Rice high-temperature-resistant gene OsACX2 and application thereof

Abstract

The invention belongs to the technical field of agricultural biology, discloses a rice high-temperature-resistant gene OsACX2 and application thereof, and particularly discloses application of the OsACX2 gene in regulation and control of high-temperature resistance of rice. The invention discloses the application of the OsACX2 in regulating and controlling the high temperature resistance of the rice for the first time. Through target gene screening and in combination with CRISPR / Cas9 technology, the OsACX2 is knocked out / knocked down and the OsACX2 gene is overexpressed, and the importance of the OsACX2 on regulation and control of the high temperature resistance of the rice is proved. Meanwhile, knockout of the gene can be used for creating high-temperature-resistant rice germplasm resources and can be applied to breeding of new high-temperature-resistant rice varieties.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology, and specifically relates to a rice high temperature resistance gene OsACX2 and an application thereof. Background Art

[0002] Rice is one of the three major food crops in the world, and more than half of the world's population relies on rice as their staple food. my country is the world's largest rice producer and consumer, with the second largest rice planting area in the world and the largest total output in the world. In recent years, with the global temperature rising year by year, extreme high temperature weather in summer has occurred frequently, seriously threatening the planting and production of double-season early rice and medium-season rice in southern my country. Studies have shown that developing anthers are most sensitive to high temperature stress. When the daily average temperature is higher than 32°C and the daily maximum temperature is higher than 35°C, the cracking of rice anthers will be blocked, the number and activity of pollen will be reduced, and even male sterility will occur, which will affect the pollination and fertilization process and ultimately lead to a decrease in fruit setting rate. Accelerating the breeding of heat-resistant and excellent varieties is an effective way to solve this problem. However, at present, there are few heat-resistant genes and germplasm resources for rice that can be used. Therefore, it is of great significance to explore heat-resistant related genes and cultivate heat-resistant and excellent rice varieties to ensure national food security. Summary of the invention

[0003] The first aspect of the present invention aims to provide an application of the OsACX2 gene.

[0004] The second aspect of the present invention aims to provide the use of OsACX2 inhibitors.

[0005] The third aspect of the present invention aims to provide a sgRNA.

[0006] The purpose of the fourth aspect of the present invention is to provide biological materials related to the gRNA of the third aspect of the present invention.

[0007] The purpose of the fifth aspect of the present invention is to provide a CRISPR / Cas system.

[0008] The purpose of the sixth aspect of the present invention is to provide the use of the gRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention, the CRISPR / Cas system of the fifth aspect of the present invention, or a reagent containing the gRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention, or the CRISPR / Cas system of the fifth aspect of the present invention.

[0009] The seventh aspect of the present invention aims to provide a method.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides the application of the OsACX2 gene in at least one of a1) to a14):

[0012] a1) Regulating the high-temperature tolerance performance of rice;

[0013] a2) Preparing a product for regulating the high-temperature tolerance performance of rice;

[0014] a3) Cultivating high-temperature tolerant rice varieties;

[0015] a4) Preparing a product for cultivating high-temperature tolerant rice varieties;

[0016] a5) Improving the high-temperature survival rate of rice;

[0017] a6) Preparing a product for improving the high-temperature survival rate of rice;

[0018] a7) Improving the high-temperature antioxidant capacity of rice;

[0019] a8) Preparing a product for improving the high-temperature antioxidant capacity of rice;

[0020] a9) Enhancing the vitality of rice pollen under high temperature;

[0021] a10) Preparing a product for enhancing the vitality of rice pollen under high temperature;

[0022] a11) Preparing to improve the pollen germination rate of rice under high temperature;

[0023] a12) Preparing a product for improving the pollen germination rate of rice under high temperature;

[0024] a13) Preparing to improve the seed setting rate of rice under high temperature;

[0025] a14) Preparing a product for improving the seed setting rate of rice under high temperature;

[0026] The nucleotide sequence of the OsACX2 gene is as shown in SEQ ID NO: 2.

[0027] In some embodiments of the present invention, the product includes but is not limited to reagents, reagent kits, and drugs.

[0028] In some embodiments of the present invention, the product further includes a pharmaceutically acceptable carrier, and the carrier includes but is not limited to: diluents, buffers, suspensions, emulsions, granules, encapsulants, excipients, fillers, binders, sprays, transdermal absorbents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents, or adsorption carriers.

[0029] The OsACX2 gene (LOC_Os11g39220), with a full-length coding region of 2100 bp, consists of seven exons and is a gene encoding acyl (fatty acyl) CoA oxidase (ACX).

[0030] The second aspect of the present invention provides the use of an OsACX2 inhibitor in at least one of b1) to b14):

[0031] b1) Regulating the high-temperature tolerance of rice;

[0032] b2) Preparing a product for regulating the high-temperature tolerance of rice;

[0033] b3) Cultivating high-temperature-tolerant rice varieties;

[0034] b4) Preparing a product for cultivating high-temperature-tolerant rice varieties;

[0035] b5) Improving the high-temperature survival rate of rice;

[0036] b6) Preparing a product for improving the high-temperature survival rate of rice;

[0037] b7) Improving the high-temperature antioxidant capacity of rice;

[0038] b8) Preparing a product for improving the high-temperature antioxidant capacity of rice;

[0039] b9) Enhancing the viability of rice pollen under high temperature;

[0040] b10) Preparing a product for enhancing the viability of rice pollen under high temperature;

[0041] b11) Preparing to increase the pollen germination rate of rice under high temperature;

[0042] b12) Preparing a product for increasing the pollen germination rate of rice under high temperature;

[0043] b13) Preparing to increase the seed setting rate of rice under high temperature;

[0044] b14) Preparing a product for increasing the seed setting rate of rice under high temperature;

[0045] The nucleotide sequence of the said OsACX2 is as shown in SEQ ID NO:2.

[0046] In some embodiments of the present invention, the said OsACX2 inhibitor includes at least one of substances that reduce the expression level of OsACX2.

[0047] In some embodiments of the present invention, the substances that reduce the expression level of OsACX2 include at least one of c1) to c13):

[0048] c1) At least one of siRNA, dsRNA, miRNA, ribozyme, shRNA, and CRISPR / Cas system targeting OsACX2;

[0049] c2) A nucleic acid molecule encoding c1);

[0050] c3) An expression cassette containing the nucleic acid molecule described in c2);

[0051] c4) A recombinant vector containing the nucleic acid molecule described in c2);

[0052] c5) A recombinant vector containing the expression cassette described in c3);

[0053] c6) A recombinant cell containing the nucleic acid molecule described in c2);

[0054] c7) A recombinant cell containing the expression cassette described in c3);

[0055] c8) A recombinant cell containing the recombinant vector described in c4);

[0056] c9) A recombinant cell containing the recombinant vector described in c5);

[0057] c10) A recombinant microorganism containing the nucleic acid molecule described in c2);

[0058] c11) A recombinant microorganism containing the expression cassette described in c3);

[0059] c12) A recombinant microorganism containing the vector described in c4);

[0060] c13) A recombinant microorganism containing the vector described in c5).

[0061] In some embodiments of the present invention, the CRISPR / Cas system includes an sgRNA targeting OsACX2 or a biomaterial related to the sgRNA;

[0062] The biomaterial related to the sgRNA includes at least one of d1) to d12):

[0063] d1) A nucleic acid molecule encoding the sgRNA;

[0064] d2) An expression cassette containing the nucleic acid molecule described in d1);

[0065] d3) A recombinant vector containing the nucleic acid molecule described in d1);

[0066] d4) A recombinant vector containing the expression cassette described in d2);

[0067] d5) A recombinant cell containing the nucleic acid molecule described in d1);

[0068] d6) A recombinant cell containing the expression cassette described in d2);

[0069] d7) A recombinant cell containing the recombinant vector described in d3);

[0070] d8) A recombinant cell containing the recombinant vector described in d4);

[0071] d9) A recombinant microorganism containing the nucleic acid molecule described in d1);

[0072] d10) A recombinant microorganism containing the expression cassette described in d2);

[0073] d11) A recombinant microorganism containing the recombinant vector described in d3);

[0074] d12) A recombinant microorganism containing the recombinant vector described in d4).

[0075] In some embodiments of the present invention, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 5.

[0076] In some embodiments of the present invention, the CRISPR / Cas system further comprises a Cas protein and / or biomaterials related to the Cas protein;

[0077] The biomaterials related to the Cas protein include at least one of d1) to d12):

[0078] d1) A nucleic acid molecule encoding a Cas protein;

[0079] d2) An expression cassette containing the nucleic acid molecule described in d1);

[0080] d3) A recombinant vector containing the nucleic acid molecule described in d1);

[0081] d4) A recombinant vector containing the expression cassette described in d2);

[0082] d5) A recombinant cell containing the nucleic acid molecule described in d1);

[0083] d6) A recombinant cell containing the expression cassette described in d2);

[0084] d7) A recombinant cell containing the recombinant vector described in d3);

[0085] d8) A recombinant cell containing the recombinant vector described in d4);

[0086] d9) A recombinant microorganism containing the nucleic acid molecule described in d1);

[0087] d10) A recombinant microorganism containing the expression cassette described in d2);

[0088] d11) A recombinant microorganism containing the recombinant vector described in d3);

[0089] d12) A recombinant microorganism containing the recombinant vector described in d4).

[0090] In some embodiments of the present invention, the recombinant vector is a plasmid vector, phagemid, viral vector, cell vector, phage, cosmid, F cosmid, artificial chromosome.

[0091] In some embodiments of the present invention, the plasmid vector can be an optional plasmid, the viral vector can be an optional virus, and the cell vector does not include propagation materials.

[0092] In some embodiments of the present invention, the Cas protein is selected from Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d and Cas14, including any recombinant variants thereof, particularly selected from Cas9, including any recombinant variants thereof.

[0093] In some embodiments of the present invention, the product includes but is not limited to reagents, kits and drugs.

[0094] In some embodiments of the present invention, the product further includes a pharmaceutically acceptable carrier, and the carrier includes but is not limited to: diluents, buffers, suspensions, emulsions, granules, encapsulants, excipients, fillers, binders, sprays, transdermal absorbents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents or adsorption carriers.

[0095] In the third aspect of the present invention, there is provided an sgRNA, and the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:5. Among them, A, C, G and U are nucleotide components including modified nucleotide components.

[0096] In some embodiments of the present invention, the modifications are such as glycosylation modification, methylation modification, etc.

[0097] In some embodiments of the present invention, the sgRNA targets OsACX2 and can co-knockout / knockdown OsACX2 with the Cas protein.

[0098] In some embodiments of the present invention, the nucleotide sequence of the OsACX2 is as shown in SEQ ID NO:2.

[0099] The fourth aspect of the present invention provides a biological material related to the sgRNA of the third aspect of the present invention, and the biological material includes at least one of e1) to e12):

[0100] e1) A nucleic acid molecule encoding the sgRNA of the third aspect of the present invention;

[0101] e2) An expression cassette containing the nucleic acid molecule described in e1);

[0102] e3) A recombinant vector containing the nucleic acid molecule described in e1);

[0103] e4) A recombinant vector containing the expression cassette described in e2);

[0104] e5) A recombinant cell containing the nucleic acid molecule described in e1);

[0105] e6) A recombinant cell containing the expression cassette described in e2);

[0106] e7) A recombinant cell containing the recombinant vector described in e3);

[0107] e8) A recombinant cell containing the recombinant vector described in e4);

[0108] e9) A recombinant microorganism containing the nucleic acid molecule described in e1);

[0109] e10) A recombinant microorganism containing the expression cassette described in e2);

[0110] e11) A recombinant microorganism containing the recombinant vector described in e3);

[0111] e12) A recombinant microorganism containing the recombinant vector described in e4).

[0112] In some embodiments of the present invention, the recombinant vector is a plasmid vector, phagemid, viral vector, cell vector, phage, cosmid, F cosmid, artificial chromosome.

[0113] In some embodiments of the present invention, the plasmid vector can be an optional plasmid, the viral vector can be an optional virus, and the cell vector does not include propagation materials.

[0114] The fifth aspect of the present invention provides a CRISPR / Cas system, which includes the sgRNA of the third aspect of the present invention and / or the biological material of the fourth aspect of the present invention.

[0115] In some embodiments of the present invention, the CRISPR / Cas system further includes a Cas protein and / or a biological material related to the Cas protein;

[0116] The biological material related to the Cas protein includes at least one of d1) to d12):

[0117] d1) A nucleic acid molecule encoding a Cas protein;

[0118] d2) An expression cassette containing the nucleic acid molecule described in d1);

[0119] d3) A recombinant vector containing the nucleic acid molecule described in d1);

[0120] d4) A recombinant vector containing the expression cassette described in d2);

[0121] d5) A recombinant cell containing the nucleic acid molecule described in d1);

[0122] d6) A recombinant cell containing the expression cassette described in d2);

[0123] d7) A recombinant cell containing the recombinant vector described in d3);

[0124] d8) A recombinant cell containing the recombinant vector described in d4);

[0125] d9) A recombinant microorganism containing the nucleic acid molecule described in d1);

[0126] d10) A recombinant microorganism containing the expression cassette described in d2);

[0127] d11) A recombinant microorganism containing the recombinant vector described in d3);

[0128] d12) A recombinant microorganism containing the recombinant vector described in d4).

[0129] In some embodiments of the present invention, the Cas protein is selected from Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, and Cas14, including any recombinant variants thereof, particularly selected from Cas9, including any recombinant variants thereof.

[0130] The sixth aspect of the present invention provides the use of any one of f1) to f4) in any one of a1) to a14):

[0131] f1) The sgRNA of the third aspect of the present invention;

[0132] f2) The biological material of the fourth aspect of the present invention;

[0133] f3) The CRISPR / Cas system of the fifth aspect of the present invention;

[0134] f4) A reagent containing the sgRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention, or the CRISPR / Cas system of the fifth aspect of the present invention;

[0135] a1) Regulating the high-temperature tolerance performance of rice;

[0136] a2) Preparing a product for regulating the high-temperature tolerance performance of rice;

[0137] a3) Cultivating high-temperature-tolerant rice varieties;

[0138] a4) Preparing a product for cultivating high-temperature-tolerant rice varieties;

[0139] a5) Improving the high-temperature survival rate of rice;

[0140] a6) Preparing a product for improving the high-temperature survival rate of rice;

[0141] a7) Improving the high-temperature antioxidant capacity of rice;

[0142] a8) Preparing a product for improving the high-temperature antioxidant capacity of rice;

[0143] a9) Enhancing the vitality of rice pollen under high temperature;

[0144] a10) Preparing a product for enhancing the vitality of rice pollen under high temperature;

[0145] a11) Preparing to improve the pollen germination rate of rice under high temperature;

[0146] a12) Preparing a product for improving the pollen germination rate of rice under high temperature;

[0147] a13) Preparing to improve the seed setting rate of rice under high temperature;

[0148] a14) Preparing a product for improving the seed setting rate of rice under high temperature.

[0149] In some embodiments of the present invention, the product includes, but is not limited to, reagents, reagent kits, and drugs.

[0150] In some embodiments of the present invention, the product further includes a pharmaceutically acceptable carrier, and the carrier includes, but is not limited to: diluents, buffers, suspensions, emulsions, granules, encapsulants, excipients, fillers, binders, sprays, transdermal absorbents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents, or adsorption carriers.

[0151] The seventh aspect of the present invention provides a method, including the step of reducing the expression level of OsACX2 in rice:

[0152] The method is at least one of g1) to g7):

[0153] g1) Regulating the high temperature tolerance performance of rice;

[0154] g2) Cultivating high temperature tolerant rice varieties;

[0155] g3) Improving the high temperature survival rate of rice;

[0156] g4) Improving the high temperature antioxidant capacity of rice;

[0157] g5) Enhancing the vitality of rice pollen under high temperature;

[0158] g6) Preparing to improve the pollen germination rate of rice under high temperature;

[0159] g7) Preparing to improve the seed setting rate of rice under high temperature;

[0160] The nucleotide sequence of the said OsACX2 gene is as shown in SEQ ID NO:2.

[0161] In some embodiments of the present invention, the step of reducing the expression level of OsACX2 in rice is to introduce at least one of h1) - h4) into rice:

[0162] h1) The sgRNA of the third aspect of the present invention;

[0163] h2) The biological material of the fourth aspect of the present invention;

[0164] h3) The CRISPR / Cas system of the fifth aspect of the present invention;

[0165] h4) A reagent containing the sgRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention or the CRISPR / Cas system of the fifth aspect of the present invention.

[0166] In some embodiments of the present invention, the method includes the step of knocking out / knocking down OsACX2 in rice by using gene editing technology.

[0167] In some embodiments of the present invention, the gene editing technology includes ZFNs, TALENs or CRISPR / Cas technology.

[0168] In some embodiments of the present invention, the OsACX2 gene is knocked out / knocked down by using CRISPR / Cas9 technology.

[0169] In some embodiments of the present invention, knocking out / knocking down the OsACX2 gene by using CRISPR / Cas9 technology includes the following steps:

[0170] 1. Target selection. According to the target design website (http: / / skl.scau.edu.cn / ), target screening was carried out, and finally the target was designed at 110 - 129 bp (AGACGACGAAGACGACCGGA) of the genomic sequence;

[0171] 2. Design of target primers. Since the U3 promoter was used for this target, the target primers were designed as follows: F - GGCAGACGACGAAGACGACCGGA; R - TCTGCTGCTTCTGCTGGCCTCAAA;

[0172] 3. Ligation of the target to the U3 promoter. The target primers were mixed with the vector containing the U3 promoter, BsaI and T4 ligase were added, and the target sequence was inserted into the vector by the method of cutting and ligating simultaneously;

[0173] 4. Amplification of the promoter - target fusion product. Using the product in step 3 as a template, and using F - CTCCGTTTTACCTGTGGAATCG and R - CGGAGGAAAATTCCATCCAC as amplification primers respectively, the amplification of the promoter - target fusion product was carried out;

[0174] 5. Ligation of the target to the editing vector. The PCR product in step 4 was mixed with the PYLCRISPR / Cas9 vector, and the target sequence was inserted into the editing vector by the method of cutting and ligating simultaneously;

[0175] 6. Transformation of rice callus and induction of regenerated plants. The vector constructed in step 5 was transformed into Agrobacterium, the rice callus was taken and placed in the Agrobacterium suspension for infection, and then the callus was taken out and placed on the differentiation medium for induction and differentiation of regenerated plants;

[0176] 7. Identification of positive plants. Fresh leaves of the regenerated plants were taken to extract DNA, primers were designed upstream and downstream of the genomic target design position for PCR amplification, and the amplification products were subjected to sequencing detection. Taking the wild - type plants as a control, the plants with different sequencing results at the target position compared with the wild - type were positive plants with gene editing.

[0177] The beneficial effects of the present invention are as follows:

[0178] The present invention discloses for the first time the application of OsACX2 in regulating the high - temperature tolerance of rice. By screening target genes and combining with the CRISPR / Cas9 technology to knockout / knockdown OsACX2 and over - express the OsACX2 gene, the importance of OsACX2 in regulating the high - temperature tolerance of rice is proved. At the same time, the knockout of this gene can be used to create rice germplasm resources with high - temperature tolerance, which can be applied to the breeding of new rice varieties with high - temperature tolerance.

[0179] In this invention, OsACX2 gene knockout mutant rice plants were successfully obtained by using CRISPR / Cas9 technology in rice. These rice plants have strong high-temperature antioxidant ability at the seedling stage and a high survival rate under high temperature. In addition, these rice plants have strong pollen viability and high pollen germination rate under high temperature, and these rice plants have a high high-temperature seed setting rate (the average seed setting rate can reach 86.3%). It is indicated that this gene can be used as a target gene for molecular breeding, and the high-temperature tolerance of rice can be improved by gene knockout, providing new gene materials and inspiration for rice molecular breeding. Description of the Drawings

[0180] Figure 1 Comparison of different rice materials with different high-temperature tolerances under high-temperature stress; among them, a is the phenotype of the high-temperature tolerant material (THR) and the high-temperature sensitive material (HTS) before high-temperature treatment at the seedling stage; b is the phenotype of HTR and HTS after 3 days of high-temperature treatment at 45°C and 7 days of recovery at the seedling stage; c is the 1% iodine-potassium iodide staining result of HTS pollen after high-temperature stress; d is the 1% iodine-potassium iodide staining result of HTR pollen after high-temperature stress; e is the effect of high-temperature stress on the seed setting rate of HTS (significantly decreased); f is the effect of the seed setting rate of HTR after high-temperature stress (less affected).

[0181] Figure 2 Results of transcriptome sequencing and fatty acid content analysis; among them, a is the histogram of differentially expressed genes; b is the Venn diagram of differentially expressed genes; c is the KEGG enrichment analysis of the common differentially expressed genes, and the red histogram is the fatty acid metabolism-related pathway; d is the comparison of fatty acid contents in anthers of different rice materials with different high-temperature tolerances before and after high-temperature stress; e is the expression of OsACX2 in anther tissues of high-temperature tolerant and high-temperature sensitive rice before and after high-temperature stress. In the figure, * indicates P<0.05; *** indicates P<0.001.

[0182] Figure 3 Detection of physiological and biochemical indexes of transgenic plants; among them, a is the result of fluorescence quantitative analysis of OsACX2 gene; b is the comparison of DAB and NBT staining of transgenic rice leaves before and after high-temperature treatment; c is the reactive oxygen species burst curve of transgenic rice detached leaves under high-temperature stress; d is the comparison of the contents of MDA, SOD, POD and CAT in transgenic rice leaf tissues before and after high-temperature treatment. In the figure, DAB: 3,3-diaminobenzidine; NBT: nitroblue tetrazolium chloride; NT: normal temperature; HT: high temperature; * indicates P<0.05; ** indicates P<0.01; *** indicates P<0.001.

[0183] Figure 4Analysis of high-temperature tolerance at the seedling stage of transgenic rice; among them, a shows the performance under high-temperature stress at the seedling stage of rice; b shows the statistics of high-temperature survival rate at the seedling stage of rice; c shows the analysis results of JA content in leaf weight at the seedling stage; d shows the effect of exogenous JA on high-temperature tolerance of plants at the seedling stage; e shows the analysis results of subcellular localization of OsACX2; f: GUS staining analysis results.

[0184] Figure 5 Analysis of anther fatty acid content under high-temperature stress; among them, a shows the statistics of the number of differential fatty acids; b shows the heatmap analysis of differential fatty acids; c shows the KEGG enrichment analysis of differential fatty acids; d shows the expression trend analysis of differential fatty acids; e shows the radar chart analysis of the top 10 differential fatty acids; f shows the box plot analysis of all-cis-7,10,13,16,19-Docosapentaenoic acid and Oleic acid.

[0185] Figure 6 PI-FDA staining results of pollen (200μm).

[0186] Figure 7 Comparison of transgenic pollen viability and pollination under high-temperature stress (200μm).

[0187] Figure 8 Comparison of transgenic rice florets after high-temperature stress; among them, a is the inflorescence of wild-type (WT) rice after high-temperature stress; b is the inflorescence of OsACX2 overexpressing (pACX2::ACX2) rice; c is the inflorescence of OsACX2 knockout rice (ko-acx2); d is the floret of wild-type (WT) rice after high-temperature stress; e is the floret of OsACX2 overexpressing (pACX2::ACX2) rice; f is the floret of OsACX2 knockout (ko-acx2) rice; g is the anther of wild-type (WT) rice after high-temperature stress; h is the anther of OsACX2 overexpressing (pACX2::ACX2) rice; i is the anther of OsACX2 knockout (ko-acx2) rice; j is the pollen of wild-type (WT) rice after high-temperature stress; k is the pollen of OsACX2 overexpressing (pACX2::ACX2) rice; l is the pollen of OsACX2 knockout (ko-acx2) rice.

[0188] Figure 9 Comparison of high-temperature seed setting rates of transgenic plants; among them, a shows the comparison of JA content in anthers of transgenic plants; b shows the comparison of the number of florets of transgenic plants; c shows the statistics of high-temperature seed setting rates of transgenic plants; d shows the comparison of seed setting between transgenic plants and wild-type under high-temperature stress; e shows the seed setting of panicles of transgenic plants after high-temperature treatment. Specific implementation methods

[0189] The content of the present invention will be further described in detail below through specific embodiments.

[0190] It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0191] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specified for the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0192] The features and performance of the present invention will be further described in detail below in conjunction with the embodiments.

[0193] Example 1 Identification of high temperature tolerance phenotypes of HTR and HTS

[0194] In a glass greenhouse, the artificial temperature control method (high temperature 38°C (9:00 - 17:00) / 30°C (17:00 - 9:00) and suitable temperature 30°C (9:00 - 17:00) / 25°C (17:00 - 9:00)) was used to treat rice plants at the heading and flowering stage. Taking the seed setting rate as the evaluation index, after years of strict screening, two different tolerance rice materials with clear phenotypes and genetic stability, namely high temperature tolerance (HTR) and high temperature sensitivity (HTS), were obtained ( Figure 1 in a).

[0195] Rice seedlings cultured normally for 14 days were placed in an artificial climate chamber at 45°C for high temperature stress treatment. During the treatment, the humidity was maintained at 70%, and the light was set to alternate between 12 hours of light and darkness. After 3 days of high temperature treatment, they were transferred to room temperature for recovery culture. After 7 days, the survival rate was counted. The survival rate of THS was significantly lower than that of HTR ( Figure 1 in b). Rice plants at the flat pillow stage were subjected to artificial temperature control (38°C (9:00 - 17:00) / 30°C (17:00 - 9:00)) in a glass greenhouse. After 5 days, they were transferred to normal temperature for normal growth. At the heading and flowering stage, the florets to be opened were taken for microscopy examination. It was found that the pollen stainability rate of HTS (that is, the pollen grains could be stained by 1% iodine-potassium iodide) was significantly reduced ( Figure 1 in c), while the pollen stainability rate of HTR did not change significantly ( Figure 1 in d). After maturity, the seed setting rate was investigated. The average seed setting rate of HTS was only 38.7%, while the average seed setting rate of HTR was 70.3% ( Figure 1 in e and f), indicating that the high temperature tolerance of HTR at the booting stage was significantly higher than that of HTS.

[0196] Example 2 Screening of differentially expressed genes in anthers of HTR and HTS after high temperature stress and detection of fatty acid content

[0197] Separate the florets at the flowering stage of HTR and HTS under suitable temperature and high temperature stress, respectively, isolate the anther tissues therefrom, and perform transcriptome sequencing on them. The analysis results of the sequencing results are as follows Figure 2 shown. A total of 2,146 differentially expressed genes were screened before and after high temperature in HTR (1,258 up-regulated and 888 down-regulated), and a total of 1,765 differentially expressed genes were screened before and after high temperature in HTS (759 up-regulated and 1,006 down-regulated) ( Figure 2 a) in). Venn analysis showed that there were 29 common differentially expressed genes ( Figure 2 b) in). KEGG enrichment analysis of the common differentially expressed genes before and after high temperature in HTR and HTS showed that a large number of differentially expressed genes were enriched in signal pathways related to fatty acid metabolism, such as Fatty acid metabolism, Fatty acid biosynthesis, Fatty acid degradation, and Fattyacid elongation and other signal pathways ( Figure 2 c) in).

[0198] The lipidome of anther tissues at different developmental stages of HTR and HTS before and after high temperature stress was compared and analyzed by targeted metabolomics technology. The results showed that there were significant differential accumulations of a large number of long-chain unsaturated fatty acids (such as Linoleic acid, Linolenic acid, Margaric acid, and γ-Linoenic acid, etc.) ( Figure 2 d) in). Further analysis of the differentially expressed genes enriched in the signal pathways related to fatty acid metabolism found that the OsACX2 gene (LOC_Os11g39220) had significant differential expression before and after high temperature ( Figure 2 e) in), suggesting the importance of the OsACX2 gene in the response of rice anthers to high temperature stress. The full length of the coding region of the OsACX2 gene is 2,100 bp (the nucleotide sequence is as shown in SEQ ID NO: 1, and the nucleotide sequence is as shown in SEQ ID NO: 2), which consists of seven exons. It is an acyl (fatty acyl) CoA oxidase (ACX) encoding gene, which participates in the first step of the β-oxidation of long-chain fatty acids in peroxisomes and is also a key rate-limiting enzyme in the fatty acid degradation reaction. In addition, the OsACX2 gene also participates in the biosynthesis of the plant hormone JA.

[0199] Example 3 Knocking out OsACX2 can significantly enhance the high temperature antioxidant ability of rice seedlings

[0200] Using gene editing technology (CRISPR / Cas9), rice plants with OsACX2 knockout (denoted as ko-acx2) and OsACX2 overexpression (denoted as OE-ACX2) were constructed. The construction method is as follows:

[0201] Method for obtaining OsACX2 overexpressing rice:

[0202] 1. Primer design. According to the cDNA sequence of the OsACX2 gene, PCR amplification primers were designed, F - ATGGCCACCGCCGCCT (SEQ ID NO:3); R - AAAACCAACATGCTGAGTATACTGAGC (SEQ ID NO:4);

[0203] 2. Total RNA extraction and cDNA synthesis from rice florets. Take the freshly emerged panicle tissue, grind it repeatedly in liquid nitrogen, extract total RNA using TRIzol reagent, take a small amount of RNA, and reverse transcribe the RNA into cDNA under the action of reverse transcriptase.

[0204] 3. Amplification of the OsACX2 gene. Using the primers synthesized in step 1 and the cDNA synthesized in step 2 as a template, amplify the OsACX2 gene.

[0205] 4. Sequencing verification of the OsACX2 gene. Sequence the PCR product in step 3, and compare the sequencing results with the cDNA sequence of the OsACX2 gene to ensure the correctness of the amplified sequence;

[0206] 5. Ligation of the OsACX2 gene with the plant expression vector. Ligate the correctly detected sequence in step 4 with the plant expression vector (pCAM1300 - GFP);

[0207] 6. Transformation of rice callus and induction of regenerated plants. Transform the vector constructed in step 5 into Agrobacterium, take the rice callus and place it in the Agrobacterium liquid for infection, and then take out the callus and place it on the differentiation medium for induction and differentiation of regenerated plants;

[0208] 7. Identification of positive plants. Take the fresh leaves of the regenerated plants to extract total RNA, reverse transcribe the RNA into cDNA, and then perform fluorescence quantitative PCR detection on the OsACX2 gene. Using the wild - type plants as a control, the plants with significantly higher expression levels of the OsACX2 gene than the wild - type are transgenic positive plants.

[0209] Knocking out the OsACX2 gene using the CRISPR / Cas9 technology includes the following steps:

[0210] 1. Target site selection. According to the target site design website (http: / / skl.scau.edu.cn / ), screen for target sites, and finally design a target site at 110 - 129bp (AGACGACGAAGACGACCGGA (SEQ ID NO:5)) of the genomic sequence;

[0211] 2. Target primer design. Since the U3 promoter is used for this target, the target primers are designed as follows: F - GGCAGACGACGAAGACGACCGGA (SEQ ID NO:6); R - TCTGCTGCTTCTGCTGGCCTCAAA (SEQ ID NO:7);

[0212] 3. Ligation of the target with the U3 promoter. Mix the target primers with the vector containing the U3 promoter, add BsaI and T4 ligase, and insert the target sequence into the vector using the method of cutting and ligating simultaneously;

[0213] 4. Amplification of the promoter - target fusion product. Using the product in step 3 as a template, and using F - CTCCGTTTTACCTGTGGAATCG (SEQ ID NO:8) and R - CGGAGGAAAATTCCATCCAC (SEQ ID NO:9) as amplification primers respectively, amplify the promoter - target fusion product;

[0214] 5. Ligation of the target with the editing vector. Take the PCR product in step 4 and mix it with the PYLCRISPR / Cas9 vector, and insert the target sequence into the editing vector using the method of cutting and ligating simultaneously;

[0215] 6. Transformation of rice calli and induction of regenerated plants. Transform the vector constructed in step 5 into Agrobacterium, take rice calli and place them in the Agrobacterium suspension for infection, then take out the calli and place them on the differentiation medium for induction and differentiation of regenerated plants;

[0216] 7. Identification of positive plants. Take fresh leaves of the regenerated plants to extract DNA, design primers upstream and downstream of the genomic target design position for PCR amplification, and perform sequencing detection on the amplification products. Using wild - type plants as a control, plants with different sequencing results at the target position compared with the wild - type are positive plants with gene editing.

[0217] The expression levels of OsACX2 in gene - knockout and over - expression rice plants were detected by fluorescence quantitative PCR. Among them, the amplification primer sequences of OsACX2 are shown as SEQ ID NO:10 - 11. The results are as Figure 3 shown in a. The expression level of OsACX2 in over - expression (OE - ACX2) rice plants increased significantly, while the expression level of OsACX2 in gene - knockout (ko - acx2) rice decreased significantly, indicating that the construction of ko - acx2 and OE - ACX2 rice was successful.

[0218] The seeds harvested from the above rice plants were germinated at room temperature. The normally germinated seeds were transferred to a 96-well plate (bottomless) and cultured with Yoshida solution (pH = 5.8) nutrient solution, which was changed every 3 days. The cultivation conditions were: 28°C / 22°C (day / night), 16-hour light / 8-hour dark cycle, and 70% relative humidity. When the seedlings grew to the three-leaf and one-heart stage, they were subjected to a high-temperature stress treatment at 45°C. After 3 hours, samples were taken for DAB (3,3-diaminobenzidine, Solarbio, D7050) and NBT (nitroblue tetrazolium chloride, Solarbio, N8140) staining. The leaf staining results showed that after the high-temperature treatment, the contents of hydrogen peroxide (H 2 O 2 ) and superoxide anion (O 2- ) in OE-ACX2 increased significantly ( Figure 3 b in). Further samples were taken to monitor the reactive oxygen species content in the detached leaf tissues of each rice plant under high-temperature stress in real time (leaf discs were collected on fully expanded leaves using a 5-mm diameter punch, and the leaf discs were placed in 100 μL of reaction solution (the reaction solution consisted of L-012 (reactive oxygen species probe): 4 × 10 -5 mM; horseradish peroxidase: 0.01 mg; 100 μL of 50 mM Tris-HCl buffer with a pH of 7.5)). The results showed that compared with the wild type (9522), OE-ACX2 had a higher peak of reactive oxygen species burst, while the dynamic curve of reactive oxygen species (ROS) in ko-acx2 tended to be flat overall ( Figure 3 c in). In addition, the contents of MDA (malondialdehyde (MDA) content detection kit, Solarbio, BC0025), SOD (superoxide dismutase (SOD) activity detection kit, Solarbio, BC0175), POD (peroxidase (POD) activity detection kit, Solarbio, BC0095), and CAT (catalase (CAT) activity detection kit, Solarbio, BC0205)) in the leaves of each rice plant were detected by spectrophotometry. The detection results showed that before the high-temperature treatment, except that SOD was significantly reduced in OE-ACX2, there were no obvious differences in the other indicators. After the high-temperature treatment, MDA increased extremely significantly in the overexpression material (OE-ACX2), while the CAT content decreased significantly ( Figure 3 d in). The contents of POD and CAT increased extremely significantly in ko-acx2 ( Figure 3 d in). The above results indicate that under high-temperature stress, the ko-acx2 rice plants generate less reactive oxygen species, have a higher integrity of the biological membrane system, and have stronger high-temperature tolerance.

[0219] Example 4 Knockout of OsACX2 can significantly improve the high-temperature survival rate of rice seedlings

[0220] The OsACX2 knockout rice plants and OsACX2 overexpressing rice seeds obtained in Example 3 were germinated at room temperature. The normally germinated seeds were transferred to a 96-well plate (bottomless) and cultured with Yoshida solution (pH = 5.8) nutrient solution, which was changed every 3 days. The cultivation conditions were: 28°C / 22°C (day / night), 16-hour light / 8-hour dark cycle, and 70% relative humidity. When the seedlings grew to the three-leaf and one-heart stage, they were subjected to high-temperature stress at 45°C for 3 days and then transferred to normal growth at room temperature. After 7 days of recovery culture, the survival rates of each rice seedling stage were counted. The results showed that under high-temperature stress, overexpression of the OsACX2 gene increased the high-temperature sensitivity of rice seedlings at the seedling stage, and its high-temperature survival rate was only 5.7%. In contrast, OsACX2 knockout significantly reduced the high-temperature sensitivity of rice seedlings at the seedling stage, and its high-temperature survival rate was 81.2%, showing good high-temperature tolerance. The high-temperature survival rate of wild-type plants was 66.9% ( Figure 4 in a and b).

[0221] The liquid chromatography method was used to detect the content of JA (jasmonic acid) in the leaves of each rice seedling stage above. The detection results showed that compared with the wild type, overexpression of the OsACX2 gene induced a significant increase in the JA content in the leaves at the seedling stage, while gene knockout led to a decrease in the content ( Figure 4 in c).

[0222] JA (JA concentration was 30 mmol / L) was sprayed externally on each rice seedling plant (sprayed once every morning for 3 days of high-temperature treatment) to investigate the high-temperature tolerance of each rice plant after spraying JA. The results of the external spraying experiment showed that external application of JA did not significantly improve the high-temperature tolerance of each transgenic rice seedling stage ( Figure 4 in d).

[0223] The recombinant plasmid of the OsACX2 gene and eGFP was transformed into Agrobacterium tumefaciens. The positive bacterial plaques were propagated and the bacteria were collected. The bacteria were diluted with an infection solution (10 mM MES; 10 mM MgCl 2 ; 200 μM acetosyringone) (OD 600 = 0.8 - 1.0), and then injected into tobacco leaves from the back of the leaves using a syringe. Observation under a laser confocal microscope found that OsACX2 was localized in peroxisomes ( Figure 4 in e). The GUS staining results showed that OsACX2 was mainly expressed in the glumes and anthers ( Figure 4 in f).

[0224] Example 5 Analysis of Fatty Acid Content in Anthers of Transgenic Rice under High-Temperature Stress

[0225] Sow and transplant each rice plant in the normal field, and carry out normal field management during this period. When the rice develops to the flat pillow stage, transfer it to a Percival artificial climate chamber. After high-temperature treatment at 38 °C (7:00-19:00) / 30 °C (19:00-next day 7:00) for 3 days, isolate the anther tissue and perform targeted metabolome analysis of long-chain fatty acids. The results are as Figure 5 shown in a. There are 7 kinds of long-chain fatty acids with increased content and 19 kinds with decreased content in the OsACX2 overexpressing rice plants respectively. There are 25 kinds with increased content and 1 kind with decreased content in the OsACX2 knockout rice plants respectively. There are 26 kinds of long-chain fatty acids with significant differences in content between the overexpressing and knockout rice, among which there are 25 kinds with increased content and 1 kind with decreased content respectively. The results of hierarchical clustering analysis of differential fatty acids are as Figure 5 shown in b. The fatty acid content in the OsACX2 knockout rice is significantly higher than that in the overexpressing rice. The results of KEGG enrichment analysis of differential fatty acids show that a large number of fatty acids are enriched in the signal pathways of Biosynthesis of unsaturated fatty acids, Metabolic pathways and Fatty acid biosynthesis ( Figure 5 shown in c). The expression trend analysis shows that the content of a large number of fatty acids decreases in the OsACX2 overexpressing rice and accumulates in large amounts in the OsACX2 knockout rice, such as Cluster 3, Cluster 4 and Cluster 5 ( Figure 5 shown in d). Take the TOP10 differential fatty acids for radar chart analysis. The results show that the difference in Oleic acid is the most significant, reaching 0.39 times, followed by all-cis-7,10,13,16,19-Docosapentaenoic acid and Elaidic acid ( Figure 5 shown in e and f).

[0226] Example 6 The content of reactive oxygen species in the pollen of gene knockout rice plants under high temperature stress increases

[0227] Carry out high temperature stress on each rice plant. The treatment is the same as in Example 5. After the treatment is completed, transfer it to normal temperature for normal growth. Take the developed and mature pollen during the heading and flowering stage and measure the content of reactive oxygen species in it (PI-FDA staining). PI (Propidium Iodide) can make inactive microspores emit red fluorescence, and FDA (Fluorescein Diacetate) can make active microspores emit green fluorescence. The results of PI-FDA staining show that the overexpression of OsACX2 induces a significant decrease in the number of active pollen in transgenic plants, while knocking out OsACX2 further increases the number of active pollen compared with the wild type ( Figure 6 ).

[0228] Example 7 Enhanced Pollen Viability in OsACX2-Knockout Rice Plants under High-Temperature Stress

[0229] Each rice plant was subjected to high-temperature stress, and the treatment was the same as in Example 5. After the treatment was completed, the plants were transferred to normal temperature for normal growth. At the heading and flowering stage, mature pollen was collected and stained with I 2 -KI. The I 2 -KI staining results showed that overexpression of the OsACX2 gene led to a decrease in the stainable pollen rate ( Figure 7 ). In vitro pollen germination showed that compared with the wild type, the pollen germination rate of OsACX2-knockout plants was significantly increased, while that of overexpressing plants was significantly decreased ( Figure 7 ). Comparison of the number of pollen grains on the stigma found that there was almost no pollen on the stigma of overexpressing plants, while the number of pollen grains on the stigma of knockout plants was significantly higher than that of the wild type ( Figure 7 ).

[0230] Example 8 OsACX2 Is Involved in the Regulation of High-Temperature Tolerance in Rice at the Booting Stage

[0231] Each rice plant was sown and transplanted in the normal field, and normal field management was carried out during this period. When the rice developed to the booting stage, it was transferred to a Percival artificial climate chamber, and the rice panicles at the flat-cushion stage on the same day were marked with tags. After 3 days of high-temperature treatment at 38 °C (7:00-19:00) / 30 °C (19:00-next day 7:00), the plants were transferred to normal temperature for normal growth. The results were significant. Obvious albino appeared in the young panicles of OsACX2 overexpressing plants ( Figure 8 b), and the anthers were significantly smaller than those of the wild type ( Figure 8 a, d, and g) ( Figure 8 e and h). However, there was no obvious change in OsACX2-knockout plants compared with the wild type ( Figure 8 c, f, and i). Pollen microscopy showed that the pollen grains of the wild type and OsACX2-knockout plants developed normally ( Figure 8 j and l), while the pollen grains of overexpressing plants showed abnormal morphology ( Figure 8 k). It was shown that overexpression of OsACX2 induced a decrease in high-temperature tolerance in rice at the booting stage, while the high-temperature tolerance of OsACX2-knockout plants was not affected.

[0232] Example 9 OsACX2 Negatively Regulates High-Temperature Tolerance of Rice Pollen

[0233] Each rice plant was subjected to high-temperature stress, and the treatment was the same as in Example 5. The JA content in the anther tissue of rice was measured. The result analysis showed that the JA content in OsACX2 overexpressing plants was significantly higher than that of the wild type, and the content in gene knockout plants was significantly lower ( Figure 9 a). There was no significant difference in the number of spikelets of transgenic plants compared with the wild type ( Figure 9In b). Further cultivate each rice plant until the panicles are filled, and count the panicle seed-setting rate of each rice plant. The results show that under high-temperature stress, the average seed-setting rate of the gene knockout plants is 86.3%, the seed-setting rate of the wild type is 84.3%, while the seed-setting rate of the over-expression plants decreases extremely significantly, only being 39.03%( Figure 9 In c, d and e).

[0234] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present invention within the scope of knowledge possessed by those of ordinary skill in the art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of the OsACX2 gene in at least one of a1) to a14): a1) regulating the high temperature tolerance of rice; a2) preparing products for regulating the high temperature resistance of rice; a3) Breeding of high temperature resistant rice varieties; a4) preparing products for breeding high temperature resistant rice varieties; a5) Improve the survival rate of rice under high temperature; a6) preparing products for improving the survival rate of rice under high temperature; a7) Improving the high temperature antioxidant capacity of rice; a8) preparing a product for improving the high temperature oxidation resistance of rice; a9) Enhance the vigor of rice pollen under high temperature; a10) preparing a product for enhancing the viability of rice pollen at high temperatures; a11) preparing a method for improving the germination rate of rice pollen under high temperature; a12) preparing a product for improving the germination rate of rice pollen under high temperature; a13) preparing a method for improving the rice seed setting rate under high temperature; a14) preparing a product for improving the rice seed setting rate under high temperature; The nucleotide sequence of the OsACX2 gene is shown in SEQ ID NO:

2.

2. Use of OsACX2 inhibitors in at least one of b1) to b14): b1) regulating the high temperature tolerance of rice; b2) preparing products for regulating the high temperature resistance of rice; b3) Breeding of high temperature resistant rice varieties; b4) preparing products for breeding high temperature resistant rice varieties; b5) Improve the survival rate of rice under high temperature; b6) preparing products for improving the survival rate of rice under high temperature; b7) Improving the high temperature antioxidant capacity of rice; b8) preparing products for improving the high temperature oxidation resistance of rice; b9) Enhance the vitality of rice pollen under high temperature; b10) preparing a product for enhancing the viability of rice pollen at high temperatures; b11) preparing to improve the germination rate of rice pollen under high temperature; b12) preparing a product for improving the germination rate of rice pollen under high temperature; b13) preparing a method for improving the rice seed setting rate under high temperature; b14) preparing a product for improving the rice seed setting rate under high temperature; The nucleotide sequence of OsACX2 is shown in SEQ ID NO:

2.

3. The use according to claim 2, characterized in that: The OsACX2 inhibitor includes at least one of substances that reduce the expression level of OsACX2; Preferably, the substance that reduces the expression level of OsACX2 includes at least one of c1) to c13): c1) at least one of siRNA, dsRNA, miRNA, ribozyme, shRNA, and CRISPR / Cas system targeting OsACX2; c2) a nucleic acid molecule encoding c1); c3) an expression cassette containing the nucleic acid molecule described in c2); c4) a recombinant vector containing the nucleic acid molecule described in c2); c5) a recombinant vector containing the expression cassette described in c3); c6) a recombinant cell containing the nucleic acid molecule described in c2); c7) a recombinant cell containing the expression cassette described in c3); c8) a recombinant cell containing the recombinant vector described in c4); c9) a recombinant cell containing the recombinant vector described in c5); c10) a recombinant microorganism containing the nucleic acid molecule described in c2); c11) a recombinant microorganism containing the expression cassette described in c3); c12) a recombinant microorganism containing the vector described in c4); c13) A recombinant microorganism containing the vector described in c5).

4. The use according to claim 3, characterized in that: The CRISPR / Cas system includes an sgRNA targeting OsACX2 or biological materials associated with the sgRNA: The biological material related to sgRNA includes at least one of d1) to d12): d1) a nucleic acid molecule encoding sgRNA; d2) an expression cassette containing the nucleic acid molecule described in d1); d3) a recombinant vector containing the nucleic acid molecule described in d1); d4) a recombinant vector containing the expression cassette described in d2); d5) a recombinant cell containing the nucleic acid molecule described in d1); d6) a recombinant cell containing the expression cassette described in d2); d7) a recombinant cell containing the recombinant vector described in d3); d8) a recombinant cell containing the recombinant vector described in d4); d9) a recombinant microorganism containing the nucleic acid molecule described in d1); d10) a recombinant microorganism containing the expression cassette described in d2); d11) a recombinant microorganism containing the recombinant vector described in d3); d12) A recombinant microorganism containing the recombinant vector described in d4).

5. A sgRNA, the nucleotide sequence of which is shown in SEQ ID NO:

5.

6. The biological material related to the sgRNA according to claim 5, characterized in that The biological material comprises at least one of e1) to e12): e1) a nucleic acid molecule encoding the sgRNA according to claim 5; e2) an expression cassette containing the nucleic acid molecule described in e1); e3) a recombinant vector containing the nucleic acid molecule described in e1); e4) a recombinant vector containing the expression cassette described in e2); e5) a recombinant cell containing the nucleic acid molecule described in e1); e6) a recombinant cell containing the expression cassette described in e2); e7) a recombinant cell containing the recombinant vector described in e3); e8) a recombinant cell containing the recombinant vector described in e4); e9) a recombinant microorganism containing the nucleic acid molecule described in e1); e10) a recombinant microorganism containing the expression cassette described in e2); e11) a recombinant microorganism containing the recombinant vector described in e3); e12) A recombinant microorganism containing the recombinant vector described in e4).

7. A CRISPR / Cas system, comprising the sgRNA of claim 5 and / or the biological material of claim 6.

8. Application of any of f1) to f4) in any of a1) to a14): f1) the sgRNA according to claim 5; f2) The biological material according to claim 6; f3) The CRISPR / Cas system of claim 7; f4) a reagent containing the sgRNA of claim 5, the biological material of claim 6, or the CRISPR / Cas system of claim 7; a1) Regulating the high temperature resistance of rice; a2) preparing products for regulating the high temperature resistance of rice; a3) Breeding of high temperature resistant rice varieties; a4) preparing products for breeding high temperature resistant rice varieties; a5) Improve the survival rate of rice under high temperature; a6) preparing products for improving the survival rate of rice under high temperature; a7) Improving the high temperature antioxidant capacity of rice; a8) preparing a product for improving the high temperature oxidation resistance of rice; a9) Enhance the vigor of rice pollen under high temperature; a10) preparing a product for enhancing the viability of rice pollen at high temperatures; a11) preparing a method for improving the germination rate of rice pollen under high temperature; a12) preparing a product for improving the germination rate of rice pollen under high temperature; a13) preparing a method for improving the rice seed setting rate under high temperature; a14) preparing a product for improving the rice seed setting rate under high temperature.

9. A method comprising the step of reducing the expression level of OsACX2 in rice: The method is at least one of g1) to g7): g1) Regulating the high temperature resistance of rice; g2) Breeding of high temperature resistant rice varieties; g3) Improve the survival rate of rice under high temperature; g4) Improving the high temperature antioxidant capacity of rice; g5) Enhance the vitality of rice pollen under high temperature; g6) preparing to improve the germination rate of rice pollen under high temperature; g7) preparing a method for improving the rice seed setting rate under high temperature; The nucleotide sequence of the OsACX2 gene is shown in SEQ ID NO:

2.

10. The method according to claim 9, characterized in that The step of reducing the expression level of OsACX2 in rice is to introduce at least one of h1) to h4) into the rice: h1) the sgRNA according to claim 5; h2) The biological material according to claim 6; h3) The CRISPR / Cas system of claim 7; h4) A reagent containing the sgRNA of claim 5, the biological material of claim 6, or the CRISPR / Cas system of claim 7.

Images