Yarrowia lipolytica genetically engineered bacterium with high carotenoid yield and application thereof

Abstract

The invention discloses a yarrowia lipolytica engineering bacterium for producing carotenoids at high yield, which is obtained by constructing a xylose induced activation system in the yarrowia lipolytica engineering bacterium XK17 to control the induced expression of astaxanthin synthesis key enzyme, the key enzymes for synthesizing the astaxanthin comprise beta-carotene hydroxylase CrtZ and beta-carotene ketolase CrtW. The invention also discloses an application of the yarrowia lipolytica engineering bacterium in fermentation production of carotenoids. According to the method, starting from yarrowia lipolytica XK17 with high yield of beta-carotene, a xylose induction activation system is used for respectively controlling the expression of beta-carotene hydroxylase (CrtZ) and beta-carotene ketolase (CrtW), or only controlling the expression of CrtW or CrtZ; the high yield of astaxanthin or canthaxanthin or zeaxanthin can be realized under the action of proper xylose induction concentration and induction opportunity respectively.

Description

Technical Field

[0001] The invention belongs to the field of synthetic biology, and specifically relates to a Yarrowia lipolytica genetic engineering bacterium which utilizes a xylose-induced activation system to efficiently produce carotenoids and an application thereof. Background Art

[0002] As a natural product, carotenoids have a variety of biological activities. Among the numerous carotenoids, canthaxanthin, zeaxanthin and astaxanthin have high economic value. Zeaxanthin is a dihydroxy derivative of β-carotene, which is found in large quantities in plant tissues such as green vegetables, corn seeds, wolfberries and Physalis fruits, and some non-photosynthetic bacteria. A large number of studies have shown that zeaxanthin has health benefits such as anti-oxidation, prevention of macular degeneration, treatment of cataracts, prevention of cardiovascular diseases, enhancement of body immunity, and slowing down of atherosclerosis, and is closely related to human health. At the same time, in the food industry, zeaxanthin, as a natural food pigment, is gradually replacing synthetic pigments such as lemon yellow and sunset yellow. Canthaxanthin is a diketone derivative of β-carotene, which is mainly found in crustaceans, fungi, and fish. Canthaxanthin can be used as a colorant in foods such as jams, candies, syrups, and sauces. However, canthaxanthin is more commonly used in animal feed rather than as a food colorant to make egg yolks and poultry meat more colorful and salmon more ruddy. Astaxanthin is mainly distributed in photosynthetic algae and crustaceans, and also exists in small amounts in bacteria, yeast and plants. Because it consists of four isoprene units and two β-ionone rings, astaxanthin has a variety of geometric and optical isomers, and currently there are three all-trans structures on the market: 3S-3′S, 3R-3′S, and 3R-3′R. Among them, only 3S-3′S with the strongest biological activity is approved for human use. Astaxanthin has been widely used in aquatic products, poultry eggs, health foods, and pharmaceutical industries due to its excellent coloring ability, extremely high antioxidant properties, and anti-inflammatory, anti-cancer, immunity-enhancing, and resistance to Helicobacter pylori invasion. It has great market potential.

[0003] At present, the production of carotenoids is still mainly based on chemical synthesis and biological extraction. Although the chemical synthesis method has a lower cost, the product produced by this method has a lower purity, contains multiple optical isomers, has questionable safety, and the production process is seriously polluted. It is prohibited by the U.S. Food and Drug Administration (FDA) from being used in the field of health products, which greatly affects its market value. Biological extraction is directly separated from the natural producers of carotenoids. However, the common Haematococcus pluvialis is not suitable for high-density culture, has high requirements for the culture environment, and is difficult to separate from it, resulting in high production costs. The astaxanthin extracted from Phaffia rhodozyma is mostly 3R-3′R configuration, and its market value is low.

[0004] Studies have found that introducing exogenous genes of the astaxanthin synthesis pathway into microbial cells of different chassis to produce astaxanthin can overcome the problems of low content, long cycle, complex product structure and complex process in natural host production. It has the advantages of simple production process, short cycle and good quality, and has become one of the current research hotspots.

[0005] The biosynthesis of canthaxanthin, zeaxanthin and astaxanthin can be divided into three modules: terpenoid precursor synthesis module, β-carotene synthesis module and astaxanthin synthesis module. The terpenoid precursor synthesis module refers to the synthesis of terpenoid precursors isoprenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) from pyruvate through the mevalonate pathway (MVA pathway) and the 2-methyl-D-erythritol-4-phosphate pathway (MEP pathway); the β-carotene synthesis module refers to the synthesis of lycopene from terpenoid precursors through multi-step reactions, and then the synthesis of β-carotene. In the third module, β-carotene can generate the diketonized product canthaxanthin under the action of β-carotene ketolase (CrtW), and can also generate the dihydroxylated product zeaxanthin under the action of β-carotene hydroxylase (CrtZ). If CrtW and CrtZ act on it at the same time, it can be converted into the final product of diketonization and dihydroxylation, astaxanthin. The genes encoding CrtW and CrtZ and the natural pathway for synthesizing astaxanthin from β-carotene exist in many algae such as Haematococcus pluvialis, Chromochloris zofingiensis, bacteria such as Paracoccus sp., and fungi such as Schizochytrium.

[0006] At present, studies have achieved the synthesis of zeaxanthin, canthaxanthin and astaxanthin in microbial cell factories by introducing heterologous synthesis pathways from astaxanthin, with hosts such as Escherichia coli and Saccharomyces cerevisiae. In addition to the safety risks of the host itself, the production of zeaxanthin, canthaxanthin and astaxanthin still cannot meet the requirements of industrial production.

[0007] In Yarrowia lipolytica, a constitutive strong promoter is generally used to control the expression of key genes in the synthesis pathway to achieve high astaxanthin production. However, these strategies have the problem of product synthesis competing with bacterial growth for resources, and product accumulation leading to feedback inhibition of the synthesis pathway, thus limiting the yield. At the same time, although there is a patent that successfully uses the lactose induction system to produce astaxanthin in Saccharomyces cerevisiae, the inducer IPTG added is biologically toxic and expensive, which is not conducive to industrial production. Summary of the invention

[0008] In view of the shortcomings of the prior art, the present invention proposes an engineered Yarrowia lipolytica that utilizes a xylose-induced activation system to produce high-yield carotenoids such as astaxanthin, canthaxanthin and zeaxanthin, so as to achieve high production of carotenoids such as astaxanthin by a biological fermentation method.

[0009] To achieve the above object, the first aspect of the present invention provides a genetically engineered Yarrowia lipolytica strain with high carotenoid production, wherein the genetically engineered Yarrowia lipolytica strain is obtained by constructing a xylose induction activation system in the Yarrowia lipolytica strain XK17 to control the induced expression of key enzymes for astaxanthin synthesis, wherein:

[0010] The key enzymes for astaxanthin synthesis include β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW.

[0011] According to the present invention, the carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

[0012] According to the present invention, the β-carotene hydroxylase CrtZ used to produce zeaxanthin comes from Pantoeaananatis, and its GenBank accession number is ADD79330.1; the β-carotene ketolase CrtW used to produce canthaxanthin comes from Paracoccus sp.N81106, and its GenBank accession number is BAE47465.1; the β-carotene ketolase CrtW used to synthesize astaxanthin comes from Paracoccus sp.N81106, and its GenBank accession number is BAE47465.1, and the β-carotene hydroxylase CrtZ comes from Haematococcus Pluvialis, and its GenBank accession number is AKQ20654.1.

[0013] According to a preferred embodiment of the present invention, the carotenoid is canthaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene ketolase CrtW derived from Paracoccus sp.

[0014] According to another preferred embodiment of the present invention, the carotenoid is zeaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene hydroxylase CrtZ from Pantoea ananatis.

[0015] According to another preferred embodiment of the present invention, the carotenoid is astaxanthin, and the corresponding key enzymes for astaxanthin synthesis are β-carotene ketolase CrtW from Paracoccus sp. and β-carotene hydroxylase CrtZ from Haematococcus Pluvialis, or β-carotene hydroxylase CrtZ from Haematococcus Pluvialis alone.

[0016] According to another preferred embodiment of the present invention, the engineered bacteria further knocks out the xylose utilization gene xyl1.

[0017] The second aspect of the present invention provides the use of the genetically engineered Yarrowia lipolytica for fermentation production of carotenoids.

[0018] Furthermore, the carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

[0019] The present invention has the following beneficial effects:

[0020] 1. The present invention constructs a xylose induction activation system (VPRHX-pXO) through synthetic biology technology to timely control the induced expression of key enzymes for astaxanthin synthesis, thereby achieving high production of astaxanthin and carotenoids such as canthaxanthin and zeaxanthin in the Yarrowia lipolytica host.

[0021] 2. Starting from the high-β-carotene-producing Yarrowia lipolytica XK17, the xylose-induced activation system was used to control the expression of β-carotene hydroxylase (CrtZ) and β-carotene ketolase (CrtW), or only control the expression of CrtW or CrtZ, so as to achieve high production of astaxanthin or canthaxanthin or zeaxanthin under the appropriate xylose induction concentration and induction timing.

[0022] 3. Since Yarrowia lipolytica has an endogenous xylose utilization pathway, it can slowly utilize xylose. The present invention further utilizes the CRISPR / Cas9 system to knock out the endogenous xylose utilization gene xyl1 from the Yarrowia lipolytica genome, so that the double-induced and single-induced engineered bacteria no longer consume xylose, which can further reduce inducer consumption and improve the xylose-induced expression effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The construction process of plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t is shown.

[0024] Figure 2 The plasmid map of pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Pxo-Ptef-pspcrtW-XPR2t is shown.

[0025] Figure 3 The plasmid map of pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t is shown.

[0026] Figure 4 The results of xylose-induced fermentation of the engineered bacteria YL-TY-W are shown.

[0027] Figure 5 The results of xylose-induced fermentation of the engineered bacteria YL-TY-Z are shown.

[0028] Figure 6 The fermentation optimization results of YL-TY-3 induction conditions are shown, where a is the yield of various carotenoid intermediates of YL-TY-3; b is the dry weight of YL-TY-3 strain.

[0029] Figure 7 The fermentation optimization results of the induction conditions of YL-TY-4 are shown, where a is the yield of various carotenoid intermediates of YL-TY-4; b is the dry weight of the YL-TY-4 strain.

[0030] Figure 8 The yield of astaxanthin by xylose-induced fermentation of YL-TY-3-Δxyl1 is shown.

[0031] Fig. 9 The yield of astaxanthin by xylose-induced fermentation of YL-TY-4-Δxyl1 is shown. DETAILED DESCRIPTION

[0032] The present invention will be further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0033] Materials and Methods

[0034] β-Carotene hydroxylase CrtZ for producing zeaxanthin is from Pantoea ananatis (GenBank: ADD79330.1);

[0035] β-carotene ketolase CrtW for producing canthaxanthin is from Paracoccus sp. N81106 (GenBank: BAE47465.1);

[0036] The β-carotene ketolase CrtW used to synthesize astaxanthin is from Paracoccus sp. N81106 (GenBank: BAE47465.1), and the β-carotene hydroxylase CrtZ is from Haematococcus Pluvialis (GenBank: AKQ20654.1).

[0037] The "xylose-induced activation system" described in the context of the present invention includes two parts: a transcription factor VPRHX that enhances transcription after binding to xylose and a xylose-responsive promoter pXO, and its function is to activate the expression of the target gene downstream of the xylose-responsive promoter by induction of xylose. The construction process is obtained by referring to the method disclosed in the document (Wei W, Shang Y, Zhang P, Liu Y, You D, Yin B, Ye B: Engineering Prokaryotic Transcriptional Activator XylR as a Xylose-Inducible Biosensor for Transcription Activation in Yeast. ACS SynthBiol 2020, 9: 1022-1029).

[0038] The Yarrowia lipolytica XK17 strain with high beta-carotene production was obtained according to the method disclosed in CN111321087A.

[0039] pVPRHX: integration plasmid, containing promoter P hp4d , xylose-induced transcription factor gene VPRH-XylR, terminator XPR2t, kana R , and contains ura3; obtained from reference document (Wei W, Zhang P, Shang Y, et al. Metabolically engineering of Yarrowia lipolytica for the biosynthesis of naringenin from a mixture of glucose and xylose[J]. Bioresource Technology, 2020, 314: 123726).

[0040] pUC19-hpcrtZ: A commercial plasmid containing the gene hpcrtZ from Haematococcus Pluvialis.

[0041] pUC19-pacrtZ: A commercial plasmid containing the gene pacrtZ from Pantoea ananatis.

[0042] pUC19-pspcrtW: A commercial plasmid containing the gene pspcrtW from Paracoccus sp.

[0043] pPtef-Pxo: Contains the hybrid promoter Ptef-Pxo sequence, obtained from reference file (Wei W, Zhang P, Shang Y, et al. Metabolically engineering of Yarrowia lipolytica for the biosynthesis of naringenin from a mixture of glucose and xylose[J]. Bioresource Technology, 2020, 314: 123726).

[0044] pUAS1B-Ptef: contains the constitutive strong promoter UAS1B-Ptef sequence, obtained with reference to CN111321087A.

[0045] pINA1312: contains the XPR2 terminator sequence, obtained from reference document (1. Zhang, XK; Wang, DN; Chen, J.; Liu, ZJ; Wei, LJ; Hua, Q., Metabolic engineering of beta-carotene biosynthesis in Yarrowia lipolytica [J]. Biotechnol Lett 2020, 42(6), 945-956).

[0046] pCRISPRyl_A08: Contains the CRISPR / Cas9 system sequence, obtained from reference file (1. Zhang, XK; Wang, DN; Chen, J.; Liu, ZJ; Wei, LJ; Hua, Q., Metabolic engineering of beta-carotene biosynthesis in Yarrowia lipolytica[J]. Biotechnol Lett 2020, 42(6), 945-956).

[0047] The molecular operations involved in the following examples, unless otherwise specified, were performed in accordance with the product instructions. Among them, the operation of integrating the gene expression cassette into the yeast host refers to the method disclosed in the literature (Li YW, Yang CL, Shen Q, et al. YALIcloneNHEJ: An Efficient Modular Cloning Toolkit for NHEJ Integration ofMultigene Pathway and Terpenoid Production in Yarrowia lipolytica [J]. Frontiers in Bioengineering and Biotechnology, 2021, 9: 816980).

[0048] The primer sequences used in the following examples are as follows:

[0049] ZZ-tef-pxo-F: CTAGATAGAGTCGACAAAGGGTAATATTGGGCACTCCCTTTCA;

[0050] ZZ-tef-pxo-wR:GGCAGAGCGTGAGCAGACATTTTGAATGATTCTTATACTCAGAAGG;

[0051] ZZ-tef-pxo-zR: ATCAGAGAGTTCACCAGCATTTTGAATGATTCTTATACTCAGAAGG;

[0052] ZZ-1312-wF: CCTTCTGAGTATAAGAATCATTCAAAATGTCTGCTCACGCTCTG;

[0053] ZZ-1312-wR: ACGTGGGGACAGGCCATGGACTAGGCGGTGTCTCCCTT;

[0054] ZZ-1312-zF: CCTTCTGAGTATAAGAATCATTCAAAATGCTGGTGAACTCTCTGAT;

[0055] ZZ-1312-zR: CGTGGGGACAGGCCATGGACTACTCGGGGGAAGAGGAAG;

[0056] ZZ-XPR-wF: CCAAGGGAGACACCGCCTAGTCCATGGCCTGTCCCCAC;

[0057] ZZ-XPR-zF:CTTCCTCTTCCCCCGAGTAGTCCATGGCCTGTCCCCAC;

[0058] ZZ-XPR-R:TCTGTACACCGAGAAACAGGCTATTTACAACAATCTGG;

[0059] ZZ-tef-F:GGTACCCGAATTCCTGAGGT;

[0060] ZZ-tef-wR:ATGCCCTCCTACGAAGCT;

[0061] Zz-tef-zR:CTACTCGGGGGAAGAGGAAG.

[0062] ZZ-hpcrtZ-F:TACATACGCAAGTGAGATGC;

[0063] ZZ-hpcrtZ-R:CCAGAGCGAGTGTTACACAT;

[0064] ZZ-tef-F:CTAGATAGAGTCGACAAAGGGGTACCCGAATTCCTGAGGT1

[0065] ZZ-tef-R:GGCAGAGCGTGAGCAGACATTTTGAATGATTCTTATACTCAGAAGG;

[0066] Dxyl1-1-F:TCCTGGAGAAGATGGACGGA.

[0067] Dxyl1-1-R:TCAAGCTCGCCTCCGGAAAGACGTCAACCTGCGCCGACCC;

[0068] Dxyl1-2-F:CTTTCCGGAGGCGAGCTTGAGTTTTAGAGCTAGAAATAGC1

[0069] Dxyl1-2-R:TCCGTCCATCTTCTCCAGGA.

[0070] CX-xyl1-F:AATCTGTCACATGTCTTCCC;

[0071] CX-xyl1-R:TCGGAGGGGAATGTACTG。

[0072] In the following examples, the shake flask fermentation method of the engineered bacteria is as follows:

[0073] Primary seed solution: Pick a single colony and place it in 5 mL YPD liquid medium, and culture it in a shaking incubator at 220 rpm and 30°C overnight;

[0074] Secondary seed solution: Take 100 μL of bacterial solution and add it to 50 mL of YPD liquid medium, and culture it in a shaking incubator at 220 rpm and 30°C for 24 h;

[0075] Fermentation broth culture: dilute an appropriate amount of secondary seed liquid and measure OD 600 The bacterial solution was inoculated into a 250 mL shake flask containing 50 mL YPD liquid medium, and the OD of each bottle of fermentation liquid after inoculation was 600 The value was 0.01; the culture was placed in a shaking incubator at 220 rpm and 30°C for constant temperature culture and fermentation for 120 h.

[0076] Sampling is performed at specific time points for parameter measurement and analysis.

[0077] YPD medium: 20 g / L tryptone, 20 g / L glucose, 10 g / L yeast extract, 20 g / L agar (solid), sterilization conditions 121°C, 30 min.

[0078] In the following examples, the carotenoid product extraction and detection methods are as follows:

[0079] ⅰ. Carotenoid product extraction method

[0080] Take 50 μL of fermentation broth in a 1.5 mL centrifuge tube and centrifuge at 13200 g for 3 min; discard the supernatant, add 500 μL of DMSO, mix by pipetting, and vortex for 30 s; incubate at 65 °C in the dark for 10 min; add 500 μL of acetone, vortex for 30 s, and incubate at 65 °C in the dark for 15 min; centrifuge at 13200 g for 3 min; take the supernatant and filter it with a 0.22 μm filter membrane for HPLC detection.

[0081] ii. Quantitative detection method of carotenoid products

[0082] Drawing of standard curves for astaxanthin, β-carotene, canthaxanthin, β-cryptoxanthin and zeaxanthin: Weigh β-carotene, astaxanthin and intermediate product standards and dissolve them in a mixture of methanol:acetone = 9:1, and dilute them with acetone to 100 mg / L, 80 mg / L, 50 mg / L, 30 mg / L, 20 mg / L, 10 mg / L, 5 mg / L, 2 mg / L. The diluted samples were filtered with a 0.22 μm filter membrane, and then tested by HPLC, the corresponding peak areas were recorded, and the standard curve was drawn.

[0083] Drawing of the standard curve of echinone: Weigh the echinone standard and dissolve it in DMSO, and dilute it with acetone to 20 mg / L, 10 mg / L, 5 mg / L, 3 mg / L, 2 mg / L, 1 mg / L, 0.5 mg / L, and 0.2 mg / L. Filter the diluted samples with a 0.22 μm filter membrane, perform HPLC detection, record the corresponding peak area, and draw a standard curve.

[0084] HPLC detection conditions: chromatographic column: Agilent ZORBAX SB-Aq 250*4.6mm, 5μm; mobile phase: acetonitrile:methanol:isopropanol:water=4.5:3:2:0.5; injection volume: 20μL; detection wavelength: 480nm, flow rate: 1mL / min; column temperature: 40℃.

[0085] ⅲ. Reducing sugar content detection

[0086] 1) DNS reagent configuration

[0087] Take 75 mL of deionized water, heat it to a slight heat, then add 1.00 g of 3,5-dinitrosalicylic acid (DNS), 1.60 g of NaOH, 0.50 g of phenol, 0.50 g of sodium sulfite and 30.00 g of potassium sodium tartrate in sequence, dilute to 100 mL after dissolution, and store in a brown bottle at room temperature in the dark.

[0088] 2) Preparation of xylose standard solution

[0089] Accurately weigh 1.000 g of anhydrous xylose, dissolve it in deionized water and dilute to 1000 mL to obtain a xylose standard solution with a concentration of 1 mg / mL.

[0090] 3) Preparation of standard curve

[0091] Prepare 6 1.5mL centrifuge tubes, add 0, 0.02, 0.04, 0.06, 0.08, 0.10mL of xylose standard solution, add deionized water to 0.10mL, then add 0.3mL of DNS color developer, mix well, boil in a metal bath for 5min, and quickly cool to room temperature. Transfer each reaction solution to a 5mL centrifuge tube, add deionized water to 4mL, shake well, measure the absorbance at 500nm, and use this to make a xylose standard curve, and calculate the regression equation and regression coefficient (R 2 ).

[0092] 4) Xylose concentration detection

[0093] Take 50 μL of fermentation liquid in a 1.5 mL centrifuge tube, centrifuge at 13200 g for 3 min, take 0.10 mL of fermentation liquid, then add 0.3 mL of DNS colorimetric reagent, mix well, boil in a metal bath for 5 min, and quickly cool to room temperature. Transfer each reaction solution to a 5 mL centrifuge tube, add deionized water to 4 mL, shake well, measure the absorbance at 500 nm, and calculate the xylose concentration according to the standard curve.

[0094] Example 1: Using the xylose-induced activation system to regulate the expression of crtW or crtZ to promote the synthesis of canthaxanthin or zeaxanthin

[0095] 1.1. Construction of plasmid pVPRHX-Pxo-Ptef-pspcrtW / pacrtZ-XPR2t containing xylose-induced crtW or crtZ expression cassette

[0096] The construction process of plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t is as follows Figure 1 As shown, the details are as follows:

[0097] Using pPtef-Pxo, pUC19-pspcrtW, and pINA1312 as templates, primer pairs ZZ-tef-pxo-F, ZZ-tef-pxo-wR, ZZ-1312-wF, ZZ-1312-wR, and ZZ-XPR-wF, ZZ-XPR-R, high-fidelity Prime star GXL DNA polymerase PCR amplification was performed to obtain Ptef-Pxo, pspcrtW, and XPR2 gene fragments containing 20 bp homology arms before and after. The theoretical lengths of the three fragments are 383 bp, 775 bp, and 326 bp, respectively, and the fragment reaction solutions with correct band sizes were purified.

[0098] The plasmid pVPRHX was digested with restriction endonuclease StuⅠ, and the larger fragment was recovered as the vector with the aid of a gel recovery kit. The NovoRec Plus PCR recombinase reaction system was configured to perform four-fragment ligation on the vector and the three target fragments amplified above, and then calcium-transformed into E.coli DH10b. Subsequently, a single clone was picked on an LB-Kan plate and PCR verification was performed. The correct transformant was selected and sequenced to obtain the pVPRHX-Pxo-Ptef-pspcrtW-XPR2t plasmid.

[0099] Following the same method, the pspcrtW gene was replaced with the pacrtZ gene (using primer pairs ZZ-tef-pxo-F, ZZ-tef-pxo-zR, ZZ-1312-zF, ZZ-1312-zR, and ZZ-XPR-zF, ZZ-XPR-R) to construct the pVPRHX-Pxo-Ptef-pacrtZ-XPR2t plasmid.

[0100] 1.2. Construction of xylose-induced CrtW / CrtZ expression strain

[0101] The pVPRHX-Pxo-Ptef-pspcrtW-XPR2t plasmid and pVPRHX-Pxo-Ptef-pacrtZ-XPR2t plasmid constructed in 1.1 above were linearized with restriction endonuclease NotⅠ, transformed into competent cells of Yarrowia lipolytica XK17 (Ura-), and incubated at 30°C for 45 minutes.

[0102] The incubated bacterial solution was spread onto YNB-Ura solid medium (commercial medium without uracil) and cultured at 30°C for 2-4 days. Since the plasmid carries the URA gene, it can enable the host to grow on a medium lacking uracil after being inserted into the host genome, so the positive clones may have undergone random integration.

[0103] Single clones were picked to extract the genome, and PCR was performed to select and confirm the colonies with random integration. Single clones with the correct band size were verified by PCR and sequencing of the target fragment to obtain recombinant engineered bacteria TY-W (xylose-induced regulation of crtW expression) and TY-Z (xylose-induced regulation of crtZ expression).

[0104] 1.3. Construction of the strong promoter UAS1B8-Tef high expression CrtW / CrtZ engineering strain

[0105] Using pUAS1B-Ptef, pUC19-pacrtZ, and pINA1312 as templates, primer pairs ZZ-tef-F, ZZ-tef-zR, ZZ-1312-zF, ZZ-1312-zR, and ZZ-XPR-zF, ZZ-XPR-R, high-fidelity Prime starGXL DNA polymerase PCR amplification was used to obtain Ptef-Pxo, pacrtZ, and XPR2 gene fragments containing 20bp homology arms before and after. The theoretical lengths of the three fragments are 383bp, 571bp, and 326bp, respectively. The fragment reaction solutions with correct band size verification were purified. The NovoRec Plus PCR recombinase reaction system was configured to connect the vector and the three target fragments obtained by the above amplification, and calcium was transferred into E.coli DH10b. Subsequently, single clones were picked on LB-Kan plates for PCR verification. The correct transformants were selected and sequenced for verification to obtain the Ptef-pacrtZ-XPR2t plasmid.

[0106] Using the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t and plasmid Ptef-pacrtZ-XPR2t in 2.2 as templates, primer pairs ZZ-tef-F and ZZ-tef-R were used respectively to amplify the Ptef-pspcrtW-XPR2t and Ptef-pacrtZ-XPR2t gene fragments by high-fidelity Prime star GXL DNA polymerase PCR. The recovered gene fragments were transformed into the competent cells of Yarrowia lipolytica XK17 (Ura-) and incubated at 30°C for 45 min.

[0107] The incubated bacterial solution was spread onto YNB-Ura solid medium (commercial medium without uracil) and cultured at 30°C for 2-4 days. Since the plasmid carries the URA gene, it can enable the host to grow on a medium lacking uracil after being inserted into the host genome, so the positive clones may have undergone random integration.

[0108] Single clones were picked to extract genomes, and PCR was performed to select colonies with random integration. Single clones with correct band sizes were verified by PCR and sequencing of target fragments to obtain UAS1B8-Tef highly expressed CrtW and CrtZ engineered strains.

[0109] 1.4 Analysis of fermentation products of xylose-induced regulation of crtW or crtZ expression in engineered bacteria

[0110] The recombinant engineered bacteria TY-W obtained in 1.2 above was used for shake flask fermentation. Samples were taken at 120 hours of shake flask fermentation for parameter measurement and analysis. At the same time, an engineered strain with high expression of CrtW by the strong promoter UAS1B8-Tef was used as a control.

[0111] The results of shake flask fermentation of recombinant engineering bacteria TY-W are as follows Figure 4 As shown in the figure, when the xylose concentration was 5 g / L and the addition time was 12 h, the accumulation of the monoketo product Echinenone decreased from 300.05 mg / L to close to 0, while the production of the diketo product Canthaxanthin increased to 384.19 mg / L; while in the engineered strain with high expression of CrtW by the strong promoter UAS1B8-Tef, the production of Canthaxanthin was 289.48 mg / L. It can be seen that compared with the constitutive strong promoter, the use of the xylose inducible regulatory system increased the production of Canthaxanthin by 32.71%.

[0112] The recombinant engineered bacteria TY-Z obtained in 1.2 above was used for shake flask fermentation. Samples were taken at 120 hours of shake flask fermentation for parameter measurement and analysis. At the same time, an engineered strain with high expression of CrtZ by the strong promoter UAS1B8-Tef was used as a control.

[0113] The results of shake flask fermentation of recombinant engineering bacteria TY-Z are as follows Figure 5 As shown in the figure, when the xylose concentration was 5g / L and the addition time was 12h, the accumulation of the monohydroxyl product β-cryptoxanthin decreased from 265.85mg / L to 202.34mg / L, while the production of the dihydroxyl product zeaxanthin increased to 150.23mg / L; while in the engineered strain with high expression of CrtZ by the strong promoter UAS1B8-Tef, the zeaxanthin production was 33.12mg / L. It can be seen that compared with the constitutive strong promoter, the use of the xylose induction regulation system increased the production of zeaxanthin by 353.59%.

[0114] Example 2: Effect of regulating the expression of crtW and crtZ on astaxanthin production using a xylose-induced activation system

[0115] 2.1. Construction of plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Pxo-Ptef-pspcrtW-XPR2t containing a xylose inducible system to control the tandem expression cassettes of crtW and crtZ

[0116] Using pUC19-hpcrtZ as a template and primer pairs ZZ-hpcrtZ-F and ZZ-hpcrtZ-R, a high-fidelity Prime star GXL DNA polymerase PCR was used to amplify the Ptef-Pxo-hpcrtZ-XPR2t gene fragment containing 20 bp homology arms in front and back. The reaction solution with a fragment size of 1587 bp was purified and the concentration was measured, and the fragment preparation was completed.

[0117] The plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t obtained in 1.1 was digested with restriction endonuclease EcoRⅠ and recovered as the vector with the aid of a gel recovery kit. The NovoRec Plus PCR recombinase reaction system was prepared (according to the product manual), the vector and the target fragment Ptef-Pxo-hpcrtZ-XPR2t were connected to each other, and then transformed into E.coli DH10b. Subsequently, a single clone was picked on the LB-Kana plate for PCR verification. The correct transformant was selected and sequenced to obtain the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Pxo-Ptef-pspcrtW-XPR2t. The plasmid map is shown in the figure. Figure 2 shown.

[0118] 2.2 Construction of the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t containing the xylose-only inducible crtZ-constitutive crtW expression cassette

[0119] 2.2.1. Construction of plasmid pVPRHX-Ptef-pspcrtW-XPR2t

[0120] Using pUAS1B-Ptef, pUC19-pspcrtW and pINA1312 as templates, primer pairs ZZ-tef-F, ZZ-tef-wR, ZZ-1312-WF, ZZ-1312-WR, and ZZ-XPR-F, ZZ-XPR-R, high-fidelity Prime starGXL DNA polymerase PCR amplification obtained UAS1B8-Ptef, pspcrtW, XPR2 gene fragments containing 20bp homology arms before and after. The theoretical lengths of the three fragments are 1094bp, 775bp, and 326bp, and the fragment reaction solutions with correct band sizes were purified.

[0121] The plasmid pVPRHX was digested with restriction endonuclease StuⅠ, and the larger fragment was recovered as the vector with the aid of a gel recovery kit. The NovoRec Plus PCR recombinase reaction system was configured to connect the vector and the three target fragments UAS1B8-Ptef, pspcrtW, and XPR2 amplified above, and then transferred into E.coli DH10b. Subsequently, a single clone was picked on the LB-Kana plate and PCR verified by primers. The correct transformant was selected and sent for sequencing verification to obtain the plasmid pVPRHX-Ptef-pspcrtW-XPR2t.

[0122] 2.2.2. Construction of plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t

[0123] The primer pair ZZ-hpcrtZ-F and ZZ-hpcrtZ-R was used to amplify the Ptef-Pxo-hpcrtZ-XPR2t gene fragment containing 20 bp homology arms in front and back by high-fidelity Prime star GXL DNA polymerase PCR. The reaction solution with a fragment size of 1587 bp was purified and the concentration was measured, and the fragment preparation was completed.

[0124] The plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t was digested with restriction endonuclease EcoRⅠ and recovered as a vector using a gel recovery kit. The NovoRec Plus PCR recombinase reaction system was prepared to connect the vector and the target fragment Ptef-Pxo-hpcrtZ-XPR2t, and then transformed into E.coli DH10b. Subsequently, a single clone was picked on the LB-Kana plate and verified by PCR using primers. The correct transformant was selected and sequenced to obtain the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t. The plasmid map is shown in the figure. Figure 3 shown.

[0125] 2.3. Construction of xylose-induced crtW / crtZ engineered bacteria and xylose-induced crtZ-constitutive crtW engineered bacteria

[0126] Referring to the method of 1.2 of Example 1, the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t obtained in 2.1 above and the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t obtained in 2.2 were linearized and transformed into competent cells of Yarrowia lipolytica XK17 (Ura-), and the correct recombinants were screened by uracil-deficient medium and colony PCR to obtain the engineered bacteria YL-TY-3 in which crtW and crtZ were simultaneously induced by xylose and the engineered bacteria YL-TY-4 with crtZ-constitutive crtW induced by xylose alone were obtained.

[0127] 2.4. Optimization of shake flask fermentation conditions for high-yield astaxanthin engineered strains YL-TY-3 and YL-TY-4

[0128] Dynamic metabolic regulation is to precisely regulate metabolic pathways by turning on (enhancing) or turning off (reducing) gene expression at the appropriate stage. Therefore, optimizing the addition time and dosage of the inducer can make the xylose activation system work more efficiently and accurately.

[0129] Based on previous data analysis and literature research, the study investigated the addition time of the inducer at 12h, 18h, and 24h; and the addition dose of xylose was 2.5g / L, 5g / L, 10g / L, 20g / L, and 40g / L. Since the induction time is related to the inducer dose, the two conditions were combined in pairs, and the control group without the addition of inducer was used for fermentation optimization.

[0130] The results of YL-TY-3 shake flask fermentation are as follows Figure 6 As shown, when the xylose concentration was 10 g / L and the addition time was 12 h, the astaxanthin production of YL-TY-3 increased to 61.94±6.34 mg / L. At the same time, the addition of xylose significantly reduced the accumulation of β-carotene, echinone and canthaxanthin in YL-TY-3, which were 33%, 60% and 25% of the strain without xylose addition, respectively.

[0131] The results of YL-TY-4 shake flask fermentation are as follows Figure 7 As shown, when the xylose concentration was 10 g / L and the addition time was 24 h, the astaxanthin production of YL-TY-4 increased to 98.72±11.85 mg / L. At the same time, the addition of xylose significantly reduced the accumulation of β-carotene, echinone and canthaxanthin in YL-TY-4, which were 18%, 15% and 14% of the strain without xylose addition, respectively.

[0132] Example 3: Knockout of the xylose utilization gene xyl1 in recombinant engineered bacteria further improves the xylose induction effect

[0133] 3.1 Construction of xylose knockout plasmid pCRISPRyl_xyl1

[0134] In the engineered bacteria YL-TY-3 and YL-TY-4 obtained in Example 2 containing a xylose inducible activation system to control the expression of crtW and / or crtZ, the endogenous xylose utilization gene was knocked out using the CRISPR / Cas9 system in order to eliminate the host's ability to utilize xylose.

[0135] Using plasmid pCRISPRyl_A08 (Plasmid #84610) as a template, primer pairs Dxyl1-1-F and Dxyl1-1-R and Dxyl1-2-F and Dxyl1-2-R were used for PCR amplification with high-fidelity Prime star GXL DNA polymerase to obtain gene fragments with 20 bp homology arms before and after. The theoretical lengths of the two fragments are 5898 bp and 5966 bp, respectively. The fragment reaction solutions with correct band size verification were purified. NovoRec Plus PCR recombinase reaction system was configured to connect the two target fragments obtained by the above amplification and calcium transfer into E.coli DH10b. Subsequently, single clones were picked on LB-AMP plates for PCR verification. The correct transformant was selected and sequenced to obtain plasmid pCRISPRyl_xyl1.

[0136] 3.2 Construction of YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 engineered bacteria

[0137] The xylose knockout plasmid pCRISPRyl_xyl1 was transformed into competent cells of the corresponding engineering bacteria and incubated at 30°C for 45 minutes. The incubated bacterial solution was spread on YNB solid medium and cultured at 30°C for 2-4 days.

[0138] Single clones were picked to extract the genome, and sequencing primer pairs CX-xyl1-F and CX-xyl1-R were used to sequence clones with frameshift mutations, resulting in engineered bacteria YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 in which the xylose utilization gene xyl1 was knocked out.

[0139] 3.2 Xylose induced fermentation of YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 engineered bacteria

[0140] Xylose-induced fermentation was performed on YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1. Xylose with a final concentration of 2.5 g / L, 5 g / L, 10 g / L, 20 g / L, and 40 g / L was added at 12 h and 24 h, respectively. The results are shown in Figure 8 and Fig. 9shown.

[0141] Figure 8 and Fig. 9 The shake flask fermentation results showed that after knocking out the xylose utilization gene xyl1, compared with the strain without knocking out the xylose utilization gene, the optimal induction concentration of YL-TY-3-Δxyl1 engineered bacteria dropped from 10g / L to 5g / L, while the xylose induction concentration tolerated by YL-TY-4-Δxyl1 engineered bacteria was also higher, and the optimal induction concentration increased from 10g / L to 20g / L; at the same time, because the consumption of xylose stopped, the induction effect was improved. After 120h of shake flask fermentation, the astaxanthin production of YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 engineered bacteria reached 62.76±0.76mg / L and 112.86±6.96mg / L, respectively.

[0142] It is easy for those skilled in the art to understand that in the above embodiments, the key enzymes for astaxanthin synthesis, the coding genes of β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW, the gene hpcrtZ from Haematococcus Pluvialis, the gene pacrtZ from Pantoea ananatis, and the gene pspcrtW from Paracoccus sp. can be codon-optimized according to the preference of the host bacteria to further increase the yield, which is obvious and belongs to the conventional technical means in the art.

[0143] The preferred embodiments of the present invention are described in detail above. It should be pointed out that a person skilled in the art may make several improvements and modifications without departing from the principles of the present invention, and these improvements and modifications also fall within the scope of the present invention.

Claims

1. An engineered Yarrowia lipolytica strain with high carotenoid production, characterized in that: The Yarrowia lipolytica engineered bacterium is obtained by constructing a xylose induction activation system in the Yarrowia lipolytica engineered bacterium XK17 to control the induced expression of key enzymes for astaxanthin synthesis, wherein: The key enzymes for astaxanthin synthesis include β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW.

2. The engineered Yarrowia lipolytica according to claim 1, characterized in that The carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

3. The engineered Yarrowia lipolytica according to claim 2, characterized in that: The β-carotene hydroxylase CrtZ used to produce zeaxanthin is from Pantoea ananatis , with GenBank accession number ADD79330.1; The β-carotene ketolase CrtW used to produce canthaxanthin was from Paracoccus sp. N81106, with GenBank accession number BAE47465.1; The β-carotene ketolase CrtW used to synthesize astaxanthin is from Paracoccus sp. N81106, with GenBank accession number BAE47465.1, and the β-carotene hydroxylase CrtZ is from Haematococcus Pluvialis, with GenBank accession number AKQ20654.

1.

4. The engineered Yarrowia lipolytica according to claim 1, characterized in that: The carotenoid is canthaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene ketolase CrtW derived from Paracoccus sp.

5. The engineered Yarrowia lipolytica according to claim 1, characterized in that The carotenoid is zeaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene hydroxylase CrtZ from Pantoea ananatis.

6. The engineered Yarrowia lipolytica according to claim 1, characterized in that The carotenoid is astaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene ketolase CrtW from Paracoccus sp. and β-carotene hydroxylase CrtZ from Haematococcus Pluvialis, or β-carotene hydroxylase CrtZ from Haematococcus Pluvialis alone.

7. The engineered Yarrowia lipolytica according to claim 6, characterized in that The engineered bacteria further knocked out the xylose utilization gene xyl1.

8. Use of the engineered Yarrowia lipolytica according to any one of claims 1 to 7 for fermentation production of carotenoids.

9. The use according to claim 8, characterized in that: The carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

Images