into MEGA 11 software, and the phylogenetic tree was constructed using the neighbor-joining analysis method, and the phylogenetic tree was evaluated using the Bootstraping method (Bootstraping = 1000).

[0052] The PCR amplified sequences of kDNA from the three children were submitted to the Genbank database to obtain accession numbers, which were OR134573, OR134574 and OR134575. After comparison in the NCBI database, the results showed that all three children belonged to the genus Leishmania, and 11 sequences with a homology higher than 93% were obtained, including two species: Leishmania donovani and Leishmania infantum; these sequence samples came from India, Nepal, Tunisia, China and Italy, and the details are shown in Table 2. The homology comparison between these sequences by Snapgene showed that the homology between the sequences of patients 1 and 2 was consistent with that of other sequences, and the homology between the sequences of patient 3 and other sequences was quite different from that of patients 1 and 2, and the details are shown in Table 3. Using freshwater fish trypanosomes (S82515) as the outgroup and (MHOM / IN / 80 / DD8, AF167712) as the WHO reference strains of Leishmania donovani, the phylogenetic tree was constructed using MEGA11 software for the sequences of the three cases and these highly homologous sequences. The results showed that all sequences were clustered under the genus Leishmania, which was consistent with the results of bone marrow smear microscopy. Among them, patients 1 and 2 belonged to Leishmania donovani, but they were clustered in a separate group, while patient 3 belonged to Leishmania infantum, which was closer to Leishmania infantum (HQ585885) in China. The results are shown in Figure 4 .

[0053] Table 2 Detailed information of Leishmania used for phylogenetic tree construction

[0054] Table 3 Homology comparison between sequences

[0055] 3.6 qPCR detection: Upstream primer (F: 5 / to3 / ): CGGGTAGGGGCGTTCTGC (SEQ ID NO.3), downstream primer (R: 5 / to3 / ): CCTGGCCTATTTTACACCAACC (SEQ ID NO.4), probe (TaqMan-P, 5 / to3 / ): CCGAAAAATGGGTGCAGAAATCCCGTTCA (SEQ ID NO.5). Real-time fluorescence quantitative PCR was performed using the DNA extract of each case as a template. The reaction system was: Probe qPCR Mix (2×) 10µL (purchased from TAKARA, Beijing, China), upstream primer (10µM) 0.4µL, downstream primer (10µM) 0.4µL, Probe 0.8µL, ROX Reference Dye (50×) 0.4µL (purchased from TAKARA, Beijing, China), DNA template 2µL, sterile water 6µL, total volume 20µL. The reaction system was: 95°C for 5s, 60°C for 34s (fluorescence signal collection), for a total of 40 cycles. The cloned plasmid of Case 1 was used as the standard (the initial copy number was 1×10 8 ), and the standard was diluted 10 times in series, recorded as: A: 1×10 8 copies / μL, B: 1×10 7 copies / μL, C: 1×10 6 copies / μL, D: 1×10 5 copies / μL, E: 1×10 4 copies / μL, F: 1×10 3 copies / μL, G: 1×10 2 copies / μL, H: 10 copies / μL, each dilution standard was repeated in 2 wells, each case sample was repeated in 3 wells, and normal bone marrow DNA extract was used as a negative control (denoted as CK).

[0056] like Figure 5As shown, the green is the amplification curve of patient 3 sample, the red is the amplification curve of patient 1 sample, and the black is the amplification curve of patient 2 sample. It can be seen that the three children have obvious amplification curves after qPCR amplification, while the negative control has no amplification curve. The average cq of patients 1, 2 and 3 were 28.09±0.27, 33.23±0.16 and 23.34±0.23, respectively. After standard quantification, the average copy number of Leishmania kDNA in the samples of the three children was 3830 copies / µL, 150 copies / µL and 77168 copies / µL, respectively. The copy number in patient 3 was the highest. The results are shown in Figure 6 .

[0057] To further explore the sensitivity of qPCR, the patient 2 sample was further diluted to a theoretical copy number of 30 copies / µL, 6 copies / µL, and 1.2 copies / µL. Seven dilutions of the standard were selected: A: 1×10 8 copies / μL, B: 1×10 7 copies / μL, C: 1×10 6 copies / μL, D: 1×10 5 copies / μL, E: 1×10 4 copies / μL, F: 1×10 3 copies / μL, G: 1×10 2 copies / μL, and the qPCR procedure was the same as step 3.6.

[0058] like Figure 7 As shown in the figure, the amplification results show that the 7 concentrations of the standard have good amplification curves and good linearity (R 2 =0.9994).

[0059] like Figure 8 As shown, when the sample of patient 2 was diluted to a copy number of 30 copies / µL (blue curve) and 6 copies / µL (black curve), there were obvious amplification curves. However, when diluted to a copy number of 1.2 copies / µL (green curve), two of the three replicate wells were successfully amplified, and one well failed to amplify, indicating that the sensitivity of the qPCR provided by the present invention is at least 6 copies / µL.

[0060] The present invention provides a highly efficient, sensitive and accurate diagnostic method for detecting Leishmania in VL-HLH using Leishmania kDNA PCR / qPCR using primer set 1 and primer set 2. In clinical practice, when clinical symptoms highly suspect VL-HLH and Leishmania is not detected in preliminary bone marrow sampling, the primer set provided by the present invention should be considered as soon as possible for detection to assist clinical diagnosis and treatment.

[0061] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer for detecting Leishmania infection in infants and young children, characterized in that: comprising primer set 1 and / or primer set 2; In the primer set 1, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.1, and the downstream primer has a nucleotide sequence as shown in SEQ ID NO.2; In the primer set 2, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3, the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4, and the probe has a nucleotide sequence as shown in SEQ ID NO.

5.

2. The primer according to claim 1, characterized in that The primer set 1 is used for specific amplification of Leishmania kDNA and for sequencing; the primer set 2 is used for quantitative detection of the Leishmania kDNA load in the sample.

3. A reagent for detecting Leishmania infection in infants and young children, characterized in that: The reagent comprises the primer according to claim 1 or 2.

4. Use of the primers according to claim 1 or 2 or the reagents according to claim 3 in the preparation of products for detecting Leishmania infection in infants and young children.

5. The use according to claim 4, characterized in that: The analyte is amplified by PCR using the primers described in claim 1 or 2 or the reagent described in claim 3.

6. The use according to claim 5, characterized in that: The amplification system for quantitatively detecting the kDNA content of Leishmania in the sample using primer set 2 is: 2×Probe qPCR Mix 10µL, 0.4µL each of the upstream and downstream primers of primer set 2 described in claim 1 or 2, 0.8µL of the probe of primer set 2 described in claim 1 or 2, 0.4µL of 50×ROX Reference Dye, 2µL of DNA template, and 6µL of water.

7. The use according to claim 5, characterized in that: The amplification system for specifically amplifying Leishmania kDNA using primer set 1 is: 25 μL of 2×PCR Master Mix, 19 μL of water, 1 μL each of the upstream and downstream primers of primer set 1 according to claim 1 or 2, and 4 μL of DNA template.

8. The use according to claim 7, characterized in that: The amplification conditions for specific amplification of Leishmania kDNA using primer set 1 were: 94°C for 2 min, 94°C for 30 s, 56°C for 30 s, 72°C for 15 s, 35 cycles, and incubation at 72°C for 1 min.

9. The use according to claim 7, characterized in that: After the PCR amplification, the amplified product is subjected to agarose gel electrophoresis. If a 139 bp specific identification band appears in the electrophoresis spectrum, the object to be tested is infected with Leishmania.

10. The use according to claim 9, characterized in that: The specific identification bands were recovered, the amplified products were purified, the amplified products and the PCDND3.1 (+) plasmid were digested and connected respectively, and the connected products were transformed into Enterobacter DH5α cells and then sequenced.

Images