Non-glutamic acid dependent poly gamma-glutamic acid bacillus licheniformis and application thereof

Abstract

According to the invention, an engineering strain of high-yield poly gamma-glutamic acid (gamma-PGA) bacillus licheniformis, which does not depend on exogenous addition of glutamic acid, is constructed through a gene knockout technology. A carbon metabolism repression protein A gene ccpA for regulating and controlling carbon metabolism on a genome of bacillus licheniformis 285-3 is knocked out in a traceless manner, so that the strain can enhance a carbon metabolism pathway, increase synthesis of a substrate glutamic acid and finally enhance synthesis of gamma-PGA. The gamma-PGA yield of the bacillus licheniformis 285-3 engineering strain constructed by the technology is remarkably increased, and a foundation can be laid for subsequently producing gamma-PGA by utilizing the engineering strain in a way of not depending on exogenous glutamic acid substrate addition. Compared with the original strain 285-3, the strain has the advantages that the gamma-PGA production rate is higher, so that the costs of labor, energy, equipment occupation, loss and the like can be effectively saved, and the gamma-PGA production cost is further reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a non-glutamate-dependent poly-gamma-glutamic acid Bacillus pseudolicheniformis and an application thereof. Background Art

[0002] Poly-γ-glutamic acid (γ-PGA) is formed by condensation of glutamic acid monomers through α-amino and γ-carboxyl groups. A large number of hydrogen bonds can be formed in the molecule, and it has good water solubility. At the same time, the molecule contains a large number of free carboxyl groups. Safety evaluation found that poly-γ-glutamic acid is non-toxic and has good biocompatibility. In the body, γ-PGA is non-ribosomal synthesis and is resistant to common proteases, but the amide bond is easily degraded by γ-PGA degrading enzymes into short peptides or glutamic acid, and has good biodegradability. γ-PGA is a water-soluble anionic polymer with the characteristics of moisture retention, film-forming, high water absorption, degradability, fiber-forming, biocompatibility, edibility and strong adsorption. It has important application prospects and value in agriculture, food, medicine, cosmetics, environmental protection and other aspects.

[0003] Microbial fermentation is the main method for preparing γ-PGA, and the strains used in production are all Bacillus strains. Microorganisms that synthesize γ-polyglutamic acid are divided into glutamate-dependent and glutamate-independent types according to whether they rely on the addition of exogenous sodium glutamate. The former requires the addition of high concentrations of sodium glutamate in the culture medium, but the cost of sodium glutamate is relatively high. The latter does not require the addition of exogenous sodium glutamate, but the yield of γ-PGA is low. There are few glutamate-independent strains reported so far. Glutamate-independent γ-polyglutamate-producing strains rely on their own ability to synthesize glutamate from scratch to synthesize glutamate. De novo synthesis of glutamate generally refers to the process of forming glutamate from a carbohydrate carbon source such as glucose. Glucose produces pyruvate through the glycolysis pathway (EMP pathway), and pyruvate forms acetyl-CoA and then enters the tricarboxylic acid cycle (TCA cycle) to generate α-ketoglutarate, which is catalyzed by aminotransferase or glutamate dehydrogenase / glutamate synthetase to form glutamate. The synthesized glutamate is polymerized and transported by the γ-polyglutamate synthetase multienzyme system to eventually form γ-PGA. The TCA cycle is crucial for the synthesis of glutamate because it provides sufficient ATP, reducing power and α-ketoglutarate.

[0004] Central carbon metabolism mainly includes glycolysis pathway and TCA cycle. Enhancing the intensity of central carbon metabolism can increase the yield of γ-PGA, which is beneficial to increase the yield of γ-PGA. Central carbon metabolism from EMP pathway to TCA cycle is regulated by multiple regulatory proteins such as CcpA, which in turn affects the synthesis of glutamate and γ-PGA. CcpA protein (Catabolite control protein A) is a global regulatory factor responsible for the process of carbon source catabolism. It balances the relationship between carbon metabolism and energy metabolism through the inhibition (CCR) and activation (CCA) of carbon catabolism to achieve the maximum carbon utilization. In the presence of a preferred carbon source such as glucose, there are carbon source catabolism pathways that are dependent on and independent of CcpA protein in Bacillus. The carbon source catabolism pathway that depends on CcpA protein is a complex formed by seryl-phosphorylated HPr protein and CcpA protein and the metabolic response element (Catabolite response element, cre) of the target operon. Studies have shown that CcpA protein promotes the glycolysis process, but inhibits the flow of carbon metabolism to the TCA cycle, which reduces the synthesis rate of intracellular glutamate and the production of γ-PGA. When glucose is present, CcpA can activate the expression of operons such as glm and espA-O, thereby promoting the synthesis of polysaccharides. In order to convert more substrates into the required γ-PGA, knocking out the ccpA gene is an effective method.

[0005] As a high molecular polymer of glutamic acid, γ-PGA is an emerging green biological product with broad application prospects in many fields of production and life. However, the current high cost of producing γ-PGA by microbial fermentation has always been the main factor limiting the widespread application of γ-PGA. Bacillus paralicheniformis is a new species separated from the genus Bacillus in 2015. The present invention uses the non-glutamate-dependent Bacillus paralicheniformis 285-3 with high γ-PGA production potential as the starting strain, and transforms it from the perspective of central carbon metabolism, hoping to guide the central carbon metabolism flow to flow more to the synthesis of γ-PGA, thereby increasing the yield and yield of poly-γ-PGA and effectively reducing the production cost, laying the foundation for the industrial production and application of γ-PGA. The starting strain used was the glutamate-independent γ-PGA high-producing strain Bacillus pseudolicheniformis 285-3, which was screened from the arid soil of the Loess Plateau in Luliang, Shanxi Province, as mentioned in the article "Screening of γ-polyglutamic acid high-yielding strains and study on the effect of improving acidified tobacco-growing soil". Summary of the invention

[0006] The purpose of the present invention is to construct an engineered strain of Bacillus pseudolicheniformis that produces high γ-PGA independently of exogenous addition of glutamate substrate. The engineered strain has the ccpA gene that regulates global carbon metabolism knocked out, and the resulting knockout strain is named 285-3ΔccpA strain.

[0007] The strain 285-3ΔccpA was fermented in a fermentation medium without glutamate for 36 hours, and the γ-PGA yield of the strain 285-3 was 46.43g / L, while the γ-PGA yield of the starting strain 285-3 was 38.63g / L. The γ-PGA yield of 285-3ΔccpA was 20.19% higher than that of 285-3. In a 10L fermenter, the stirring speed was 500rpm, the fermentation temperature was 37℃, the ventilation volume was 8L / min, the initial pH of the fermentation was 7.0, the fermentation system was 7L, and the inoculation amount was 3%. Under these conditions, the γ-PGA yield of the strain 285-3ΔccpA in a fermentation medium without glutamate for 41 hours was 63.86g / L.

[0008] To solve the above technical problems, the purpose of the present invention is achieved as follows:

[0009] The present invention relates to a non-glutamate-dependent poly-γ-glutamic acid Bacillus sp. licheniformis, in which the ccpA gene on the genome of the Bacillus sp. licheniformis engineering strain 285-3 is knocked out, named Bacillus sp. 285-3△ccpA, and deposited in the China Center for Type Culture Collection with a deposit number of CCTCC M 20242408 and a deposit date of October 31, 2024.

[0010] The present invention also relates to a non-glutamate-dependent poly-gamma-glutamic acid Bacillus pseudolicheniformis 285-3ΔccpA and its application in the fermentation production of poly-gamma-glutamic acid.

[0011] Through homologous recombination technology, the ccpA gene involved in the regulation of carbon metabolism in the genome of Bacillus pseudolicheniformis 285-3 strain was knocked out to obtain the corresponding engineered strain.

[0012] Homologous recombination gene knockout technology includes the following steps:

[0013] 1) Cultivate the 285-3 strain and extract the genomic DNA of the cells;

[0014] 2) PCR amplify the two homology arms of the gene to be knocked out and fuse them by SOE PCR;

[0015] 3) The fusion DNA fragment amplified in step 2) is digested with nucleases BamHI and XbaI, and then loaded into a T2 plasmid that has also been digested with BamHI and XbaI to construct a knockout plasmid for homologous recombination;

[0016] 4) The knockout plasmid was transformed into Bacillus pseudolicheniformis 285-3 by electroporation, and positive transformants were screened by kanamycin resistance (20 μg / mL) and PCR;

[0017] 5) The positive transformants were cultured at 45°C for 5 h, then diluted and spread on plates, and colonies with single exchange were screened by PCR;

[0018] 6) The colonies verified to have undergone single exchange in 5) above were cultured in a non-resistant culture medium at 37°C for 24 hours, then diluted and spread on plates, and cultured overnight in a 37°C bacterial incubator until single colonies grew; then single colonies were picked and spotted on resistant LB plates (20 μg / mL kanamycin) and non-resistant LB plates, respectively, and cultured at 37°C for 12 hours, and then single colonies that grew on non-resistant LB plates but could not grow on resistant LB plates were selected; single colonies that could not grow on resistant plates were verified by colony PCR, and colonies that had successfully undergone double exchange were screened, and the colony PCR products were sequenced and compared to further confirm the deletion of the target gene.

[0019] The method for amplifying the homology arm SOE fragment in step 2) is:

[0020] Refer to the whole genome sequence of Bacillus paralicheniformis CBMAI 1303 in NCBI to find the CDS region of the target gene, and extend it to the 5' end and 3' end by about 1000 bp respectively as the design region of the homology arm;

[0021] Primer 5.0 software was used to design and screen primer pairs, which were then synthesized by Sangon Biotech (Shanghai) Co., Ltd.;

[0022] Temperature gradient PCR was performed to verify the optimal annealing temperature of the primer pair, with a central temperature of 50°C and a temperature gradient of ±6°C. 46°C, 48°C, 50°C, 52°C, 54°C and 56°C were selected for temperature gradient PCR;

[0023] Based on the above optimized conditions, PCR was performed with a high-fidelity enzyme at the optimal annealing temperature, the band size was verified by agarose gel electrophoresis, and then purified with a PCR purification kit;

[0024] The purified homologous arm L arm and R arm were used as mixed templates, and the 5' end primer of the L arm and the 3' end primer of the R arm were used as primer pairs. PCR was performed at the optimal annealing temperature. The obtained amplified fragment was verified by agarose gel electrophoresis to be correct in band size and then purified using a PCR purification kit.

[0025] Primers used:

[0026] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0027] ccpA-LR: 5'TGTACCCAGTTGCATCGCATTGAA 3'

[0028] ccpA-RF: 5'TTCAATGCCGATGCAACTGGGTACA 3'

[0029] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0030] The knockout plasmid construction method of step 3) is:

[0031] Plasmid extraction: Escherichia coli containing the T2 plasmid mentioned in the article "Deletion of meso-2,3-butanediol dehydrogenase gene bud C for enhanced D-2,3-butanediol production in Bacillus licheniformis" was inoculated into LB (containing 20 μg / mL kanamycin) liquid culture medium, and then the plasmid was extracted using a plasmid extraction kit.

[0032] Enzyme digestion: The SOE fragment and T2 plasmid prepared above were double digested with two nucleases, BamHI and XbaⅠ, and purified with a purification kit after digestion, and then the band size was verified by agarose gel electrophoresis.

[0033] Enzyme ligation: The SOE fragment and T2 plasmid after enzyme digestion are ligated using T4 DNA ligase.

[0034] The electrotransformation method of Bacillus pseudolicheniformis in step 4) is:

[0035] Preparation of electroporation competent cells of Bacillus pseudolicheniformis 285-3: Inoculate a single colony of 283-3 into 5 mL LB liquid medium and activate overnight at 37°C and 180 rpm in a shaking incubator; take 500 μL of the activated bacterial solution and inoculate it into 50 mL GM growth medium (LB + 0.5 M sorbitol) and culture it in a shaking incubator at 37°C and 180 rpm until OD 600Between 0.95-0.97; after centrifugation at 4°C and 8000rpm for 6min, discard the supernatant, resuspend and wash with 10mL of pre-cooled ETM washing solution (0.5M sorbitol, 0.5M mannitol, 10% glycerol), repeat the operation twice; centrifuge at 4°C and 8000rpm for 6min, discard the supernatant, resuspend with 800μL of ETM washing solution to obtain 285-3 electroporation competent cells, and keep them on ice for use.

[0036] Knockout plasmid electrotransformation of Bacillus pseudolicheniformis 285-3: The knockout plasmid constructed in step 3) was extracted using a plasmid extraction kit; a 0.2 cm electroporation cup and RM recovery culture medium (LB + 0.5 M sorbitol + 0.38 M mannitol) were precooled on ice, and then 10 μL of the constructed knockout plasmid was gently mixed with 100 μL of 285-3 competent cells, added to the electroporation cup, and quickly electroporated once at 2.5 KV, and then gently mixed in 1 mL of precooled RM recovery culture medium, and recovered culture was performed in a shaker at 37°C and 180 rpm for 3 h; after centrifugation at 8000 rpm for 5 minutes, the supernatant was discarded and 100 μL of After resuspending the bacteria in RM recovery culture medium, spread them on LB plates (containing 20 μg / mL kanamycin) and cultured in a 37°C incubator for 24 h; pick all single colonies on the plate for colony PCR verification; verify the band size by agarose gel electrophoresis, and sequence the PCR bands. The sequencing results were compared with the designed fragment sequences by Blast in NCBI to screen 285-3 positive transformants.

[0037] Primers used for colony PCR:

[0038] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0039] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0040] The single exchange verification method of step 5) is:

[0041] A single colony of the positive transformant was inoculated into 5 mL of LB liquid (containing 20 μg / mL kanamycin) medium, and activated and cultured overnight in a shaker at 37°C and 180 rpm; 50 μL of the bacterial solution was transferred to a fresh 5 mL of LB liquid (containing 20 μg / mL kanamycin) medium, and cultured at 42°C and 180 rpm for 5 h; after 10-fold gradient dilution with sterile water, 100 μL of the dilution was spread on an LB plate (containing 20 μg / mL kanamycin), and cultured overnight in a 37°C bacterial incubator until a single colony grew; several single colonies were randomly selected for colony PCR verification of single exchange.

[0042] Primers used for colony PCR:

[0043] ccpA-dan-LF:5'ATCATGACGAGTCCGACAAG 3'

[0044] ccpA-dan-RR:5'TCGAGCCTTAAAAGCCGCC 3'

[0045] The double exchange method of step 6) is:

[0046] The strain that successfully underwent a single exchange was inoculated into 5 mL of non-resistant LB liquid culture medium and cultured at 28°C for 24 h; after diluting it with sterile water in a 10-fold gradient, 100 μL of the diluted bacterial solution was spread on an LB plate (containing 20 μg / mL kanamycin) and cultured overnight in a 37°C incubator until a single colony grew; a single colony was picked and spotted on an LB plate containing 20 μg / mL kanamycin and an LB plate without resistance, and cultured at 37°C for 12 h; a single colony that grew on a non-resistant LB plate but could not grow on an LB plate containing 20 μg / mL kanamycin was selected for colony PCR to verify the occurrence of double exchange; according to the results of PCR amplification, a PCR product that met the target band size was selected, and after sequencing, NCBI Blast comparison was performed based on the sequencing results to verify whether the target gene had been knocked out.

[0047] Primers used for colony PCR:

[0048] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0049] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0050] The main advantages of the present invention are:

[0051] 1. At present, the strains used in the fermentation production of γ-PGA are all strains that rely on the addition of exogenous glutamate. Due to the high price of glutamate, the raw material cost of γ-PGA fermentation production has increased significantly, which limits the promotion and application of γ-PGA, especially the large-scale application in the agricultural field. The present invention uses a gene knockout method to knock out the ccpA gene that regulates the carbon metabolism of Bacillus. The obtained engineered strain of Bacillus pseudolicheniformis 285-3 has a γ-PGA yield of more than 60g / L in a culture medium without the addition of exogenous glutamate, which greatly reduces the fermentation production cost of γ-PGA.

[0052] 2. Compared with the starting strain 285-3, the engineered strain 285-3ΔccpA provided by the present invention has a higher γ-PGA production rate, thereby effectively saving costs such as labor, energy, equipment occupancy and loss, thereby further reducing the production cost of γ-PGA. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 : It is the homologous recombination knockout of the gene in the present invention, and the PCR amplification of the L arm and the R arm of the target gene; L1-L6 are the amplified L arms, and R1-R6 are the amplified R arms.

[0054] Figure 2 : PCR verification of knockout plasmid electroporation into Bacillus licheniformis 285-3; Lane 6 is a positive transformant with a size of about 1000 bp.

[0055] Figure 3 : Blast alignment of the sequencing results of double-exchange PCR amplified fragments. The missing part in the middle is the knocked-out ccpA gene sequence. Figure 4 : It is the γ-PGA yield of the central carbon metabolism pathway enhanced knockout bacteria 285-3ΔccpA in the present invention in shake flask culture in basic culture medium.

[0056] Figure 5 : It is the yield of γ-PGA in the shake flask culture of the central carbon metabolism pathway enhanced knockout bacteria 285-3ΔccpA in the fermentation medium in the present invention.

[0057] Figure 6 : is the yield of γ-PGA of the central carbon metabolism pathway enhanced knockout bacteria 285-3ΔccpA in the present invention cultured in a 10L fermenter in a fermentation medium. DETAILED DESCRIPTION

[0058] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0059] Example 1

[0060] 1. Gene knockout

[0061] Extraction of genomic DNA of Bacillus pseudolicheniformis 285-3: inoculate a single colony of 285-3 into 5 mL of LB liquid culture medium and activate it overnight in a shaker at 37°C and 180 rpm; take 1 mL of the activated bacterial solution into a 1.5 mL centrifuge tube, centrifuge it at 12000 rpm for 1 min, discard the supernatant and add 500 μL of ultrapure water to resuspend the bacteria; boil it in a boiling water bath for 10 min, centrifuge it at 12000 rpm for 1 min, and the supernatant is the total genomic DNA of Bacillus pseudolicheniformis, which is stored at 4°C.

[0062] PCR amplification of the homologous L and R arms of the target gene: refer to the whole genome sequence of Bacillus paralicheniformis CBMAI 1303 in NCBI, find the CDS region of the target gene, and extend it to the 5' end and 3' end by about 1000bp respectively as the design region of the homologous arms; use Primer 5.0 software to design and screen primers; temperature gradient PCR to verify the optimal annealing temperature of the primers, select the central temperature of 50℃, the temperature gradient of ±6℃, and select 46℃, 48℃, 50℃, 52℃, 54℃ and 56℃ for temperature gradient PCR; on the basis of the above optimized conditions, perform PCR at the optimal annealing temperature with a high-fidelity enzyme, verify the band size by agarose gel electrophoresis, and then purify the DNA fragments amplified by PCR with a PCR purification kit.

[0063] SOE-PCR fragment amplification: Use the purified homologous arm L arm and R arm as a mixed template, the 5' end primer of the L arm and the 3' end primer of the R arm as a primer pair, perform PCR at the optimal annealing temperature, and purify the obtained amplified fragment using a PCR purification kit after verifying the correct band size by agarose gel electrophoresis.

[0064] Extract T2 plasmid vector: Inoculate a single colony of E. coli containing T2 plasmid into 5 mL of LB medium (containing 20 μg / mL kanamycin) and activate it overnight in a shaker at 37°C and 180 rpm; use a plasmid extraction kit to extract plasmid from the activated bacterial solution, and use agarose gel electrophoresis to verify whether the band size is correct.

[0065] Double enzyme digestion: The SOE-PCR fragment and T2 plasmid were double-digested with BamHⅠ and XbaⅠ; after digestion, they were purified with a PCR purification kit, and then agarose gel electrophoresis was used to verify whether the band size was correct.

[0066] Enzyme ligation: The fragments after the above enzyme cutting are ligated with T4 DNA ligase to obtain the recombinant plasmid for knocking out the gene.

[0067] Preparation of DH5α competent cells: Inoculate a single DH5α colony into 5 mL LB liquid medium and activate it overnight in a shaker at 37°C and 180 rpm; take 50 μL of the activated bacterial solution and inoculate it into fresh 5 mL LB liquid medium and culture it in a shaker at 37°C and 180 rpm until OD 600 ≈0.48; take 1mL of bacterial solution into a 1.5mL centrifuge tube, centrifuge at 4℃, 5000rpm for 5min, and discard the supernatant; gently resuspend the bacteria with 1mL of sterile CaCl2 solution (0.1mol / L) precooled on ice, centrifuge at 4℃, 5000rpm for 5min, discard the supernatant, repeat the operation twice; gently resuspend the bacteria with precooled CaCl2 solution to obtain DH5α competent cells, and keep them on ice for use.

[0068] Knockout plasmid transformation DH5α: Gently mix the above 10 μL enzyme-linked product with 100 μL DH5α competent cells; let it stand on ice for 20 minutes, then place it in a 42°C water bath for 90 seconds, and then quickly let it stand on ice for 3 minutes; add 800 μL of new LB liquid culture medium, resuscitate and culture in a shaker at 37°C and 180 rpm for 45 minutes, and then centrifuge at 4000 rpm for 5 minutes; discard part of the supernatant, keep about 100 μL of resuspended cells and spread them on LB (containing 20 μg / mL kanamycin) plates, and place them in a 37°C bacterial incubator until single colonies grow; randomly select single colonies for colony PCR verification; agarose gel electrophoresis verifies that the band size is correct and then sequenced, and the sequencing results are compared with the designed fragment sequence in NCBI by Blast to verify the successful transformation of the recombinant plasmid.

[0069] Preparation of competent cells of Bacillus pseudolicheniformis 285-3: Inoculate a single colony of 285-3 into 5 mL LB liquid medium and activate overnight in a shaker at 37°C and 180 rpm; take 500 μL of the activated bacterial liquid and inoculate it into 50 mL GM growth medium and culture it in a shaker at 37°C and 180 rpm until OD 600 =0.95-0.97, dispense into two pre-sterilized and pre-cooled 50 mL centrifuge tubes, 20 mL in each tube, and place on ice for 30 min; centrifuge at 4°C and 8000 rpm for 6 min, discard the supernatant, resuspend and wash with 10 mL of pre-cooled ETM washing solution, repeat the operation twice; centrifuge at 4°C and 8000 rpm for 6 min, discard the supernatant, resuspend with 800 μL of ETM washing solution to obtain 285-3 electroporation competent cells, and place on ice for use.

[0070] Knockout plasmid electrotransformation of Bacillus pseudolicheniformis 285-3: The knockout plasmid constructed above was extracted using a plasmid extraction kit; a 0.2 cm electroporation cup and RM recovery culture medium were precooled on ice, 10 μL of the recombinant plasmid and 100 μL of the competent cells were gently mixed, added to the electroporation cup, and quickly electroporated once at 2.5 KV, and then gently mixed in 1 mL of precooled RM recovery culture medium, and recovered and cultured in a shaker at 37°C and 180 rpm for 3 h; after centrifugation at 8000 rpm for 5 minutes, the supernatant was discarded, the bacteria were resuspended in 100 μL of RM recovery culture medium and then spread on an LB plate (containing 20 μg / mL kanamycin), and cultured in a 37°C bacterial incubator for 24 h; all single colonies on the plate were picked for colony PCR verification; the band size was verified by agarose gel electrophoresis and sequencing was performed, and the sequencing results were compared with the designed fragment sequence in NCBI by Blast to screen positive transformants.

[0071] Single exchange: Inoculate a single colony of a positive transformant into 5 mL of LB liquid (containing 20 μg / mL kanamycin) medium, and activate the culture overnight in a shaker at 37°C and 180 rpm; transfer 50 μL of the bacterial solution into fresh 5 mL of LB liquid (containing 20 μg / mL kanamycin) medium, and culture at 42°C and 180 rpm for 5 h; dilute the culture with sterile water in a 10-fold gradient to 10 -5 , 10 -6 , 100 μL was spread on LB plates (containing 20 μg / mL kanamycin) and cultured overnight in a 37°C bacterial incubator until a single colony grew; single colonies were randomly selected for colony PCR verification of single exchange.

[0072] Double exchange: Inoculate the strain that has successfully undergone single exchange into 5 mL of LB liquid medium without resistance and culture at 28°C for 20-24 hours; dilute with sterile water in a 10-fold gradient to 10 -5 , 10 -6 , 100 μL was spread on LB plates (containing 20 μg / mL kanamycin) and cultured overnight in a 37°C bacterial incubator until a single colony grew; a single colony was picked and spotted on an LB plate containing 20 μg / mL kanamycin and an LB plate without resistance, and cultured at 37°C for about 12 hours, and a single colony that grew on an LB plate without resistance but could not grow on an LB plate containing 20 μg / mL kanamycin was selected for colony PCR to verify the occurrence of double exchange; according to the results of PCR amplification, a PCR product that met the target band size was selected for sequencing, and NCBI Blast comparison was performed based on the sequencing results to verify whether the target gene had been knocked out.

[0073] Primers used for amplification of homology arms and SOE-PCR:

[0074] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0075] ccpA-LR: 5'TGTACCCAGTTGCATCGCATTGAA 3'

[0076] ccpA-RF: 5'TTCAATGCCGATGCAACTGGGTACA 3'

[0077] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0078] Primers used for screening positive transformant colonies of Bacillus pseudolicheniformis by PCR:

[0079] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0080] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0081] Primers used for single crossover colony PCR:

[0082] ccpA-dan-LF:5'ATCATGACGAGTCCGACAAG 3'

[0083] ccpA-dan-RR:5'TCGAGCCTTAAAAGCCGCC 3'

[0084] Primers used for double-crossover colony PCR:

[0085] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0086] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0087] Example 2

[0088] 1. Shake flask fermentation

[0089] Activation of bacterial strains: Pick a freshly cultured single colony from the LB plate, inoculate it into 5 mL of LB liquid culture medium, and culture it overnight at 37°C and 180 rpm in a shaker for 12 hours.

[0090] Seed solution preparation: 50 μL of bacterial solution was transferred to new 5 mL LB liquid medium and cultured in a shaker at 37°C and 180 rpm for 10 h as the fermentation seed solution.

[0091] Shake flask fermentation culture: Take 1.5mL of seed liquid and inoculate it into a 250mL shake flask containing 50mL of basic culture medium, and ferment and culture it in a shaker at 37℃ and 180rpm for 36h. Basic culture medium formula (1L): 30g of industrial sodium citrate, 12g of industrial sodium nitrate, 8g of ammonium chloride, 0.5g of dipotassium hydrogen phosphate trihydrate, 1g of magnesium sulfate heptahydrate, 0.08g of ferric chloride hexahydrate, 0.3g of anhydrous calcium chloride, 0.05g of manganese sulfate monohydrate, dilute to 800mL with distilled water, adjust pH to 7.40, sterilize at 115℃ for 30 minutes; 70g of food-grade glucose is fully dissolved in 200mL of distilled water and sterilized separately at 115℃ for 30 minutes.

[0092] 2. Fermentation tank culture

[0093] Activation of strains: Pick a freshly cultured single colony from the LB plate, inoculate it into 25 mL of LB liquid culture medium, and activate it overnight in a shaker at 37°C and 180 rpm for 16 hours.

[0094] Preparation of seed solution: 2.1 mL of the above bacterial solution was transferred to 210 mL of fresh LB liquid culture medium and cultured in a shaker at 37°C and 180 rpm for 10 h to obtain fermentation seed solution.

[0095] Fermentation culture in a fermenter: Take 210 mL of seed liquid and inoculate it in a 10 L fermenter containing 7 L of fermentation medium, and ferment for 41 h at 37 ° C, 500 rpm, and 8 L / min of ventilation. Formula of fermentation medium (1 L): 45 g of industrial sodium citrate, 21 g of industrial sodium nitrate, 12 g of ammonium chloride, 0.5 g of dipotassium hydrogen phosphate trihydrate, 1 g of magnesium sulfate heptahydrate, 0.08 g of ferric chloride hexahydrate, 0.3 g of anhydrous calcium chloride, and 0.05 g of manganese sulfate monohydrate. Use distilled water to make up to 800 mL, adjust pH to 7.40, and sterilize at 115 ° C for 30 minutes; 87.5 g of food-grade glucose is fully dissolved in 200 mL of distilled water and sterilized separately at 115 ° C for 30 minutes.

[0096] Example 3

[0097] 1. Drawing of γ-PGA standard curve

[0098] (1) Accurately weigh 0.25 g of γ-PGA standard, fully dissolve it in distilled water, and then use a 250 mL volumetric flask to make a 1 g / L γ-PGA standard solution;

[0099] (2) Take 25 mL of the above solution and dilute it again with distilled water in a 250 mL volumetric flask to obtain a 100 mg / L γ-PGA standard solution;

[0100] (3) Accurately measure 8 mL, 16 mL, 24 mL, 32 mL and 40 mL of the above solution and dilute to volume with distilled water in a 100 mL volumetric flask to obtain 8 μg / mL, 16 μg / mL, 24 μg / mL, 32 μg / mL and 40 μg / mL γ-PGA standard solutions;

[0101] (4) Take 2 mL of γ-PGA standard solution of different concentrations, add 2 mL of CTAB reagent (5 g / L) and start timing; slowly invert and mix for 30 seconds (try to minimize foaming), let it stand for 6 minutes and 30 seconds, and read the A value using a UV spectrophotometer. 250 Value; For blank control, 2 mL of γ-PGA standard solution was replaced with 2 mL of distilled water, and other operations remained unchanged;

[0102] (5) With the concentration of γ-PGA standard solution as the horizontal axis, A 250 The numerical value is used as the ordinate to obtain a scatter plot, and a linear regression fit is performed to obtain the linear regression equation.

[0103] 2. Quantitative detection of γ-PGA

[0104] The CTAB (cetyltrimethylammonium bromide) turbidimetric method was used. The specific steps are as follows:

[0105] (1) Take 2 mL of fermentation broth into a 2 mL centrifuge tube and centrifuge at 4°C and 12000 rpm for 20 min;

[0106] (2) Take 500 μL of the supernatant and add it to a 2 mL centrifuge tube. Then add 1.5 mL of anhydrous ethanol, shake vigorously, and place in a 4 °C refrigerator for more than 1 h.

[0107] (3) Centrifuge at 12000 rpm for 5 min at room temperature, discard the supernatant, and place in an oven at 65°C for more than 3 h to constant weight;

[0108] (4) Add 1 mL of ultrapure water and let stand overnight at room temperature to fully dissolve, and dilute with ultrapure water to an appropriate multiple as the test solution;

[0109] (5) Take 2 mL of the test solution, add 2 mL of CTAB (5 g / L) reagent, and start timing; slowly invert upside down to mix for 30 seconds (try to minimize foaming), let it stand for 6 minutes and 30 seconds, and read the A250 value using a UV spectrophotometer; for the blank control, replace 2 mL of the test solution with 2 mL of distilled water, and keep other operations unchanged;

[0110] (6) The measured sample A 250 The value of γ-PGA in the sample was obtained by using the standard curve mentioned above.

[0111] The preferred specific embodiments of the present invention are described in detail above. It should be understood that a person skilled in the art can make many modifications and changes based on the concept of the present invention without creative work. Therefore, any technical solution that can be obtained by a person skilled in the art through logical analysis, reasoning or limited experiments based on the concept of the present invention on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A glutamate-independent poly-γ-glutamic acid bacillus licheniformis, characterized in that: The ccpA gene on the genome of the engineered strain 285-3 of Bacillus licheniformis was knocked out and named 285-3ΔccpA. It was deposited in the China Center for Type Culture Collection with the deposit number CCTCC M 20242408 and the deposit date was October 31, 2024.

2. Use of the glutamate-independent poly-γ-glutamic acid Bacillus pseudolicheniformis 285-3ΔccpA according to claim 1 in the fermentation production of poly-γ-glutamic acid.

Images