Diallele knockout of ANGPTL3

Abstract

RNA molecules comprising a guide sequence portion consisting of 17 to 50 nucleotides and containing 17 to 22 nucleotides in the sequence set forth in any one of SEQ ID NO: 1 to 20347, as well as compositions, methods and uses thereof.

Description

[0001] This application claims the benefit of U.S. Provisional Application Nos. 63 / 492,808, filed on March 29, 2023, 63 / 385,944, filed on December 2, 2022, and 63 / 368,926, filed on July 20, 2022, the contents of each of which are incorporated herein by reference.

[0002] Throughout this application, various publications are cited, including citations in parentheses. The disclosures of all publications mentioned in this application are incorporated herein by reference in their entirety to provide additional description of the art to which the invention pertains and features of the art that may be used in the present invention.

[0003] Sequence Listing References

[0004] This application incorporates by reference the nucleotide sequence present in the file named "230720_91943-A-PCT_Sequence_Listing_AWG.xml", which is 18,030,806 bytes in size and was created on July 20, 2023 in the format of an IBM-PC machine with an operating system compatible with MS-Windows, which is contained in the XML file filed on July 20, 2023 as a part of this application. Background of the Invention

[0006] Targeted gene therapy may help treat several lipid metabolism disorders, including familial hypercholesterolemia (FH), hypertriglyceridemia, and hyperlipidemia. More specifically, familial hypercholesterolemia (FH) is a genetic disease that is primarily due to mutations in the low-density lipoprotein receptor (LDLR), leading to elevated cholesterol and premature development of cardiovascular disease. Hypertriglyceridemia is a lipid metabolism disorder characterized by high blood triglyceride levels. It can lead to atherosclerosis and other life-threatening diseases even when cholesterol levels are normal. Hyperlipidemia is another example of a lipid metabolism disorder characterized by elevated levels of any or all lipids and / or lipoproteins in the blood. A simple and specific gene therapy approach would improve treatment options for each of these diseases. Additionally, since high triglyceride levels inhibit insulin release, this approach could also be used to treat symptoms of type II diabetes.

[0007] Angiopoietin-like protein 3 (ANGPTL3) is a secreted protein that plays a role in the regulation of plasma lipid levels. When secreted, ANGPTL3 binds lipoprotein lipase (LPL) and endothelial lipase (LIPG), thereby affecting the hydrolysis of triglycerides and phospholipids. Therefore, in healthy individuals, ANGPTL3 acts as an inhibitor of lipoprotein-lipase.

[0008] ANGPTL3 deficiency due to loss-of-function mutations in the ANGPTL3 gene results in a condition called "familial combined hypobetalipoproteinemia" (FHBL2, OMIM #605019), which is characterized by low concentrations of all major lipoprotein classes in the circulation. In fact, families carrying ANGPTL3 loss-of-function mutations were found to have low levels of LDL, VLDL, and triglycerides. Therefore, knockout of wild-type ANGPTL3 is a potential therapeutic target for the treatment of combined hyperlipidemia, and reduced ANGPTL3 expression may reduce plasma lipoprotein concentrations. Summary of the invention

[0009] Disclosed are methods for knocking out the ANGPTL3 gene to increase lipid metabolism, thereby treating conditions including hypertriglyceridemia, hyperlipidemia, and hypercholesterolemia. Therefore, as described herein, the biallelic knockout of the ANGPTL3 gene in liver cells (e.g., hepatocytes) can be used to treat, inhibit, prevent, and / or alleviate any of hypertriglyceridemia, hyperlipidemia, and hypercholesterolemia (e.g., familial hypercholesterolemia (FH)).

[0010] The present disclosure also provides a method for inactivating an allele of angiopoietin-like protein 3 (ANGPTL3) gene in a cell, the method comprising

[0011] introducing into a cell a composition comprising:

[0012] CRISPR nucleases, or nucleotide molecules encoding CRISPR nucleases; and

[0013] An RNA molecule comprising a guide sequence portion having 17 to 50 nucleotides, or a DNA molecule encoding the RNA molecule,

[0014] In it, a complex of CRISPR nuclease and RNA molecules effects a double-strand break in one allele of the ANGPTL3 gene.

[0015] According to an embodiment of the present invention, there is provided an RNA molecule comprising a guide sequence portion, wherein the guide sequence portion consists of 17-50 consecutive nucleotides and comprises 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347.

[0016] According to some embodiments of the present invention, there is provided a composition comprising an RNA molecule and a CRISPR nuclease, wherein the RNA molecule comprises a guide sequence portion, wherein the guide sequence portion consists of 17-50 consecutive nucleotides and comprises 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347.

[0017] According to some embodiments of the invention, there is provided a method for inactivating an ANGPTL3 allele in a cell, the method comprising delivering to the cell a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347.

[0018] In some embodiments, the cell is a liver cell. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is a stem cell. In some embodiments, delivery to the cell is performed in vivo, ex vivo, or in vitro. In some embodiments, delivery to the cell is performed by delivering a lentivirus, adeno-associated virus (AAV), or nanoparticle to the liver in vivo. In some embodiments, the method is performed ex vivo and the cell is provided / removed from the individual patient. In some embodiments, the method further comprises the step of introducing the resulting cell having a modified / knockout ANGPTL3 allele into the individual patient.

[0019] According to some embodiments of the present invention, there is provided a method for treating and / or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, the method comprising delivering a composition comprising an RNA molecule and a CRISPR nuclease to cells of a subject suffering from or likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347.

[0020] According to some embodiments of the present invention, there is provided a use of a composition comprising an RNA molecule and a CRISPR nuclease for inactivating an ANGPTL3 allele in a cell, the RNA molecule comprising a guide sequence portion, the guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347, the use comprising delivering to the cell a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion, the guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347.

[0021] According to an embodiment of the present invention, there is provided a medicament for inactivating the ANGPTL3 allele in cells, comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of any of the sequences shown in SEQ ID NOs: 1-20347, wherein the medicament is administered by delivering to the cells a composition comprising the RNA molecule and the CRISPR nuclease, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of any of the sequences shown in SEQ ID NOs: 1-20347.

[0022] According to some embodiments of the present invention, there is provided the use of a composition comprising an RNA molecule and a CRISPR nuclease for the treatment, alleviation or prevention of hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of any of the sequences shown in SEQ ID NOs: 1-20347, the use comprising delivering to the cells of a subject suffering from or at risk of experiencing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia a composition comprising the RNA molecule and the CRISPR nuclease, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of any of the sequences shown in SEQ ID NOs: 1-20347.

[0023] In some embodiments, the method is carried out in vivo, and the cells are liver cells, such as hepatocytes.

[0024] In some embodiments, the composition is delivered in vivo to the cells by lipid nanoparticle delivery, lentiviral delivery or AAV delivery.

[0025] According to some embodiments of the present invention, a drug for treating, alleviating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia is provided, the drug comprising a composition containing an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion, the guide sequence portion having 17-50 consecutive nucleotides containing nucleotides in the sequence shown in any one of SEQ ID NOs: 1-20347, wherein the drug is administered by delivering a composition comprising an RNA molecule and a CRISPR nuclease to cells of a subject suffering from or likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, the RNA molecule comprising a guide sequence portion, the guide sequence portion consisting of 17-50 consecutive nucleotides and containing 17-22 nucleotides in the sequence shown in any one of SEQ ID NOs: 1-20347.

[0026] According to some embodiments of the invention, there is provided a kit for inactivating an ANGPTL3 allele in a cell, comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347; and instructions for delivering the RNA molecule, the CRISPR nuclease, and / or the tracrRNA to the cell.

[0027] According to some embodiments of the invention, there is provided a kit for treating hypertriglyceridemia, hyperlipidemia or hypercholesterolemia in a subject, the kit comprising: an RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347; and instructions for delivering the RNA molecule, the CRISPR nuclease, and / or the tracrRNA to cells of a subject suffering from or at risk of experiencing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1A-1B : Use OMNI-103 nuclease ( Figure 1A ) or OMNI-159 nuclease ( Figure 1B) A transfection-based guide screen was performed in HeLa cells for guides targeting ANGPTL3 exon 1, exon 2, exon 3, and exon 4. Details of the guide sequences and nucleases used in the screen are provided in Tables A and B below. Additional description of the OMNI-159 nuclease (SEQ ID NO: 20353) is provided in PCT International Application Publication No. WO 2023 / 019269, and additional description of the OMNI-103 nuclease (SEQ ID NO: 20354) is provided in PCT International Application Publication No. WO 2022 / 170199, the contents of each of which are incorporated herein by reference.

[0030] Table A: OMNI CRISPR nucleases, PAM requirements, and sgRNA scaffold sequences

[0031]

[0032] Table B: Guide sequence segments targeting ANGPTL3 and utilization of CRISPR nucleases

[0033]

[0034]

[0035]

[0036] Figures 2A-2D : Screening of sgRNAs targeting the first exon of the ANGPTL3 gene for high on-target activity in Huh-7 cells using OMNI-103 CRISPR nuclease. Figure 2A The target sites for each tested sgRNA listed in Table C below are shown. Figure 2B Measurements of the percent editing (%) for each sgRNA are shown. Figure 2C Shown are qRT-PCR measurements of ANGPTL3 mRNA levels in cells treated with each sgRNA. Figure 2D ELISA measurements of ANGPTL3 secreted protein levels in cells treated with each sgRNA are shown.

[0037] Table C: Figures 2A-2D The guide sequence portion of the sgRNA targeting ANGPTL3 is shown

[0038]

[0039] Figures 3A-3C : In vivo using OMNI-103 CRISPR nuclease, using sgRNA targeting the mouse ANGPTL3 gene. The details of each sgRNA tested are listed in Table D below. Figure 3AMeasurements of the percent editing (%) for each sgRNA are shown. Figure 3B Shown are qRT-PCR measurements of ANGPTL3 mRNA levels in mice treated with each sgRNA. Figure 3C ELISA measurements of ANGPTL3 secreted protein levels in mice treated with each sgRNA are shown.

[0040] Table D: Figures 3A-3C The guide sequence portion of the mouse sgRNA targeting ANGPTL3 is shown

[0041] DETAILED DESCRIPTION OF THE INVENTION

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the invention belongs. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In the event of a conflict, the patent specification (including definitions) shall prevail. In addition, materials, methods and examples are illustrative only and are not intended to be limiting.

[0044] It should be understood that the terms "a" and "an" as used above and elsewhere herein refer to "one or more" of the listed components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless otherwise specifically stated. Therefore, the terms "a" and "an" and "at least one" are used interchangeably in this application.

[0045] For a better understanding of the purpose of the present teaching and in no way limiting the scope of the present teaching, unless otherwise indicated, all numbers and other numerical values ​​used in the specification and claims to indicate quantity, percentage or ratio should be understood as being modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values, which may vary depending on the desired properties sought to be obtained. At a minimum, each numerical parameter should at least be interpreted in light of the number of reported significant figures and by applying conventional rounding techniques.

[0046] Unless otherwise indicated, adjectives modifying conditions or relational features of one or more features of embodiments of the present invention, such as "substantially" and "about") should be understood to mean that the conditions or features are defined within acceptable tolerances for the operation of the embodiments for their intended application. Unless otherwise indicated, the word "or" in the specification and claims is considered to be an inclusive "or" rather than an exclusive or, and means at least one or any combination of its conjunctions.

[0047] In the specification and claims of the present application, each verb "comprise", "include" and "have" and its verb conjugation forms are used to indicate that one or more objects of the verb are not necessarily a complete list of parts, elements or portions of one or more subjects of the verb. Other terms used herein are intended to be defined by their well-known meanings in the art.

[0048] In some embodiments of the present invention, DNA nuclease is used to affect DNA breakage at the target site to induce cellular repair mechanisms, such as but not limited to non-homologous end joining (NHEJ). In the classical NHEJ process, the two ends of the double-strand break (DSB) site are joined together in a fast but inaccurate manner (i.e., often resulting in mutations in the DNA at the cut site in the form of small insertions or deletions).

[0049] As used herein, the term "modified cell" refers to a cell in which a double-strand break is effected by a complex of an RNA molecule and a CRISPR nuclease as a result of hybridization with a target sequence, i.e., on-target hybridization.

[0050] As used herein, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence or molecule comprising a nucleotide sequence that can be hybridized with a specific target sequence, for example, a targeting sequence having a nucleotide sequence that is at least partially complementary to the targeted sequence along the length of the targeting sequence. The targeting sequence or targeting molecule can be a part of an RNA molecule that can form a complex with a CRISPR nuclease, alone or in combination with other RNA molecules, wherein the targeting sequence serves as the targeting portion of the CRISPR complex. When a molecule with a targeting sequence is present simultaneously with a CRISPR molecule, an RNA molecule alone or in combination with additional one or more RNA molecules (e.g., tracrRNA molecules) can target the CRISPR nuclease to a specific target sequence. As a non-limiting example, the guide sequence portion of a CRISPR RNA molecule or a single guide RNA molecule can serve as a targeting molecule. Each possibility represents a separate embodiment. The targeting sequence can be custom designed to target any desired sequence.

[0051] The term "target" as used herein refers to the preference for hybridizing the targeting sequence of the targeting molecule with a nucleic acid having a targeting nucleotide sequence. It should be understood that the term "target" encompasses variable hybridization efficiencies, such that a nucleic acid having a target nucleotide sequence is preferably targeted, but unintentional off-target hybridization may occur in addition to on-target hybridization. It should be understood that when an RNA molecule targets a sequence, the complex of the RNA molecule and the CRISPR nuclease molecule targets the sequence to obtain nuclease activity.

[0052] The "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, for example, a guide sequence portion has a nucleotide sequence that is partially or completely complementary to a DNA sequence that is targeted along the length of the guide sequence portion. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or is about 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-4 In some embodiments, the full length of the guide sequence portion is fully complementary to the targeted DNA sequence along the length of the guide sequence portion. The guide sequence portion can be a part of an RNA molecule capable of forming a complex with a CRISPR nuclease, wherein the guide sequence portion serves as a DNA targeting portion of the CRISPR complex. When the RNA molecule with the guide sequence portion is present simultaneously with the CRISPR molecule, alone or in combination with additional one or more RNA molecules (e.g., tracrRNA molecules), the RNA molecule is capable of targeting the CRISPR nuclease to a specific target DNA sequence. Therefore, the CRISPR complex can be formed by direct binding of an RNA molecule with a guide sequence portion to a CRISPR nuclease or by binding of an RNA molecule with a guide sequence portion and additional one or more RNA molecules to a CRISPR nuclease. Each possibility represents a separate embodiment. The guide sequence portion can be custom designed to target any desired sequence. Therefore, a molecule comprising a "guide sequence portion" is a class of targeting molecules. In some embodiments, the guide sequence portion comprises a sequence that is identical to or differs by no more than 1, 2, 3, 4, or 5 nucleotides from a guide sequence portion described herein (e.g., a guide sequence shown in any one of SEQ ID NOs: 1-20347). Each possibility represents a separate embodiment. In some of these embodiments, the guide sequence portion comprises a sequence identical to the sequence set forth in any one of SEQ ID NOs: 1-20347.Throughout this application, the terms "guide molecule", "RNA guide molecule", "guide RNA molecule" and "gRNA molecule" are synonymous with molecules that comprise a guide sequence portion.

[0053] As used herein, the term "indiscriminate" refers to the guide sequence portion of an RNA molecule that targets a specific DNA sequence that is common to all alleles of a gene.

[0054] In an embodiment of the present invention, the RNA molecule comprises a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347.

[0055] RNA molecules and / or guide sequence portions of RNA molecules may contain modified nucleotides. Exemplary modifications to nucleotides / polynucleotides may be synthetic, and encompass polynucleotides containing nucleotides of bases other than naturally occurring adenine, cytosine, thymine, uracil or guanine bases. Modifications to polynucleotides include polynucleotides containing synthetic, non-naturally occurring nucleosides (e.g., locked nucleic acids). Modifications to polynucleotides may be used to increase or decrease the stability of RNA. An example of a modified polynucleotide is an mRNA containing 1-methyl pseudouridine. For examples of modified polynucleotides and uses thereof, see U.S. Patent No. 8,278,036, PCT International Publication No. WO / 2015 / 006747, and Weissman and Kariko (2015), each of which is incorporated herein by reference.

[0056] As used herein, "consecutive nucleotides" shown in a SEQ ID NO refers to the nucleotides in the nucleotide sequence in the order shown in the SEQ ID NO without any intervening nucleotides.

[0057] In an embodiment of the present invention, the guide sequence portion may be 50 nucleotides in length and contain 20-22 consecutive nucleotides in the sequence shown in any one of SEQ ID NOs: 1-20347. In an embodiment of the present invention, the guide sequence portion may be less than 22 nucleotides in length. For example, in an embodiment of the present invention, the guide sequence portion may be 17, 18, 19, 20 or 21 nucleotides in length. In such an embodiment, the guide sequence portion may consist of 17, 18, 19, 20 or 21 nucleotides in the sequence of 17-22 consecutive nucleotides shown in any one of SEQ ID NOs: 1-20347, respectively. For example, a guide sequence portion having 17 nucleotides in the sequence of 17 consecutive nucleotides shown in SEQ ID NO: 20348 may consist of any of the following nucleotide sequences (nucleotides excluded from the consecutive sequence are marked with a strikethrough):

[0058] AAAAAAAUGUACUUGGUUCC(SEQ ID NO:20348)

[0059] 17-nucleotide guide sequence 1: AAAAAAAUGUACUUGGUUCC(SEQ ID NO:20349)

[0060] 17-nucleotide guide sequence 2: AAAAAAAUGUACUUGGUUCC(SEQ ID NO:20350)

[0061] 17-nucleotide guide sequence 3: AAAAAAAUGUACUUGGUUCC(SEQ ID NO:20351)

[0062] 17-nucleotide guide sequence 4: AAAAAAAUGUACUUGGUUCC(SEQ ID NO:20352)

[0063] In embodiments of the present invention, the length of the guide sequence portion can be greater than 20 nucleotides. For example, in embodiments of the present invention, the length of the guide sequence portion can be 21, 22, 23, 24, or 25 nucleotides. In such embodiments, the guide sequence portion can comprise 17 - 50 nucleotides, which contains a sequence of 20, 21, or 22 consecutive nucleotides shown in any of SEQ ID NOs: 1 - 20347 and additional nucleotides that are fully complementary to the nucleotides or nucleotide sequences adjacent to the 3'-end of the target sequence, the 5'-end of the target sequence, or both.

[0064] In an embodiment of the present invention, a CRISPR nuclease and an RNA molecule comprising a guide sequence portion form a CRISPR complex that binds to a target DNA sequence to achieve cutting of the target DNA sequence. A CRISPR nuclease, such as Cpf1, can form a CRISPR complex comprising a CRISPR nuclease and an RNA molecule without an additional tracrRNA molecule. Alternatively, a CRISPR nuclease (e.g., Cas9) can form a CRISPR complex between a CRISPR nuclease, an RNA molecule, and a tracrRNA molecule. A guide sequence portion comprising a nucleotide sequence that can be hybridized with a specific target DNA sequence and a sequence portion (e.g., a tracrRNA sequence portion) that participates in the binding of a CRISPR nuclease can be located on the same RNA molecule. Alternatively, a guide sequence portion can be located on an RNA molecule, while a sequence portion (e.g., a tracrRNA portion) that participates in the binding of a CRISPR nuclease can be located on a separate RNA molecule. A single RNA molecule comprising a guide sequence portion (e.g., an RNA sequence that targets DNA) and at least one RNA sequence portion (e.g., a tracrRNA sequence portion) that binds a CRISPR protein can form a complex with a CRISPR nuclease and act as a molecule that targets DNA. In some embodiments, a first RNA molecule comprising a DNA-targeting RNA portion that includes a guide sequence portion and a second RNA molecule comprising an RNA sequence that binds a CRISPR protein interact through base pairing to form an RNA complex that targets the CRISPR nuclease to a DNA target site, or alternatively, are fused together to form an RNA molecule that complexes with and targets the CRISPR nuclease to a DNA target site.

[0065] In an embodiment of the present invention, the RNA molecule comprising a guide sequence portion may further comprise a sequence of a tracrRNA molecule. Such an embodiment may be designed as a synthetic fusion of a guide portion of an RNA molecule and a trans-activating crRNA (tracrRNA). (See Jinek et al., 2012). In such an embodiment, the RNA molecule is a single guide RNA (sgRNA) molecule. Embodiments of the present invention may also form a CRISPR complex using a separate tracrRNA molecule and a separate RNA molecule comprising a guide sequence portion. In such an embodiment, the tracrRNA molecule may be hybridized with the RNA molecule by base pairing, and may be advantageous in certain applications of the present invention described herein.

[0066] The term "tracr pairing sequence" refers to a sequence that is sufficiently complementary to the tracrRNA molecule to hybridize with the tracrRNA through base pairing and promote the formation of a CRISPR complex. (See U.S. Patent No. 8,906,616). In an embodiment of the present invention, the RNA molecule may further include a portion having a tracr pairing sequence.

[0067] For purposes of this disclosure, a "gene" includes a DNA region encoding a gene product, as well as all DNA regions that regulate the production of a gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Thus, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.

[0068] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.

[0069] As used herein, the term "nuclease" refers to an enzyme that is capable of cleaving a phosphodiester bond between nucleotide subunits of a nucleic acid. The nuclease can be isolated or derived from a natural source. The natural source can be any living organism. Alternatively, the nuclease can be a modified or synthetic protein that retains phosphodiester bond cleavage activity. Genetic modification can be achieved using nucleases, such as CRISPR nucleases.

[0070] According to an embodiment of the present invention, an RNA molecule comprising a guide sequence portion (e.g., a targeting sequence) is provided, the guide sequence portion comprising a nucleotide sequence that is fully or partially complementary to a target sequence of an ANGPTL3 gene. In some embodiments, the guide sequence portion is fully or partially complementary to a target sequence located within 30 nucleotides or up to 30 nucleotides upstream or downstream of an exon of the ANGPTL3 gene. In some embodiments, the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or more than 26 nucleotides. In some embodiments, the guide sequence portion is configured to target a CRISPR nuclease to a target sequence and provide a cleavage event by a CRISPR nuclease complexed therewith, the cleavage event being selected from a double-strand break and a single-strand break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the ANGPTL3 target site. In some embodiments, the cleavage event enables nonsense-mediated decay of the ANGPTL3 gene. In some embodiments, the RNA molecule is a guide RNA molecule, such as a crRNA molecule or a single guide RNA molecule.

[0071] In some embodiments, the target sequence of an allele of an ANGPTL3 gene is altered (e.g., by the introduction of an NHEJ-mediated indel (e.g., insertion or deletion)) and results in a reduction or elimination of expression of a gene product encoded by the allele of the ANGPTL3 gene. In some embodiments, the reduction or elimination of expression is due to nonsense-mediated mRNA decay, such as due to a premature stop codon. In some embodiments, the reduction or elimination of expression is due to expression of a truncated form of the ANGPTL3 gene product.

[0072] According to an embodiment of the present invention, an RNA molecule comprising a guide sequence portion (e.g., a targeting sequence) is provided, the guide sequence portion comprising a nucleotide sequence that is fully or partially complementary to a target sequence located in or near an ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located 30 base pairs upstream to 30 base pairs downstream of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of an ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located 50 base pairs upstream to 50 base pairs downstream of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of an ANGPTL3 gene. Each possibility represents a separate embodiment. In some embodiments, the target sequence of an ANGPTL3 gene is altered (e.g., by introducing an NHEJ-mediated insertion or deletion), and results in a reduction or elimination of the expression of a gene product encoded by the ANGPTL3 gene. In some embodiments, the reduction or elimination of expression is due to nonsense-mediated mRNA decay. In some embodiments, the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides. In some embodiments, the guide sequence portion is configured to target a CRISPR nuclease to a target sequence and provide a cleavage event by the CRISPR nuclease complexed therewith, the cleavage event being selected from a double-strand break and a single-strand break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the ANGPTL3 target site. In some embodiments, the cleavage event enables nonsense-mediated decay of the ANGPTL3 gene. In some embodiments, the RNA molecule is a guide RNA molecule, such as a crRNA molecule or a single guide RNA molecule.

[0073] In some embodiments, the guide sequence portion is complementary to a target sequence located 30 base pairs upstream to 30 base pairs downstream of an exon of an ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located 50 base pairs upstream to 50 base pairs downstream of an exon of an ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located 30 base pairs upstream to 30 base pairs downstream of an exon of an ANGPTL3 gene.

[0074] In some embodiments, the exon is exon 1 and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs by no more than 3 nucleotides from the sequence set forth in any one of SEQ ID NOs: 6333-9188.

[0075] In some embodiments, the exon is exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs by no more than 3 nucleotides from the sequence set forth in any one of SEQ ID NOs:9189-9978.

[0076] In some embodiments, the exon is exon 3 and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs by no more than 3 nucleotides from the sequence set forth in any one of SEQ ID NOs:9979-10786.

[0077] In some embodiments, the exon is exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs by no more than 3 nucleotides from the sequence set forth in any one of SEQ ID NOs: 10787-11633.

[0078] In some embodiments, the exon is exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs by no more than 3 nucleotides from the sequence set forth in any one of SEQ ID NOs: 11634-12384.

[0079] In some embodiments, the exon is exon 6 and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs by no more than 3 nucleotides from the sequence set forth in any one of SEQ ID NOs: 12385-14057.

[0080] In some embodiments, the exon is exon 7, and the guide sequence portion comprises a sequence that is identical to or differs by no more than 3 nucleotides from the sequence set forth in any one of SEQ ID NOs: 1-6332 and 14058-15412.

[0081] According to an embodiment of the present invention, there is provided a method for inactivating at least one allele of angiopoietin-like protein 3 (ANGPTL3) gene in a cell, the method comprising

[0082] introducing into a cell a composition comprising:

[0083] at least one CRISPR nuclease, or a nucleotide molecule encoding a CRISPR nuclease; and

[0084] An RNA molecule comprising a guide sequence portion, or a DNA molecule encoding the RNA molecule,

[0085] wherein the complex of the CRISPR nuclease and the RNA molecule affects a double strand break in at least one allele of the ANGPTL3 gene,

[0086] The guide sequence portion of the RNA molecule consists of 17-50 consecutive nucleotides.

[0087] In some embodiments, the RNA molecule comprising a guide sequence portion is a crRNA molecule or an sgRNA molecule. In some embodiments, the RNA molecule is a crRNA molecule, and the composition further comprises a tracrRNA molecule that forms a complex with the crRNA molecule.

[0088] In some embodiments, the composition is introduced into cells of a subject or into cells in culture.

[0089] In some embodiments, the cell is a liver cell, preferably a hepatocyte. In some embodiments, the cell is a stem cell.

[0090] In some embodiments, the CRISPR nuclease and the RNA molecule are introduced into the cell at substantially the same time or at different times.

[0091] In some embodiments, an allele of an ANGPTL3 gene in a cell is subjected to an insertion or deletion mutation.

[0092] In some embodiments, the insertion or deletion mutation generates a premature stop codon.

[0093] In some embodiments, inactivation results in a truncated protein encoded by the inactivated allele.

[0094] In some embodiments, the guide sequence portion is complementary to a target sequence located 50 base pairs upstream to 50 base pairs downstream of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the ANGPTL3 gene.

[0095] In some embodiments, the guide sequence portion is complementary to a target sequence located 30 base pairs upstream to 30 base pairs downstream of an exon of an ANGPTL3 gene, and

[0096] a) the exon is exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 6333-9188 by no more than 3 nucleotides;

[0097] b) the exon is exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9189-9978 by no more than 3 nucleotides;

[0098] c) the exon is exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9979-10786 by no more than 3 nucleotides;

[0099] d) the exon is exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 10787-11633 by no more than 3 nucleotides;

[0100] e) the exon is exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 11634-12384 by no more than 3 nucleotides;

[0101] f) the exon is exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 12385-14057 by no more than 3 nucleotides; or

[0102] g) the exon is exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 1-6332 and 14058-15412 by no more than 3 nucleotides.

[0103] In some embodiments, the guide sequence portion consists of 17-50 consecutive nucleotides and comprises 17-22 nucleotides in the sequence shown in any one of SEQ ID NOs: 1-20347 or 17-22 nucleotides in a sequence that differs from the sequence shown in any one of SEQ ID NOs: 1-20347 by no more than 3 nucleotides.

[0104] According to an embodiment of the present invention, a composition comprising an RNA molecule is provided, wherein the RNA molecule comprises a guide sequence portion, the guide sequence portion consists of 17-50 consecutive nucleotides, and comprises 17-22 nucleotides in a sequence shown in any one of SEQ ID NOs: 1-20347 or a sequence that differs from the sequence shown in any one of SEQ ID NOs: 1-20347 by no more than 3 nucleotides.

[0105] In some embodiments, the guide sequence portion is complementary to a target sequence located 50 base pairs upstream to 50 base pairs downstream of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the ANGPTL3 gene.

[0106] In some embodiments, the guide sequence portion is complementary to a target sequence located 30 base pairs upstream to 30 base pairs downstream of an exon of an ANGPTL3 gene, and

[0107] a) the exon is exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 6333-9188 by no more than 3 nucleotides;

[0108] b) the exon is exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9189-9978 by no more than 3 nucleotides;

[0109] c) the exon is exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9979-10786 by no more than 3 nucleotides;

[0110] d) the exon is exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 10787-11633 by no more than 3 nucleotides;

[0111] e) the exon is exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 11634-12384 by no more than 3 nucleotides;

[0112] f) the exon is exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 12385-14057 by no more than 3 nucleotides; or

[0113] g) the exon is exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 1-6332 and 14058-15412 by no more than 3 nucleotides.

[0114] In some embodiments, the composition further comprises a CRISPR nuclease.

[0115] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule.

[0116] In some embodiments, the CRISPR nuclease and the RNA molecule form a complex, or the CRISPR nuclease, the RNA molecule, and the tracrRNA molecule form a complex.

[0117] According to an embodiment of the present invention, there is provided a medicament comprising any one of the compositions described herein for inactivating an ANGPTL3 allele in a cell, wherein the medicament is administered by delivering the composition to the cell.

[0118] According to an embodiment of the present invention, there is provided a use of any one of the compositions described herein for treating, alleviating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, comprising delivering the composition to a subject who is experiencing or is likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

[0119] According to an embodiment of the present invention, a medicament comprising any one of the compositions described herein is provided for treating, alleviating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, such that the medicament is administered by delivering the composition to a subject who is experiencing or is likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

[0120] According to an embodiment of the present invention, there is provided a kit for inactivating an ANGPTL3 allele in a cell, comprising any one of the compositions described herein and instructions for delivering the composition to the cell.

[0121] According to an embodiment of the present invention, a kit for treating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia in a subject is provided, comprising any of the compositions described herein and instructions for delivering the composition to a subject experiencing or likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

[0122] According to an embodiment of the present invention, there is provided any one of the compositions described herein for alleviating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

[0123] According to an embodiment of the present invention, a method for treating hypertriglyceridemia, hyperlipidemia or hypercholesterolemia in a subject is provided, the method comprising administering any one of the compositions described herein to a subject who is experiencing or is likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

[0124] According to an embodiment of the present invention, a gene editing composition comprising an RNA molecule is provided, wherein the RNA molecule comprises a guide sequence portion, wherein the guide sequence portion consists of 17-50 consecutive nucleotides and comprises 17-22 nucleotides in the sequence shown in any one of SEQ ID NOs: 1-20347. In some embodiments, the RNA molecule further comprises a portion having a sequence that binds to a CRISPR nuclease. In some embodiments, the sequence that binds to a CRISPR nuclease is a tracrRNA sequence.

[0125] In some embodiments, the RNA molecule further comprises a portion having a tracr pairing sequence.

[0126] In some embodiments, the RNA molecule may further comprise one or more linker moieties.

[0127] According to embodiments of the present invention, the length of RNA molecules can be up to 1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110 or 100 nucleotides. Each possibility represents a separate embodiment. In embodiments of the present invention, the length of RNA molecules can be 17 to 300 nucleotides, 100 to 300 nucleotides, 150 to 300 nucleotides, 100 to 500 nucleotides, 100 to 400 nucleotides, 200 to 300 nucleotides, 100 to 200 nucleotides or 150 to 250 nucleotides. Each possibility represents a separate embodiment.

[0128] According to some embodiments of the invention, there is provided a method for inactivating ANGPTL3 expression in a cell, the method comprising delivering to the cell a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of the sequence shown in any one of SEQ ID NOs: 1-20347.

[0129] According to some embodiments of the invention, there is provided a method for preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, the method comprising delivering a composition comprising an RNA molecule and a CRISPR nuclease to cells of a subject, the RNA molecule comprising a guide sequence portion consisting of 17-50 consecutive nucleotides and comprising 17-22 nucleotides of a sequence shown in any one of SEQ ID NOs: 1-20347.

[0130] According to embodiments of the invention, at least one CRISPR nuclease and at least one RNA molecule comprising a guide sequence portion are delivered to a subject and / or cell substantially simultaneously or at different times.

[0131] In some embodiments, the tracrRNA molecule is delivered to the subject and / or cell substantially simultaneously or at different times with the at least one CRISPR nuclease and the at least one RNA molecule comprising a guide sequence portion.

[0132] The compositions and methods of the present disclosure can be used to treat, prevent, alleviate or slow the progression of hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

[0133] Any one or a combination of the above-described strategies for inactivating ANGPTL3 expression may be used in the context of the present invention.

[0134] In an embodiment of the invention, an RNA molecule is used to direct a CRISPR nuclease to an exon or splice site of an ANGPTL3 allele to generate a double-strand break (DSB), resulting in the insertion or deletion of one or more nucleotides by inducing an error-prone non-homologous end joining (NHEJ) mechanism, and thereby forming a frameshift mutation in the ANGPTL3 allele. The frameshift mutation can result in, for example, inactivation or knockout of the ANGPTL3 allele by generating an early stop codon in the ANGPTL3 allele and producing a truncated protein or nonsense-mediated mRNA decay of the allele transcript. In a further embodiment, one RNA molecule is used to direct a CRISPR nuclease to the promoter of an ANGPTL3 allele.

[0135] In some embodiments, the method is used to treat a subject at risk for hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia. In such embodiments, the method results in improvement, alleviation, or prevention of the disease phenotype by reducing or eliminating the expression of ANGPTL3.

[0136] Embodiments of the compositions described herein include at least one CRISPR nuclease, an RNA molecule comprising at least a guide sequence portion, and a tracrRNA molecule, all of which are effective in a subject or cell. The at least one CRISPR nuclease, the RNA molecule comprising at least a guide sequence portion, and the tracrRNA molecule can be delivered substantially simultaneously or can be delivered at different times, but all are effective. For example, this includes delivering the CRISPR nuclease to a subject or cell before the RNA guide molecule and / or the tracrRNA are substantially present in the subject or cell.

[0137] In some embodiments, a human cell is modified by any of the methods described herein. In some embodiments, the cell is a liver cell. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is a stem cell.

[0138] ANGPTL3 knockout strategy

[0139] The present invention provides a method for knocking out an ANGPTL3 allele in a subject cell, preferably a liver cell, such as a hepatocyte, thereby preventing the inhibition of lipid metabolism without causing damage to the subject. The provided method for knocking out an ANGPTL3 allele in a cell can be used to treat, prevent or alleviate any of hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

[0140] ANGPTL3 knockout strategies include, but are not limited to, biallelic knockout by targeting any one or a combination of ANGPTL3 exons 1-7, including within thirty nucleotides upstream and downstream of the exons to flank the splice donor and acceptor sites. Frameshift mutations in these exons result in non-functional truncated ANGPTL3 proteins or nonsense-mediated decay (NMD) of mutant ANGPTL3 transcripts. For example, an RNA molecule comprising a guide sequence portion comprising 17-24 nucleotides of the sequence present in any one of SEQ ID NOs: 1-20347 can be used to target CRISPR nucleases to the ANGPTL3 target site and induce double-stranded DNA breaks, resulting in non-functional truncated ANGPTL3 proteins or nonsense-mediated decay (NMD) of mutant ANGPTL3 transcripts.

[0141] CRISPR nucleases and PAM recognition

[0142] In some embodiments, the sequence-specific nuclease is selected from a CRISPR nuclease, or a functional variant thereof. In some embodiments, the sequence-specific nuclease is an RNA-guided DNA nuclease. In these embodiments, the RNA sequence of the guide RNA-guided DNA nuclease (e.g., Cpf1) binds to all ANGPTL3 alleles in the cell and / or guides the RNA-guided DNA nuclease to all ANGPTL3 alleles in the cell. In some embodiments, the CRISPR complex does not further comprise a tracrRNA. In a non-limiting example, where the RNA-guided DNA nuclease is a CRISPR protein, at least one nucleotide that differs between the dominant ANGPTL3 allele and the functional allele can be within the PAM site and / or near the PAM site in the region where the RNA molecule is designed to hybridize with it. It will be understood by those skilled in the art that RNA molecules can be engineered to bind to selected targets in the genome by methods known in the art. In some embodiments, the RNA-guided DNA nuclease is part of a fusion protein. In a non-limiting example, the RNA-guided DNA nuclease is linked to a second enzyme, such as a reverse transcriptase. In some embodiments, the RNA-guided DNA nuclease is a nickase that forms single-stranded DNA breaks.

[0143] The term "PAM" as used herein refers to the nucleotide sequence of the target DNA that is located near the target DNA sequence and recognized by the CRISPR nuclease complex. The PAM sequence can be different according to the nuclease homology. In addition, there are CRISPR nucleases that can target almost all PAMs. In some embodiments of the present invention, the CRISPR system utilizes one or more RNA molecules with a guide sequence portion to guide the CRISPR nuclease to the target DNA site via Watson-Crick base pairing between the guide sequence portion and the prototype spacer on the target DNA site, and the prototype spacer is adjacent to the prototype spacer adjacent motif (PAM), which is an additional requirement for target identification. The CRISPR nuclease then mediates the cutting of the target DNA site to produce a double-stranded break in the prototype spacer. In a non-limiting example, a type II CRISPR system utilizes a mature crRNA:tracrRNA complex, which is guided to the target DNA by Watson Crick base pairing between the guide sequence portion of the crRNA and the prototype spacer adjacent motif (PAM) on the target DNA near the prototype spacer adjacent motif (PAM).One skilled in the art will appreciate that each of the engineered RNA molecules of the present invention is further designed to associate with a target genomic DNA sequence of interest adjacent to a protospacer adjacent motif (PAM), for example, a PAM that matches a sequence associated with the type of CRISPR nuclease used, such as, for example, non-limiting examples NGG or NAG for Streptococcus pyogenes Cas9WT (SpCAS9), where "N" is any nucleobase; NNGRRT for Staphylococcus aureus (SaCas9); NNGRRT for jejuni Cas9 NNNVRYM for WT; NGAN or NGNG for SpCas9-VQR variants; NGCG for SpCas9-VRER variants; NGAG for SpCas9-EQR variants; NRRH for SpCas9-NRRH variants, wherein N is any nucleobase, R is A or G and H is A, C, or T; NRTH for SpCas9-NRTH variants, wherein N is any nucleobase, R is A or G, H is A, C, or T; NRCH for SpCas9-NRCH variants, wherein N is any nucleobase, R is A or G, H is A, C, or T; NG for SpG variants of SpCas9, wherein N is any nucleobase; NG or NA for SpCas9-NG variants of SpCas9, wherein N is any nucleobase; NR or NRN or NYN for SpRY variants of SpCas9, wherein N is any nucleobase, R is A or G, Y is C or T; canis) Cas9 variant (ScCas9), wherein N is any nucleobase; NNNRRT for the SaKKH-Cas9 variant of Staphylococcus aureus (SaCas9), wherein N is any nucleobase and R is A or G; NNNNGATT for Neisseria meningitidis (NmCas9), wherein N is any nucleobase; TTN for Alicyclobacillus acidiphilus Cas12b (AacCas12b), wherein N is any nucleobase; or TTTV for Cpf1, wherein V is A, C or G. Each of the RNA molecules of the invention is designed to bind to one or more different CRISPR nucleases to form a complex and is designed to target a polynucleotide sequence of interest using one or more different PAM sequences corresponding to the CRISPR nuclease used.

[0144] In some embodiments, RNA-guided DNA nucleases, such as CRISPR nucleases, can be used to cause DNA breaks that are double-stranded or single-stranded in nature at a desired location in the cell genome. The most commonly used RNA-guided DNA nucleases are derived from the CRISPR system, however, other RNA-guided DNA nucleases are also expected to be used in the genome editing compositions and methods described herein. For example, see U.S. Publication No. 2015 / 0211023, which is incorporated herein by reference.

[0145] CRISPR systems that can be used to implement the present invention vary widely. The CRISPR system can be a type I, type II, or type III system. Non-limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas11, Cas12, Cas13, Cas14, Cas15, Cas16, Cas17, Cas18, Cas19, Cas20, Cas21, Cas22, Cas23, Cas24, Cas25, Cas26, Cas27, Cas28, Cas29, Cas30, Cas31, Cas32, Cas33, Cas34, Cas35 Csl, Csb2, Csb3, Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966.

[0146] In some embodiments, the RNA-guided DNA nuclease is a CRISPR nuclease derived from a type II CRISPR system (e.g., Cas9). CRISPR nucleases can be derived from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Streptosporangium spp. ... acidocaldarius), Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.), Acetohalobium arabaticum, Ammonifex degensii, caldicelulosiruptorbecscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difjicile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculumthermopropionicum, Acidithiobacillus caldus, Acidithiobacillusferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngby sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochlorismarina, or any species encoding a CRISPR nuclease with a known PAM sequence. CRISPR nucleases encoded by uncultured bacteria can also be used in the context of the present invention. (See Burstein et al.Nature, 2017). Variants of CRIPSR proteins with known PAM sequences, such as SpCas9 D1135E variant, SpCas9 VQR variant, SpCas9 EQR variant, or SpCas9 VRER variant, can also be used in the context of the present invention.

[0147] Thus, RNA-guided DNA nucleases of CRISPR systems, such as Cas9 proteins or modified Cas9 or homologues or orthologues of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and homologues and orthologues thereof, can be used in the compositions of the present invention. Additional CRISPR nucleases can also be used, for example, the nucleases described in PCT International Application Publication Nos. WO2020 / 223514 and WO2020 / 223553, each of which is incorporated herein by reference.

[0148] In certain embodiments, the CRIPSR nuclease may be a "functional derivative" of a naturally occurring Cas protein. A "functional derivative" of a native sequence polypeptide is a compound having the same qualitative biological properties as a native sequence polypeptide. "Functional derivatives" include, but are not limited to, fragments of native sequences and derivatives of native sequence polypeptides and fragments thereof, provided that they have the same biological activity as the corresponding native sequence polypeptide. The biological activity considered herein is the ability of a functional derivative to hydrolyze a DNA substrate into fragments. The term "derivative" encompasses amino acid sequence variants, covalent modifications, and fusions thereof of a polypeptide. Suitable derivatives of a Cas polypeptide or its fragments include, but are not limited to, mutants, fusions, and covalent modifications of a Cas protein or its fragments. Cas proteins, including Cas proteins or fragments thereof, and derivatives of Cas proteins or their fragments, may be obtained from cells or by chemical synthesis or by a combination of these two methods. The cell may be a cell that naturally produces Cas proteins, or a cell that naturally produces Cas proteins and is genetically engineered to produce endogenous Cas proteins at higher expression levels or produces Cas proteins from nucleic acids introduced from an exogenous source, the nucleic acids encoding the same or different Cas as endogenous Cas. In some cases, the cell does not naturally produce Cas proteins and is genetically engineered to produce Cas proteins.

[0149] In some embodiments, the CRISPR nuclease is Cpf1. Cpf1 is a single RNA-guided endonuclease that utilizes a T-rich protospacer-adjacent motif. Cpf1 cleaves DNA through staggered DNA double-strand breaks. Two Cpf1 enzymes from Acidaminococcus and Lachnospiraceae have been shown to achieve efficient genome editing activity in human cells. (See Zetsche et al., 2015).

[0150] Therefore, RNA-guided DNA nucleases of a type II CRISPR system, such as Cas9 protein or modified Cas9 or homologs, orthologs or variants of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs, orthologs or variants, can be used in the present invention.

[0151] In some embodiments, the guide molecule comprises one or more chemical modifications that impart new or improved properties (e.g., improved stability from degradation, improved hybridization energetics, or improved binding properties to RNA-guided DNA nucleases). Suitable chemical modifications include, but are not limited to, modified bases, modified sugar moieties, or modified internucleoside linkages. Non-limiting examples of suitable chemical modifications include: 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methylpseudouridine, "β,D-galactosyl quercetin", 2'-O-methylguanosine, inosine, N6 isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, "2,2-dimethylguanosine", 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, "β,D-mannosyl braided glycoside", 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6-isopentenyladenosine, N-((9-β- D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-β-D-ribofuranosylpurine-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetic acid methyl ester, uridine-5-oxyacetic acid, wybutoxosine, queuosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N -((9-β-D-ribofuranosylpurin-6-yl)-carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, wybutoxosine, "3-(3-amino-3-carboxypropyl)uridine, (acp3)u", 2'-O-methyl (M), 3'-thiophosphate (MS), 3'-thioPACE (MSP), pseudouridine, or 1-methylpseudouridine. Each possibility represents a separate embodiment of the present invention.

[0152] In addition to targeting ANGPTL3 alleles by RNA-guided CRISPR nucleases, other means of inhibiting ANGPTL3 expression in target cells (preferably liver cells, such as hepatocytes) include, but are not limited to, the use of gapmers, shRNAs, siRNAs, custom TALENs, meganucleases or zinc finger nucleases, small molecule inhibitors, and any other methods known in the art for reducing or eliminating gene expression in target cells. See, e.g., U.S. Pat. Nos. 6,506,559; 7,560,438; 8,420,391; 8,552,171; 7,056,704; 7,078,196; 8,362,231; 8,372,968; 9,045,754; and PCT International Publication Nos. WO / 2004 / 067736; WO / 2006 / 097853 ; WO / 2003 / 087341; WO / 2000 / 0415661; WO / 2003 / 080809; WO / 2010 / 079430; WO / 2010 / 079430; WO / 2011 / 072246; WO / 2018 / 057989; and WO / 2017 / 164230, the entire contents of each of which are incorporated herein by reference.

[0153] Advantageously, guide RNA molecules comprising at least one guide sequence portion presented herein provide improved knockout efficiency of ANGPTL3 relative to other guide RNA molecules when complexed with a CRISPR nuclease in a cell. These specifically designed sequences can also be used to identify ANGPTL3 target sites for other nucleotide-targeted gene editing or gene silencing approaches, such as siRNA, TALEN, meganuclease or zinc finger nuclease.

[0154] Delivery to cells

[0155] Any of the compositions described herein can be delivered to the target cell by any suitable means. The RNA molecule compositions of the present invention can target any cell containing and / or expressing an ANGPTL3 allele, such as a mammalian liver cell (e.g., a hepatocyte). For example, in one embodiment, the RNA molecule specifically targets an ANGPTL3 allele in a target cell, and the target cell is a liver cell (e.g., a hepatocyte) or a stem cell. Delivery to the cell can be performed in vivo, ex vivo, or in vitro. Delivery can be in vivo delivery of a composition packaged in a lentivirus, adeno-associated virus (AAV), or nanoparticle to the liver of the subject, or to the liver cells of the subject. Delivery can be ex vivo delivery to the cells of the subject, such as liver cells, hepatocytes, or stem cells isolated from the subject. In addition, the nucleic acid compositions described herein can be delivered to cells as one or more of a DNA molecule, an RNA molecule, a ribonucleoprotein (RNP), a nucleic acid vector, or any combination thereof.

[0156] In some embodiments, any of the compositions described herein is delivered to cells in vivo. In some embodiments, the cells are liver cells, such as hepatocytes. In some embodiments, the compositions are delivered to the liver of the subject. The compositions can be delivered to cells by any known in vivo delivery method, including but not limited to viral transduction, such as using lentivirus or adeno-associated virus (AAV), nanoparticle delivery, etc. Other detailed delivery methods are described throughout this section.

[0157] In some embodiments, any of the compositions described herein is delivered to cells ex vivo. In some embodiments, the cells are liver cells, such as hepatocytes. The compositions can be delivered to cells by any known ex vivo delivery method, including but not limited to nuclear transfection, electroporation, viral transduction, such as using slow virus or adeno-associated virus (AAV), nanoparticle delivery, liposomes, etc. Other detailed delivery methods are described in this section.

[0158] In some embodiments, the RNA molecule comprises a chemical modification. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl, 3' thiophosphate (MS) or 2'-O-methyl, 3' thioPACE (MSP), pseudouridine and 1-methylpseudouridine. Each possibility represents a separate embodiment of the present invention.

[0159] Any suitable viral vector system can be used to deliver nucleic acid compositions, such as RNA molecule compositions of the present invention. Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids and target tissues. In certain embodiments, nucleic acids are administered for in vivo or ex vivo gene therapy purposes. Non-viral vector delivery systems include naked nucleic acids and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers. For a review of gene therapy procedures, see Anderson (1992); Nabel & Felgner (1993); Mitani & Caskey (1993); Dillon (1993); Miller (1992); Van Brunt (1988); Vigne (1995); Kremer & Perricaudet (1995); Haddada et al. (1995); and Yu et al. (1994).

[0160] Non-viral delivery methods for nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNP), polycationic or lipid: nucleic acid conjugates, artificial virosomes, and agent-enhanced nucleic acid uptake or can be delivered to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus, and cassava vein mosaic virus). (See Chung et al., 2006). Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also considered to be an in vivo, ex vivo, or in vitro delivery method. (See Zuris et al. (2015); see also Coelho et al. (2013); Judge et al. (2006); and Basha et al. (2011)).

[0161] Non-viral vectors, such as transposon-based systems, e.g., the recombinant Sleeping Beauty transposon system or the recombinant PiggyBac transposon system, can also be delivered to target cells and used for transposition of polynucleotide sequences of composition molecules or polynucleotide sequences encoding composition molecules in target cells.

[0162] Additional exemplary nucleic acid delivery systems include those provided by Amaxa.RTM.Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery System (Holliston, Mass.) and Copernicus Therapeutics Inc. (see, e.g., U.S. Pat. No. 6,008,336). Lipofection is described in, e.g., U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787; and U.S. Pat. No. 4,897,355, and lipofection reagents are commercially sold (e.g., Transfectam.TM., Lipofectin.TM, and Lipofectamine.TM.RNAiMAX). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those disclosed in PCT International Publication Nos. WO / 1991 / 017424 and WO / 1991 / 016024. Delivery can be to cells (ex vivo administration) or to target tissues (in vivo administration).

[0163] Preparation of lipid:nucleic acid complexes, including targeted liposomes, such as immunolipid complexes, is well known to those skilled in the art (see, e.g., Crystal, Science (1995); Blaese et al., (1995); Behr et al., (1994); Remy et al. (1994); Gao and Huang (1995); Ahmad and Allen (1992); U.S. Pat. Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028; and 4,946,787).

[0164] Other delivery methods include packaging the nucleic acid to be delivered into a homologous delivery vehicle (EDV). These EDVs are specifically delivered to target tissues using bispecific antibodies, wherein one arm of the antibody is specific to the target tissue, and the other arm is specific to the EDV. The antibody brings the EDV to the target cell surface, and then brings the EDV to the cell by endocytosis. Once in the cell, the contents are released (see MacDiarmid et al., 2009).

[0165] Delivery vehicles include, but are not limited to, bacteria, preferably non-pathogenic vehicles, nanoparticles, exosomes, microvesicles, gene gun delivery (e.g., by attaching the composition to gold particles and firing the gold particles into cells using a "gene gun"), viral vectors, including but not limited to lentivirus, AAV and retrovirus, virus-like particles (VLPs). Large VLPs (LVLPs), lentivirus-like particles, transposons, viral vectors, naked vectors, DNA or RNA, and other delivery vehicles known in the art.

[0166] The delivery of CRISPR nucleases and / or polynucleotides encoding CRISPR nucleases, and optionally additional nucleotide molecules and / or additional proteins or peptides can be carried out using a single delivery vehicle or method or a combination of different delivery vehicles or methods. For example, CRISPR nucleases can be delivered to cells using LNPs, and crRNA molecules and tracrRNA molecules can be delivered to cells using AAV. Alternatively, CRISPR nucleases can be delivered to cells using AAV particles, and crRNA molecules and tracrRNA molecules can be delivered to cells using separate AAV particles, which may be advantageous due to size limitations.

[0167] The application of RNA or DNA virus-based systems in virus-mediated nucleic acid delivery utilizes highly evolved processes to target viruses to specific cells in vivo and transport the viral payload to the nucleus. Viral vectors can be directly administered to patients (in vivo), or they can be used for in vitro treatment of cells, and modified cells are administered to patients (ex vivo). Conventional virus-based systems for delivering nucleic acids include, but are not limited to, retroviruses, slow viruses, adenoviruses, adeno-associated viruses, vaccinia viruses, and herpes simplex virus vectors for gene transfer.

[0168] RNA viruses can be used to deliver RNA compositions described herein. In addition, high transduction efficiencies have been observed in many different cell types and target tissues. The nucleic acids of the present invention can be delivered by non-integrating lentiviruses. Optionally, RNA is delivered using lentiviruses. Optionally, the lentivirus includes mRNA for nucleases, RNA for guides. Optionally, the lentivirus includes mRNA for nucleases, RNA for guides, and donor templates. Optionally, the lentivirus includes nuclease proteins, guide RNAs. Optionally, the lentivirus includes nuclease proteins, guide RNAs, and / or donor templates for gene editing by, for example, homology-directed repair. Optionally, the lentivirus includes mRNA for nucleases, RNA for targeting DNA, and tracrRNA. Optionally, the lentivirus includes mRNA for nucleases, RNA for targeting DNA, and tracrRNA, and donor templates. Optionally, the lentivirus includes nuclease proteins, RNA for targeting DNA, and tracrRNA. Optionally, the lentivirus includes nuclease proteins, RNA for targeting DNA, and tracrRNA, and donor templates for gene editing by, for example, homology-directed repair.

[0169] As described above, the compositions described herein may be administered using a non-integrating lentiviral particle approach, e.g. The system is delivered to the target cell. This method can be used to deliver mRNA or other types of RNA to the target cell, so that the RNA is delivered to the target cell resulting in the composition described herein being assembled in the target cell. See also PCT International Publication Nos. WO / 2013 / 014537, WO / 2014 / 016690, WO / 2016 / 185125, WO / 2017 / 194902, and WO / 2017 / 194903.

[0170] The tropism of retroviruses can be altered by incorporating exogenous envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats with the ability to package up to 6-10 kb of exogenous sequences. The minimal cis-acting LTRs are sufficient for replication and packaging of the vector, which is then used to integrate the therapeutic gene into the target cells to provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchschacher et al. (1992); Johannet al. (1992); Sommerfelt et al. (1990); Wilson et al. (1989); Miller et al. (1991); PCT International Publication No. WO / 1994 / 026877A1).

[0171] There are at least six viral vector approaches currently available for gene transfer in clinical trials that involve complementation of the defective vector by insertion of genes into helper cell lines to produce the transducing agent.

[0172] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (see Dunbar et al., 1995; Kohn et al., 1995; Malech et al., 1997). PA317 / pLASN was the first therapeutic vector used in gene therapy trials (Blaese et al., 1995). Transduction efficiencies of 50% or greater have been observed with MFG-S packaging vectors (Ellem et al., (1997); Dranoff et al., 1997).

[0173] Packaging cells are used to form viral particles that can infect host cells. These cells include 293 cells, which package adenovirus, AAV and Psi-2 cells or PA317 cells, which package retroviruses. Viral vectors for gene therapy are usually produced by production cell lines that package nucleic acid vectors into viral particles. The vector usually contains the minimum viral sequence required for packaging and subsequent integration into the host (if applicable), and other viral sequences are replaced by expression cassettes encoding proteins to be expressed. The missing viral functions are provided in trans by the packaging cell line. For example, the AAV vectors used for gene therapy usually only have reverse terminal repeats (ITR) sequences from the AAV genome, which are necessary for packaging and integration into the host genome. Viral DNA is packaged in a cell line that contains a helper plasmid that encodes other AAV genes (i.e., rep and cap) but lacks ITR sequences. The cell line is infected with adenovirus as an auxiliary. The helper virus promotes the replication of the AAV vector and the expression of the AAV genes from the helper plasmid. Due to the lack of ITR sequences, the helper plasmid is not packaged in large quantities. Contamination with adenovirus can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. Additionally, AAV can be produced on a clinical scale using a baculovirus system (see US Pat. No. 7,479,554).

[0174] In many gene therapy applications, it is desirable that gene therapy vectors have a high degree of specificity for specific tissue types. Therefore, viral vectors can be modified to have specificity for a given cell type by expressing a ligand in the form of a fusion protein with a viral coat protein on the outer surface of the virus. Select a ligand with affinity for a receptor known to be present on the cell type of interest. For example, Han et al. (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and recombinant viruses infect certain human breast cancer cells expressing human epidermal growth factor receptors. This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein containing a cell surface receptor ligand. For example, filamentous phages can be engineered to display antibody fragments (e.g., FAB or Fv) with specific binding affinity to almost any selected cell receptor. Although the above description is mainly applied to viral vectors, the same principle can be applied to non-viral vectors. Such a vector can be engineered to contain a specific uptake sequence that is conducive to being taken up by a specific target cell.

[0175] The gene therapy vector can be delivered in vivo by administration to an individual patient, for example, by systemic administration (e.g., intravitreal, intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or topical application, as described below. Preferably, delivery of any of the compositions disclosed herein is delivered in vivo to cells within the liver of a subject to knock out ANGPTL3 expression in liver cells (e.g., hepatocytes). The composition can be delivered to liver cells by several known means, including by using viral vectors (e.g., lentivirus, adeno-associated virus (AAV), etc.), nanoparticles, or by delivery of naked RNA compositions. For example, the composition can be delivered in vivo to liver cells by lipid nanoparticle delivery, lentiviral delivery, or AAV delivery.

[0176] Alternatively, the vector can be delivered ex vivo to cells, such as cells removed from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsies) or universal donor hematopoietic stem cells, which are then reimplanted into the patient, optionally after selecting cells that have incorporated the vector. Non-limiting exemplary ex vivo methods can involve removing tissue (e.g., peripheral blood, bone marrow, and spleen) from a patient for culture, transferring nucleic acid to cultured cells (e.g., hematopoietic stem cells), and then transplanting the cells into the patient's target tissue (e.g., bone marrow and spleen). In some embodiments, the stem cells or hematopoietic stem cells can be further treated with a vitality enhancer.

[0177] Ex vivo cell transfection for diagnosis, research, or for gene therapy (e.g., by reinfusing the transfected cells into a host organism) is well known to those skilled in the art. In a preferred embodiment, cells are isolated from a subject organism, transfected with a nucleic acid composition, and reinfused back into a subject organism (e.g., a patient). Various cell types suitable for ex vivo transfection are well known to those skilled in the art (see, e.g., Freshney, "Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications (6th edition, 2010) and references cited therein for discussing how to isolate and culture cells from a patient).

[0178] The carrier (such as retrovirus, liposome etc.) containing therapeutic nucleic acid composition can also be directly applied to organism for in vivo cell transduction.Using is by being generally used for introducing molecule into any approach that finally contacts with blood or tissue cell, including but not limited to injection, infusion, topical application and electroporation.The suitable method of using such nucleic acid is available and is well known to those skilled in the art, and, although more than one approach can be used to apply specific composition, specific approach can usually provide more immediate and more effective reaction than another approach.According to some embodiments, composition is delivered by intravenous (IV) injection.

[0179] Vectors suitable for introducing transgenes into cells include non-integrating lentiviral vectors. See, e.g., U.S. Publication No. 2009 / 0117617.

[0180] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as the particular method used to administer the composition. Thus, there are a variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0181] The disclosed compositions and methods can also be used to manufacture a medicament for treating a dominant genetic disease in a patient.

[0182] Example of a portion of an RNA guide sequence that specifically targets an ANGPTL3 gene allele

[0183] While a large number of guide sequences can be designed to target the ANGPTL3 gene, the nucleotide sequences described in Table 1 and identified by SEQ ID NOs: 1-20347 were specifically selected to effectively carry out the methods described herein.

[0184] Table 1 shows guide sequences designed to associate with ANGPTL3 alleles as described in the above embodiments. Each engineered guide molecule is further designed to associate with a target genomic DNA sequence of interest immediately adjacent to a protospacer adjacent motif (PAM), such as a PAM matching the sequence NGG or NAG, where "N" is any nucleobase. The guide sequence is designed to work in conjunction with one or more different CRISPR nucleases, including but not limited to, for example, SpCas9WT (PAM SEQ: NGG), SpCas9.VQR.1 (PAM SEQ: NGAN), SpCas9.VQR.2 (PAM SEQ: NGNG), SpCas9.EQR (PAM SEQ: NGAG), SpCas9.VRER (PAM SEQ: NGCG), SaCas9WT (PAM SEQ: NNGRRT), SpRY (PAM SEQ: NRNor NYN), NmCas9WT (PAM SEQ: NNNNGATT), Cpf1 (PAM SEQ: TTTV), JeCas9WT (PAM SEQ: NNNVRYM), OMNI-50 (PAM SEQ: NGG), OMNI-79 (PAM SEQ: NGG), OMNI-103 (PAM SEQ: NNRACT), OMNI-159 (NNNNCMAN), or OMNI-124 (PAM SEQ: NNGNRMNN).

[0185] Additional descriptions of OMNI-124 nuclease (SEQ ID NO: 20362) and OMNI-159 nuclease (SEQ ID NO: 20353) are provided in PCT International Application Publication No. WO 2023 / 019269A2, the contents of which are incorporated herein by reference. Additional descriptions of OMNI-103 nuclease (SEQ ID NO: 20354) are provided in PCT International Application Publication Nos. WO 2022 / 170199 A2 and WO 2023 / 107946 A2, the contents of which are incorporated herein by reference. Other descriptions of OMNI-50 nuclease (SEQ ID NO: 20360) are provided in U.S. Patent No. 11,666,641B2 and PCT International Application Publication Nos. WO 2020 / 223514A2, WO 2022 / 098693 A1, and WO 2023 / 019263 A1, the contents of each of which are incorporated herein by reference. Other descriptions of OMNI-79 nuclease (SEQ ID NO: 20361) are provided in U.S. Application Publication No. 2023 / 0122086A1 and PCT International Application Publication Nos. WO 2021 / 248016 A2 and WO 2023 / 102407A2, the contents of each of which are incorporated herein by reference.

[0186] The RNA molecules of the present invention are each designed to form a complex with one or more different CRISPR nucleases and are designed to target a polynucleotide sequence of interest using one or more different PAM sequences corresponding to the CRISPR nuclease utilized.

[0187] Table 1: Portions of guide sequences designed to associate with specific ANGPTL3 gene targets

[0188]

[0189]

[0190] The designated positions listed in column 1 of Table 1 are based on the gnomAD v3 database and the UCSC Genome Browser component ID: hg38, sequencing / assembly provider ID: Genome Reference Consortium Human GRCh38.p12 (GCA_000001405.27). Assembly date: First release in December 2013; Patch release 12 in December 2017.

[0191] Examples are provided below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary ways of preparing and practicing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only.

[0192] Experimental details

[0193] Example 1: ANGPTL3 Targeting Analysis

[0194] High on-target activity was screened in human cell lines (e.g., HeLa cells) using a compatible CRISPR nuclease (e.g., OMNI-103 or OMNI-159) for guide sequence portions consisting of 17-50 contiguous nucleotides and containing 17-22 nucleotides of any of the sequences shown in SEQ ID NOs: 1-20347. On-target activity was determined by DNA capillary electrophoresis analysis.

[0195] Example 2: ANGPTL3-targeting sgRNA tested in liver cells

[0196] To reduce the expression of ANGPTL3 protein in liver cells, several single-guide RNAs (sgRNAs) were tested with the OMNI-103 CRISPR nuclease expressed from mRNA in Huh-7 human hepatoma cells. High on-target activity of six (6) different sgRNAs targeting the first exon in the ANGPTL3 gene was screened in Huh-7 cells (Table C and Figure 2A). Briefly, 1 μg of OMNI-103 and 124 pmol of sgRNA were introduced into cells by electroporation using the Lonza 4D-nucleofector system. Cells were harvested 72 h after electroporation. Cell lysis and genomic DNA extraction were performed in Quick Extract (Lucigen), and specific primers were used to amplify endogenous genomic regions to measure on-target activity by next-generation sequencing (NGS). Figure 2B ). To verify the changes in ANGPTL3 expression, ANGPTL3 mRNA levels were evaluated by qRT-PCR and ANGPTL3 secreted protein levels were evaluated by ELISA. For mRNA levels, total mRNA from edited and unedited cells was extracted using the Maxwell RSC automated RNA purification kit (Promega). Total cDNA was synthesized from mRNA using a high capacity RNA-cDNA kit (Applied Biosystems). mRNA levels were measured by qRT-PCR using Sybr green dye and HPRT mRNA levels as controls ( Figure 2C To measure secreted ANGPTL3 protein levels, 1 × 10 6 huh-7 cells and incubated in 500 μl DMEM medium for 24 h. The collected medium samples were centrifuged at 800 g for 10 min to pellet cells and debris, and then analyzed for ANGPTL3 expression by human ANGPTL3 ELISA kit (Abcam) ( Figure 2D ). All tested sgRNAs showed more than 90% genome editing percentage and more than 50% reduction in mRNA expression level. Secretion of ANGPTL3 was lower than the sensitivity level of sgRNAs 29, 30, 32, and 36.

[0197] Example 3: ANGPTL3-targeting sgRNA tested in vivo

[0198] To reduce the expression of ANGPTL3 protein in C57Bl6 mice, LNPs containing "sgRNA1m" or "sgRNA2m" guide molecules and mRNA molecules encoding OMNI-103 were intravenously injected into the tail vein of C57Bl6 mice at a concentration of 2.5 mg / kg or 5 mg / kg (Table D). Serum was collected from mice on day 0 (injection day) and 14 days later. To evaluate on-target editing, the whole liver was collected and isolated into a single cell suspension using a liver perfusion kit and a GentleMACS instrument (Miltenyi Biotec). Genomic DNA extraction was performed using a Maxwell RSC cell kit (Promega), and specific primers were used to amplify endogenous genomic regions to measure on-target activity by next-generation sequencing (NGS) ( Figure 3A). To verify the changes in ANGPTL3 expression, we assessed ANGPTL3 mRNA levels by qRT-PCR and ANGPTL3 secreted protein levels by ELISA. To assess mRNA levels, total mRNA was extracted using the Maxwell RSC automated RNA purification kit (Promega). Total cDNA was synthesized from mRNA using a high capacity RNA-cDNA kit (Applied Biosystems). LDLR mRNA levels were measured by qRT-PCR using Sybr green dye, and HPRT mRNA levels were measured as a control ( Figure 3B To measure secreted ANGPTL3 protein levels, serum samples collected from mice before and 14 days after treatment were analyzed for ANGPTL3 expression using a mouse ANGPTL3 ELISA kit (Abcam). Figure 3C ). Both tested sgRNAs showed more than 50% genome editing percentage and more than 80% reduction in mRNA expression levels in all mice. The secretion of ANGPTL3 was reduced by more than 80% in the sgRNA2m and more than 95% in the sgRNA1m test group.

[0199] References

[0200] 1.Ahmad and Allen (1992) "Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro", Cancer Research 52: 4817-20.

[0201] 2.Anderson (1992) "Human gene therapy", Science 256:808-13.

[0202] 3.Basha et al. (2011) "Influence of Cationic Lipid Composition on GeneSilencing Properties of Lipid Nanoparticle Formulations of siRNAin Antigen-Presenting Cells", Mol.Ther.19(12):2186-200.

[0203] 4.Behr(1994)Gene transfer with synthetic cationic amphiphiles:Prospects for gene therapy”,Bioconjuage Chem 5:382-89.

[0204] 5.Blaese(1995)“Vectors in cancer therapy:how will they deliver”,Cancer Gene Ther.2:291-97.

[0205] 6.Blaese et al.(1995)“T lympocyte-directed gene therapy for ADA-SCID:initial trial results after 4years”,Science 270(5235):475-80.

[0206] 7.Buchschacher and Panganiban(1992)“Human immunodeficiency virusvectors forinducible expression of foreign genes”,J.Virol.66:2731-39.

[0207] 8.Burstein et al.(2017)“New CRISPR-Cas systems from uncultivatedmicrobes”,Nature 542:237-41.

[0208] 9.Chang and Wilson(1987)“Modification of DNA ends can decrease end-joiningrelative to homologous recombination in mammalian cells”,Proc.Natl.Acad.Sci.USA 84:4959-4963.

[0209] 10.Chung et al.(2006)“Agrobacterium is not alone:gene transfer toplants by virusesand other bacteria”,Trends Plant Sci.11(1):1-4.

[0210] 11.Coelho et al.(2013)“Safety and efficacy of RNAi therapy fortransthyretinamyloidosis”N.Engl.J.Med.369,819-829.

[0211] 12.Collias and Beisel(2021)“CRISPR technologies and the search forthe PAM-freenuclease”,Nature Communications 12,555.

[0212] 13.Crystal(1995)“Transfer of genes to humans:early lessons andobstacles to success”,Science 270(5235):404-10.

[0213] 14.Dillon(1993)“Regulation gene expression in gene therapy”Trends inBiotechnology11(5):167-173.

[0214] 15.Dranoff et al.(1997)“Aphase I study of vaccination withautologous,irradiatedmelanoma cells engineered to secrete human granulocytemacrophage colony stimulatingfactor”,Hum.Gene Ther.8(1):111-23.

[0215] 16.Dunbar et al.(1995)“Retrovirally marked CD34-enriched peripheralblood and bonemarrow cells contribute to long-term engraftment afterautologous transplantation”,Blood85:3048-57.

[0216] 17.Ellem et al.(1997)“A case report:immune responses and clinicalcourse of the firsthuman use of ganulocyte / macrophage-colony-stimulating-factor-tranduced autologousmelanoma cells for immunotherapy”,Cancer ImmunolImmunother 44:10-20.

[0217] 18.Gao and Huang(1995)“Cationic liposome-mediated gene transfer”GeneTher.2(10):710-22.

[0218] 19.Haddada et al.(1995)“Gene Therapy Using Adenovirus Vectors”,in:TheMolecularRepertoire of Adenoviruses III:Biology and Pathogenesis,ed.Doerflerand pp.297-306.

[0219] 20.Han et al.(1995)“Ligand-directed retro-viral targeting of humanbreast cancer cells”,Proc Natl Acad Sci U.S.A.92(21):9747-51.

[0220] 21.Hu et al.(2018)“Evolved Cas9 variants with broad PAM compatibilityand highDNA specificity”,Nature 556(7699):57-63.

[0221] 22.Jinek et al.(2012)“Aprogrammable dual-RNA-guided DNAendonucleaseinadaptive bacterial immunity,”Science 337(6096):816-21.

[0222] 23.Johan et al.(1992)“GLVR1,a receptor for gibbon ape leukemia virus,is homologousto a phosphate permease of Neurospora crassa and is expressed athigh levels in the brain andthymus”,J Virol 66(3):1635-40.

[0223] 24.Judge et al.(2006)“Design of noninflammatory syntheticsiRNAmediating potentgene silencing in vivo”,Mol Ther.13(3):494-505.

[0224] 25.Kohn et al.(1995)“Engraftment of gene-modified umbilical cordblood cells inneonates with adnosine deaminase deficiency”,Nature Medicine 1:1017-23.

[0225] 26.Kremer and Perricaudet(1995)“Adenovirus and adeno-associated virusmediatedgene transfer”,Br.Med.Bull.51(1):31-44.

[0226] 27.Macdiarmid et al.(2009)“Sequential treatment of drug-resistanttumors with targetedminicells containing siRNAor a cytotoxic drug”,NatBiotehcnol.27(7):643-51.

[0227] 28.Malech et al.(1997)“Prolonged production of NADPH oxidase-correctedgranulocyes after gene therapy of chronic granulomatous disease”,PNAS 94(22):12133-38.

[0228] 29.Miller et al.(1991)“Construction and properties of retroviruspackaging cells basedon gibbon ape leukemia virus”,J Virol.65(5):2220-24.

[0229] 30.Miller(1992)“Human gene therapy comes of age”,Nature 357:455-60.

[0230] 31.Mitani and Caskey(1993)“Delivering therapeutic genes–matchingapproach andapplication”,Trends in Biotechnology 11(5):162-66.

[0231] 32.Nabel and Felgner(1993)“Direct gene transfer for immunotherapyandimmunization”,Trends in Biotechnology 11(5):211-15.

[0232] 33.Nishimasu et al.(2018)“Engineered CRISPR-Cas9 nuclease withexpanded targetingspace”,Science 361(6408):1259-1262.

[0233] 34.Remy et al.(1994)“Gene Transfer with a Series of Lipphilic DNA-BindingMolecules”,Bioconjugate Chem.5(6):647-54.

[0234] 35.Sentmanat et al.(2018)“A Survey of Validation Strategies forCRISPR-Cas9 Editing”,Scientific Reports 8:888,doi:10.1038 / s41598-018-19441-8.

[0235] 36.Sommerfelt et al.(1990)“Localization of the receptor gene for typeD simianretroviruses on human chromosome 19”,J.Virol.64(12):6214-20.

[0236] 37.Van Brunt(1988)“Molecular framing:transgenic animals as bioactors”Biotechnology 6:1149-54.

[0237] 38.Vigne et al.(1995)“Third-generation adenovectors for genetherapy”,RestorativeNeurology and Neuroscience 8(1,2):35-36.

[0238] 39.Walton et al.(2020)“Unconstrained genome targeting with near-PAMless engineeredCRISPR-Cas9 variants”,Science 368(6488):290-296.

[0239] 40.Weissman and Kariko(2015)“mRNA:Fulfilling the promise of genetherapy”,Molecular Therapy(9):1416-7.

[0240] 41.Wilson et al.(1989)“Formation of infectious hybrid virion withgibbon ape leukemiavirus and human T-cell leukemia virus retroviral envelopeglycoproteins and the gag and polproteins of Moloney murine leukemia virus”,J.Virol.63:2374-78.

[0241] 42.Yu et al.(1994)“Progress towards gene therapy for HIV infection”,GeneTher.1(1):13-26.

[0242] 43.Zetsche et al.(2015)“Cpf1 is a single RNA-guided endonuclease of aclass 2CRIPSR-Cas system”Cell 163(3):759-71.

[0243] 44.Zuris et al.(2015)“Cationic lipid-mediated delivery of proteinsenables efficientprotein based genome editing in vitro and in vivo”NatBiotechnol.33(1):73-80.

Claims

1. A method for inactivating at least one allele of angiopoietin-like protein 3 (ANGPTL3) gene in a cell, the method comprising introducing into the cell a composition comprising: at least one CRISPR nuclease, or a nucleotide molecule encoding a CRISPR nuclease; and an RNA molecule comprising a guide sequence portion, or a DNA molecule encoding said RNA molecule, wherein the complex of the CRISPR nuclease and the RNA molecule effects a double strand break in at least one allele of the ANGPTL3 gene, The guide sequence portion of the RNA molecule consists of 17-50 consecutive nucleotides.

2. The method of claim 1, wherein the composition is introduced into cells of a subject or into cells in culture.

3. The method according to any one of claims 1-2, wherein the cell is a liver cell, preferably a hepatocyte or a stem cell.

4. The method of any one of claims 1-3, wherein the CRISPR nuclease and the RNA molecule are introduced into the cell at substantially the same time or at different times.

5. The method according to any one of claims 1 to 4, wherein the allele of the ANGPTL3 gene in the cell is subjected to an insertion or deletion mutation.

6. The method of claim 5, wherein the insertion or deletion mutation generates a premature stop codon.

7. The method of any one of claims 1-6, wherein the inactivation results in a truncated protein encoded by the inactivated allele.

8. The method of any one of claims 1-7, wherein the guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 or exon 7 of the ANGPTL3 gene.

9. The method according to any one of claims 1 to 8, wherein the guide sequence portion is complementary to a target sequence located 30 base pairs upstream to 30 base pairs downstream of the ANGPTL3 gene exon, and a) the exon is exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 6333-9188 by no more than 3 nucleotides; b) the exon is exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9189-9978 by no more than 3 nucleotides; c) the exon is exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9979-10786 by no more than 3 nucleotides; d) the exon is exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 10787-11633 by no more than 3 nucleotides; e) the exon is exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 11634-12384 by no more than 3 nucleotides; f) the exon is exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 12385-14057 by no more than 3 nucleotides; or g) the exon is exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 1-6332 and 14058-15412 by no more than 3 nucleotides.

10. The method according to any one of claims 1 to 7, wherein the guide sequence portion consists of 17 to 50 consecutive nucleotides and comprises 17 to 22 nucleotides in a sequence shown in any one of SEQ ID NOs: 1 to 20347 or a sequence that differs from a sequence shown in any one of SEQ ID NOs: 1 to 20347 by no more than 3 nucleotides.

11. A composition comprising an RNA molecule, wherein the RNA molecule comprises a guide sequence portion, wherein the guide sequence portion consists of 17-50 consecutive nucleotides and comprises 17-22 nucleotides in a sequence shown in any one of SEQ ID NOs: 1-20347 or a sequence that differs from the sequence shown in any one of SEQ ID NOs: 1-20347 by no more than 3 nucleotides.

12. The composition of claim 11, wherein the guide sequence portion is complementary to a target sequence located 50 base pairs upstream to 50 base pairs downstream of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 or exon 7 of the ANGPTL3 gene.

13. The composition according to claim 11 or 12, wherein the guide sequence portion is complementary to a target sequence located 30 base pairs upstream to 30 base pairs downstream of an exon of an ANGPTL3 gene, and a) the exon is exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 6333-9188 by no more than 3 nucleotides; a) the exon is exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9189-9978 by no more than 3 nucleotides; b) the exon is exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 9979-10786 by no more than 3 nucleotides; c) the exon is exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 10787-11633 by no more than 3 nucleotides; d) the exon is exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 11634-12384 by no more than 3 nucleotides; e) the exon is exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 12385-14057 by no more than 3 nucleotides; or f) the exon is exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is identical to or differs from the sequence shown in any one of SEQ ID NOs: 1-6332 and 14058-15412 by no more than 3 nucleotides.

14. The composition of any one of claims 11-13, further comprising a CRISPR nuclease.

15. The composition of any one of claims 11-14, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule.

16. The composition of any one of claims 11-15, wherein the CRISPR nuclease and RNA molecule form a complex, or the CRISPR nuclease, RNA molecule and tracrRNA molecule form a complex.

17. A medicament comprising the composition according to any one of claims 11-16 for inactivating an ANGPTL3 allele in a cell, wherein the medicament is administered by delivering the composition according to any one of claims 11-16 to the cell.

18. Use of the composition according to any one of claims 11-16 for treating, alleviating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, comprising delivering the composition according to any one of claims 11-16 to a subject who is experiencing or is likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

19. A medicament comprising the composition according to any one of claims 11-16, for treating, alleviating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia, wherein the medicament is administered by delivering the composition according to any one of claims 11-16 to a subject who is experiencing or is likely to experience hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

20. A kit for inactivating an ANGPTL3 allele in a cell, comprising the composition of any one of claims 11-16 and instructions for delivering the composition to the cell.

21. A kit for treating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia in a subject, comprising a composition according to any one of claims 11-16 and instructions for delivering the composition to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

22. The composition according to any one of claims 1 to 16, which is used for treating, alleviating or preventing hypertriglyceridemia, hyperlipidemia or hypercholesterolemia.

23. A method of treating hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia in a subject, the method comprising administering to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia a composition according to any one of claims 11-16.

24. A composition, method, process, kit, modified cell or use characterized by one or more elements disclosed herein.

Images