Construction method and application of dystocia mouse model
Exon 2 of the Col24a1 gene was knocked out through CRISPR/Cas9 technology, and a mouse model with Col24a1 deletion was constructed, which solved the problem that the existing technology was difficult to build a mouse model of difficult labor, and achieved in-depth research and treatment screening of the mechanism of difficult labor.
Patent Information
- Application Number
- CN202510136944.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-07
- Publication Date
- 2025-05-23
AI Technical Summary
The existing technology is difficult to build a mouse model that shows the clinical characteristics of difficult labor and the pathogenesis of humans, which limits the in-depth study of the difficult labor mechanism.
By designing gRNAs targeting the Col24a1 gene, using CRISPR/Cas9 technology to knock out Exon 2 of the Col24a1 gene, a mouse model with Col24a1 deletion showed a high difficulty yield.
The constructed mouse model can effectively simulate the difficult labor process, provide a reliable animal model to study the trigger mechanism of difficult labor and screen therapeutic drugs, improving research efficiency.
Smart Images
Figure CN120026024A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for constructing a dystocia mouse model and application thereof. Background Art
[0002] Dystocia refers to the inability of the fetus to pass smoothly through the birth canal during labor due to factors such as fetal size, malposition, maternal pelvic constriction, and weak uterine contractions. This not only threatens the health of both mother and child but can also lead to serious medical consequences. With advances in medical technology, efforts to reduce the incidence of dystocia have evolved from traditional midwifery techniques to include ultrasound diagnosis, mating at maturity, and cesarean sections. While these techniques can reduce dystocia rates and improve maternal and fetal safety, they do not allow for in-depth understanding of the mechanisms underlying dystocia. Mouse models, which mimic pathological processes through specific experimental methods and procedures, are widely used to study disease mechanisms and identify interventions due to their high operability and reproducibility, shortening research cycles and improving research efficiency. Therefore, developing animal models based on the clinical characteristics of dystocia that align clinical presentation with human pathogenesis remains a key and challenging area of research.
[0003] COL24A1 is a gene belonging to the collagen family. Its expression product is collagen XXIVα1 chain. It is highly expressed in the female reproductive system and is thought to regulate the formation of type I collagen fibrils during fetal development. Currently, research on COL24A1 focuses on its role in hepatocellular carcinoma and its role in osteoblast differentiation and mineralization. There are currently no studies on COL24A1 in the field of dystocia.
[0004] Therefore, if a mouse model for dystocia can be designed based on COL24A1, it will be beneficial for in-depth research on the triggering mechanism of dystocia. Summary of the Invention
[0005] To address the shortcomings of the existing technology, the present invention designed a gRNA targeting the Col24a1 gene, and used the gRNA to guide the Cas9 nuclease to knock out Exon 2 of the Col24a1 gene, thereby constructing a Col24a1-deficient mouse model. This mouse model shows a high rate of dystocia, providing a reliable animal model for further research on the triggering mechanism of dystocia.
[0006] In order to achieve the above purpose, the present invention solves the technical problem by adopting the following technical solutions:
[0007] In a first aspect, the present invention provides a gRNA for constructing a dystocia mouse model, wherein the target site region of the gRNA is the exon2 region of the Col24a1 gene, and the nucleotide sequence of the gRNA is shown in SEQ ID No. 1-2, specifically as follows:
[0008] 5'-AGTTACACGATTTGTCAGTTGGG-3' (SEQ ID NO. 1); 5'
[0009] -TGATGTGCAGCATCCGCAATGG-3' (SEQ ID NO. 2).
[0010] In a second aspect, the present invention provides a method for constructing a dystocia mouse model, the construction comprising the following steps:
[0011] S1. Synthesize gRNA based on the target sequence region of the exon2 region of the Col24a1 gene;
[0012] S2. Introducing the Cas9 nuclease and gRNA into mouse fertilized eggs, identifying and screening to obtain F0 generation positive mice, and then hybridizing the F0 generation positive mice with wild-type mice to identify and screen to obtain F1 generation positive mice;
[0013] S3. Mating F1 heterozygous female mice with F1 heterozygous male mice, identifying and screening to obtain homozygous female mice, which is the dystocia mouse model.
[0014] In some embodiments, the gRNA includes gRNA1 and gRNA2, the nucleotide sequence of the gRNA1 is shown as SEQ ID No.1, and the nucleotide sequence of the gRNA2 is shown as SEQ ID No.2.
[0015] Specifically, the nucleotide sequence of the gRNA1 is 5'-AGTTACACGATTTGTCAGTTGGG-3'; the nucleotide sequence of the gRNA2 is 5'-TGATGTGCAGCATCCGCAAATGG-3'.
[0016] In some embodiments, the nucleotide sequence of the gRNA target sequence is shown as SEQ ID No. 3.
[0017] In some embodiments, the nucleotide sequences of the specific primers for identifying F0 generation positive mice are shown as SEQ NO.4 and SEQ NO.5.
[0018] In some embodiments, in step S2, the F0 generation positive mouse lacks the nucleotide sequence shown in SEQ NO. 8, and the sequence length is 319 bp.
[0019] In some of the embodiments, the nucleotide sequences of the specific primers for identifying F1 generation positive mice are shown as SEQ NO.11, SEQ NO.12, SEQ NO.13 and SEQ NO.14.
[0020] In some embodiments, the method of introduction is microinjection.
[0021] In a third aspect, the present invention provides a dystocia mouse model, which is constructed by the dystocia mouse model construction method.
[0022] In some embodiments, the present invention provides the use of the dystocia mouse model in studying the triggering mechanism of dystocia or screening drugs for treating dystocia.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] The present invention constructs a Col24a1 gene knockout mouse model based on CRISPR / Cas9 technology. The pelvic diameter of the female mouse model is significantly smaller than that of wild-type female mice, and after mating with wild-type male mice, it shows a dystocia rate as high as 72%.
[0025] The construction method of the present invention is simple and has a high success rate. The constructed mouse model can be used to study the triggering mechanism and treatment of dystocia, etc., which is beneficial to the development of mouse models.
[0026] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be obvious from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the technical solution of the present invention, the following is a brief introduction to the drawings required for use in the implementation. Obviously, the drawings described below are only some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0028] Figure 1 This is a diagram of the Col24a1 knockout strategy for the dystocia mouse model in an embodiment of the present invention.
[0029] Figure 2 It is the Sanger sequencing diagram of wild-type C57BL / 6J mice (WT) and Col24a1-KO (KO) mice in the examples of the present invention.
[0030] Figure 3This is a diagram showing the PCR electrophoresis results of homozygous mice produced after mating an F1 generation heterozygous female mouse with an F1 generation heterozygous male mouse in an embodiment of the present invention. In the diagram, (1) is an identification diagram for specific primers P1 and P2; and (2) is an identification diagram for specific primers P3 and P4.
[0031] Figure 4 The figures are graphs showing the dystocia test results of the wild-type C57BL / 6J female mouse (WT) and Col24a1 female mouse models in the embodiments of the present invention, wherein: (1) is a statistical graph showing the dystocia test results of the mouse model; and (2) is a real-life picture showing the dystocia test results of the mouse model.
[0032] Figure 5 The wild-type female mice (WT) and Col24a1 gene knockout female mice (Col24a1 - / - )'s weight, mid-pelvic plane diameter, pelvic inlet plane diameter, and pelvic outlet plane diameter test results diagram. DETAILED DESCRIPTION
[0033] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0034] In the present invention, when referring to numerical ranges, unless otherwise specified, the numerical ranges are considered continuous and include the minimum and maximum values of the range, as well as every value between such minimum and maximum values. Furthermore, when a range refers to an integer, every integer between the minimum and maximum values of the range is included. In addition, when multiple ranges are provided to describe a feature or characteristic, the ranges can be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges subsumed therein.
[0035] In the present invention, the test methods used are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.
[0036] In the present invention, the term "CRISPR-Cas9 technology" used is a gene editing technology that uses artificially designed sgRNA (guide RNA) to identify the target genomic sequence and guide the Cas9 protease to effectively cut the DNA double strands, forming double-strand breaks. Post-damage repair will cause gene knockout or knockin, ultimately achieving the purpose of modifying genomic DNA.
[0037] In the present invention, the term "gRNA" is a non-coding RNA molecule widely used in gene editing technology, which is mainly used to guide nucleases (such as Cas9) to accurately identify and cut target DNA sequences. In some embodiments, the gRNA of the present application is 23 nucleotides in length.
[0038] In the present invention, the term "microinjection" is a technique for precisely injecting substances (such as genes, drugs, cells or other biological molecules) into cells, tissues or organisms through a fine injection needle under a microscope.
[0039] As used herein, the term "gene knockout" refers to a genetic engineering technique that specifically disables the function of a target gene, thereby studying its role in an organism. Depending on the scope and method of knockout, these techniques can be categorized as complete knockout, conditional knockout, tissue-specific knockout, and inducible knockout. In some embodiments, the gene knockout described herein involves complete knockout of the Col24a1 gene using CRISPR / Cas9 technology.
[0040] Example 1: Construction of Col24a1 knockout mice
[0041] 1. Col24a1 gene knockout strategy:
[0042] like Figure 1 As shown, according to the Col24a1 gene, a guide RNA target site was designed in the exon2 region, and gRNA was obtained by in vitro transcription. Then, the exon2 region of the Col24a1 gene was knocked out by CRISPR / Cas9 technology to construct a Col24a1 gene deletion model.
[0043] Col24a1 (Ensembl number: ENSMUSG00000028197, http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?g=ENSMUSG00000028197; r=3:144998233-145257766).
[0044] Transcript: Col24a1-201 (Ensembl number: ENSMUST00000029848.5).
[0045] 2. Select the target sequence in the exon2 region of the Col24a1 gene (SEQ ID NO. 3) and perform in vitro transcription to obtain guide RNA targeting the Col24a1 gene (synthesized by Shanghai Model Organisms Technology Co., Ltd.) ， The sequence information of gRNAs is shown in Table 1.
[0046] Target sequence: 5'-AGTTACACGATTTGTCAGTTGGGAATGTCTAACAGTTGCTTATTCCTCCCTTAGGAAACTGTTTCTTCGCTTTATTGTACTATGTGTGGTGTGGATTTCTGTTCATGCACAGGGACAAGGTAAGTGGAACTATCTCGTTACTTGTTTTTACGATTATTTCTGAGCTGAGAA TGGTAACATAAGCTGGAAGCCTTGGCCTGCTGAGAAAAGAGACAGGAAGATAGGATGCTCCAAACAAGTGTGATAGTTATTTTTCTAATCACTGTGGCAGAATTCATGAAAAAGGCCACTTAAGAAAGGATGTGTTCATTTGGCCTTGCCATTTGCGGATGCTGCACATCA-3'(SEQ ID NO.3).
[0047] Table 1 gRNAs sequence information
[0048] gRNA Sequence(5'→3') gRNA1 AGTTACACGATTTGTCAGTTGGG(SEQ ID NO.1) gRNA2 TGATGTGCAGCATCCGAAATGG(SEQ ID NO.2)
[0049] 3. Acquisition and identification of F0 mice
[0050] In vitro transcribed gRNA1, gRNA2, and Cas9 nuclease mRNA were microinjected into fertilized eggs of C57BL / 6J wild-type (WT) mice. The injected fertilized eggs were then transplanted into the uterus of pseudopregnant female mice. Pregnancy and littering were achieved, resulting in F0 generation mice. The genotypes of these F0 generation mice were identified by PCR and Sanger sequencing. F0 generation mice (F0) served as the experimental group, and wild-type C57BL / 6J mice (WT) served as the control group.
[0051] Table 2 Primer information used for PCR identification of F0 generation mice
[0052]
[0053]
[0054] Table 3 Reaction system used for identification of F0 generation mice
[0055]
[0056] Table 4 Reaction program used for identification of F0 generation mice
[0057]
[0058] Table 5 Sequence mutation of F0 generation mice
[0059]
[0060]
[0061]
[0062] Note: "-319bp" in the table refers to the length of the knocked-out sequence.
[0063] As shown in Table 5, the sequencing results show that, compared with wild-type mice, the F0 generation mice had a 319 bp deletion of the sequence shown in SEQ ID NO. 8.
[0064] GATTTGTCAGTTGGGAATGTCTAACAGTTGCTTATTCCTCCCTTAGGAAACTGTTTCTTCGCTTTATTGTACTATGTGTGGTGTGGATTTCTGTTCATGCACAGGGACAAGGTAAGTGGAACTATCTCGTTACTTGTTTTTACGATTATTTCTGAGCTGAG AATGGTAACATAAGCTGGAAGCCTTGGCCTGCTGAGAAAAGAGACAGGAAGATAGGATGCTCCAAACAAGTGTGATAGTTATTTTTCTAATCACTGTGGCAGAATTCATGAAAAAGGCCACTTAAGAAAGGATGTGTTCATTTGGCCTTGCCATTTGC(SEQ ID NO.8).
[0065] 4. Acquisition and identification of F1 generation mice
[0066] The correctly identified F0 generation mice were mated with wild-type C57BL / 6J mice to obtain F1 generation heterozygous mice. The genotype of the F1 generation mice was identified by PCR and Sanger sequencing, and the required F1 generation heterozygous mice of 6-8 weeks of age were selected. The Sanger sequencing diagram of wild-type C57BL / 6J mice (WT) and Col24a1-KO (KO) mice is shown in the figure below. Figure 2 As shown in the figure, the query is the wild-type C57BL / 6J mouse gene sequence, and the subject is the Col24a1-KO mouse sequencing result. F1 mice were set as the experimental group and wild-type C57BL / 6J mice as the control group.
[0067] Table 6 Theoretical gene sequence alignment before and after knockout
[0068]
[0069]
[0070] Note: "-319 bp" in the table refers to the length of the knocked-out sequence, and its nucleotide sequence is the sequence shown in SEQ ID NO.8 above.
[0071] Table 7 PCR identification primer information for F1 generation heterozygous mice
[0072]
[0073]
[0074] Table 8 PCR identification reaction system of F1 generation heterozygous mice
[0075]
[0076] Table 9 PCR identification reaction procedure of F1 generation heterozygous mice
[0077]
[0078] The PCR amplified products were subjected to agarose gel electrophoresis. Figure 3 As shown, F1 mice were identified by PCR product size.
[0079] Genotype determination criteria:
[0080] Wild type: Primers P1 and P2 can obtain a single 795 bp band by PCR amplification (optional); primers P3 and P4 can obtain a 507 bp band.
[0081] Heterozygotes: Primers P1 and P2 were used to obtain two fragments of 795 bp (optional) and 475 bp by PCR amplification; primers P3 and P4 could obtain a 507 bp band.
[0082] Homozygotes: Primers P1 and P2 obtained a single 475 bp fragment by PCR amplification; primers P3 and P4 did not produce any bands.
[0083] 5. Obtaining and identifying the genotypes of F1 generation mouse offspring
[0084] The F1 heterozygous female mice identified above were mated with F1 heterozygous male mice to obtain homozygous mice. The genotypes of the offspring mice were determined by PCR, and the desired homozygous mice, aged 6-8 weeks, were selected. The PCR primer information and reaction system were the same as those used for F1 mouse identification.
[0085] Example 2: Analysis of the dystocia phenotype of Col24a1-KO female mice
[0086] 1. Female Wt mice (n=16) born at the same time and aged 6-8 weeks, Col24a1 - / - Mice (n=25) and Col24a1 + / - Mice (n=22) were placed in fertility test cages at a sex ratio of male to female = 1:2. Male mice were 9-12 week old C57BL / 6J strain Wt mice.
[0087] 2. The mice in each group were put into cages at 5-6 pm on the first day and vaginal plugs were checked at 7-8 am on the second day. If vaginal plugs were found, fertilization was considered and recorded as GD 0.5.
[0088] 3. On the 10th day after cage combination, observe the abdomen of each group of female mice. If there is obvious distension, use the fetal palpation method and gently touch the mouse's abdomen. If a soybean-sized embryo is clearly palpated, it is considered that the pregnancy is successful and the female mouse should be raised in a separate cage until delivery.
[0089] 4. Record the delivery conditions, dystocia rate, total live births, total litter parities, average litter size, and birth weight of the pups in each group for each group of female mice at 6 months of age. Take photos and record any abnormal delivery conditions.
[0090] Table 10 Fertility test results of female mice of different genotypes
[0091]
[0092] In the table, Wt is wild-type mouse; Col24a1 - / - Homozygous mice; Col24a1 + / - Heterozygous mice.
[0093] As shown in Table 10 and Figure 4 As shown, Col24a1 - / - Most of the female mice in the group suffered from fatal dystocia, with a dystocia rate as high as 72%, showing obstructive dystocia, such as Figure 4 As shown, the Wt group and Col24a1 + / - No dystocia occurred in the mice of the two groups, and it was found that Col24a1 - / - The dystocia phenotype of female mice in the group was significant.
[0094] Then by Figure 5 It can be seen that the weight of wild-type mice and dystocia mice is basically the same, but the pelvic diameter of dystocia mice is significantly smaller than that of normal mice. In practical applications, microCT technology can be used to observe the pelvic diameter of non-pregnant mice to determine the tendency of dystocia.
[0095] In summary, the present invention provides a method for constructing a dystocia mouse model based on CRISPR / Cas9 gene knockout technology. First, gRNA1 and gRNA2 are designed, and then gRNA1, gRNA2, and Cas9 nuclease are injected into mouse fertilized eggs to obtain F0 generation mice. The F0 generation mice are then mated with wild-type mice and homozygous mice, i.e., F1 generation heterozygous mice, are screened. The F1 generation heterozygous female mice are mated with F1 generation heterozygous male mice, and homozygous mice are identified and screened to obtain Col24a1 knockout mice. The method of the present invention achieves complete knockout of the Col24a1 gene for the first time, and the constructed mice show a stable dystocia phenotype, indicating that knockout of the Col24a1 gene will lead to a higher dystocia rate in mice. The constructed dystocia mouse model is of great significance for the study of the mechanism of dystocia and clinical practice, and also provides a new direction for the research and development of mouse models.
[0096] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.
Claims
1. A gRNA for constructing a dystocia mouse model, characterized in that: The target site region of the gRNA is the exon2 region of the Col24a1 gene, and the nucleotide sequence of the gRNA is shown in SEQ ID No.1-2.
2. A method for constructing a dystocia mouse model, characterized in that: The construction includes the following steps: S1. Synthesize gRNA according to the target sequence of the exon2 region of the Col24a1 gene; S2. Introducing Cas9 nuclease and gRNA into mouse fertilized eggs, identifying and screening to obtain F0 generation positive mice, and then hybridizing the F0 generation positive mice with wild-type mice, identifying and screening to obtain F1 generation positive mice; S3. F1 heterozygous female mice are mated with F1 heterozygous male mice, and homozygous female mice are identified and screened to obtain the dystocia mouse model.
3. The method for constructing a dystocia mouse model according to claim 2, characterized in that: The gRNA includes gRNA1 and gRNA2, the nucleotide sequence of the gRNA1 is shown as SEQ ID No.1, and the nucleotide sequence of the gRNA2 is shown as SEQ ID No.
2.
4. The method for constructing a dystocia mouse model according to claim 2, characterized in that: The nucleotide sequence of the target sequence is shown in SEQ ID No.
3.
5. The method for constructing a dystocia mouse model according to claim 2, characterized in that: The nucleotide sequences of the specific primers for identifying F0 generation positive mice are shown in SEQ NO.4 and SEQ NO.
5.
6. The method for constructing a dystocia mouse model according to claim 2, characterized in that: In step S2, the F0 generation positive mouse lacks the nucleotide sequence shown in SEQ NO.8, and the sequence length is 319 bp.
7. The method for constructing a dystocia mouse model according to claim 2, characterized in that: The nucleotide sequences of the specific primers for identifying F1 generation positive mice are shown in SEQ NO.11, SEQ NO.12, SEQ NO.13 and SEQ NO.
14.
8. The method for constructing a dystocia mouse model according to claim 2, characterized in that: The introduction method is microinjection.
9. A dystocia mouse model, characterized in that: The mouse model is constructed by the method described in any one of claims 2-8.
10. Use of the dystocia mouse model according to claim 9 in studying the triggering mechanism of dystocia or screening drugs for treating dystocia.