Molecular marker for identifying genetic sex of trachinotus goodei and primer pair thereof

Abstract

The application discloses a Trichiurus lepturus gender-specific molecular marker and a primer pair thereof. The application first excavates a DNA fragment with stable difference existing in the genomes of male and female Trichiurus lepturus, i.e., the sequence of the molecular marker is shown as SEQ ID NO:1, which exists on the genetic sex X chromosome of the Trichiurus lepturus and is absent on the Y chromosome. The sequences of the primer pair are shown as SEQ ID NO:2 and 3. A genetic sex identification method of the Trichiurus lepturus is established, and the genetic sex of the Trichiurus lepturus can be accurately identified, which lays a foundation for related genetic basic research. The application has the characteristics of wide application range, simple operation, high accuracy and the like, and has important application value in Trichiurus lepturus gender proportion monitoring and resource investigation.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of fish genomes, and in particular to a molecular marker for identifying the genetic sex of Johnius belangerii and a primer pair thereof. BACKGROUND

[0002] Sex determination, as the core regulatory mechanism of the developmental direction of sexually reproducing organisms, plays a key role in species continuation, adaptive evolution, and maintenance of population genetic diversity, and is a frontier research direction in the intersection of evolutionary biology and developmental genetics. As the class with the most abundant species diversity among vertebrates, teleosts have a unique phylogenetic position, retaining primitive characteristics of early vertebrates while exhibiting evolutionary trends of higher vertebrates. This class has a wide geographical distribution, high environmental adaptability, and a complex sex determination system, providing an ideal model for analyzing the molecular basis of sex determination mechanisms and their evolutionary patterns. However, the sex dimorphism of many fish species is weak, making it difficult to identify their sex by naked eye or traditional taxonomic methods. Therefore, developing molecular markers that can accurately identify the genetic sex of these fish species not only provides precise genetic manipulation targets for sex control breeding of economic fish, but also opens up a molecular level technical path for sex ratio monitoring and protection strategy optimization of endangered species.

[0003] Johnius belangerii belongs to the family Sciaenidae and is mainly distributed in the coastal waters of the Indian Ocean to the western Pacific Ocean. It usually inhabits sandy bottoms and near-reef areas within 100m in shallow seas and estuaries, is an important component of biological communities in many Chinese sea areas, has important ecological value, and is widely studied by fishery biologists. Due to its delicious meat, high nutritional and economic value, it is an important bycatch object for fixed net and trawl operations. However, due to overfishing, habitat degradation, and climate change, the resource quantity fluctuates significantly, and it was listed in the Red List of Endangered Species of the International Union for Conservation of Nature in 2019. As an important component of marine ecosystems, the importance of Johnius belangerii is increasingly significant. Therefore, developing sex molecular markers can be used for population sex ratio monitoring to provide scientific basis for resource management and ecological restoration, and may be used for sex control breeding in the future. SUMMARY

[0004] The purpose of the present application is to provide a molecular marker and identification method that can simply, quickly, and stably identify the genetic sex of different individuals in each population of Johnius belangerii, including embryos, juveniles, and adults of Johnius belangerii.

[0005] To achieve the above object, the application provides a gender-specific molecular marker of Nibea albiflora, characterized in that the sequence of the molecular marker is shown as SEQ ID NO:1, and the molecular marker exists on the sex chromosome X of Nibea albiflora and is absent on the Y chromosome.

[0006] The application further provides a primer pair of the molecular marker for identifying the genetic sex of Nibea albiflora, characterized in that the sequence of the primer pair is shown as SEQ ID NO:2 and 3.

[0007] The application further provides a method for detecting the molecular marker by using the primer pair, characterized in that the primer pair is used for PCR amplification of the DNA to be detected.

[0008] The application further provides a method for identifying the genetic sex of Nibea albiflora, characterized in that the primer pair is used for PCR detection, when the primer pair of SEQ ID NO:2 and 3 is used, there are two specific bands of different sizes of 296bp and 278bp in the PCR amplification fragment, and then it is judged that the genetic sex of the Nibea albiflora to be detected is male; and there is only one specific band of 296bp in the PCR amplification fragment, and then it is judged that the genetic sex of the Nibea albiflora to be detected is female.

[0009] Further, the reaction system of the PCR detection is calculated based on the total reaction volume of 10ul, 5ul of 2xPro TaqMaster Mix, 1ul of 30ng / ul template DNA, 0.4ul of 10ulM forward and reverse primers, and finally ddH2O is added to make up.

[0010] Further, the amplification conditions of the PCR detection are as follows: after pre-denaturation for several minutes at 90℃, denaturation at 95℃ for 30s, annealing at 62℃ for 15s, extension at 72℃ for 30s, 30-35 cycles, and then extension at 72℃ for 5-10min.

[0011] Further, the DNA to be detected is extracted from part of the tissue or cells of the Nibea albiflora to be detected, such as fin strips, scales, blood, and muscles.

[0012] Further, the tissue or cells taken are fresh Nibea albiflora tissue or cells, or frozen tissue or cells, or fixed and preserved tissue or cells.

[0013] The differential sequence of the application, i.e., the sequence of the molecular marker, is SEQ ID NO:1, and the sequence is located in Figure 1 Specifically, SEQ ID NO:1 is located at 186bp-203bp in Figure 1 .

[0014] TCCAGAGAAACGAGTATT SEQ ID NO:1.

[0015] The differential sequence, i.e., the molecular marker sequence, is identified, and the identified sequence is as follows:

[0016] The MF-share (male-female share) primer 1 can distinguish the sequence of SEQ ID NO: 1:

[0017] 1. The MF-share (male-female share) primer 1 upstream sequence - 23 bp

[0018] MFS1-F: 5' CTCGAGTGTCGACAGTAAACAGC 3' SEQ ID NO: 2;

[0019] 2. The MF-share (male-female share) primer 1 downstream sequence - 25 bp

[0020] MFS1-R: 5' AGTTGTCTTTCCCTACTCCTACAAA 3' SEQ ID NO: 3.

[0021] The primer sequence is used to amplify two DNA bands of about 296 bp and 278 bp in the genetically male P. peniculus genome, and only one DNA band of about 296 bp in the genetically female P. peniculus genome. If it is a genetically super-male fish, a DNA band of about 278 bp should be amplified. The accuracy reaches 100%.

[0022] CTCGAGTGTCGACAGTAAACAGCATGAAAAGTTAAAAGAGGGCCATAAAGATTGCGAACCTGCTGCGCTGAATATTCAACACACTTGTTTTTCCCCCCTTTAAAACCGAGGCTACAGCTTTAATGGAGGGAAAACGCCTCCAGAGAAACGAGTATTTCAGAGCCTTAGAAAGAGCTCAGTAGCATGAAAACACAAACTGTGTTTGCTGGAGCATGTAAGGCGCTTTGTCTTTTTTTGTGGAAAATTGGCATGATTGTGCACAAGTGTCTATTTTGTAGGAGTAGGGAAAGACAACT (296 bp)

[0023] SEQ ID NO: 4.

[0024] CTCGAGTGTCGACAGTAAACAGCATGAAAAGTTAAAAGAGGGCCATAAAGATTGCGAACCTGCTGCGCTGAATATTCAACACACTTGTTTTTCCCCCCTTTAAAACCGAGGCTACAGCTTTAATGGAGGGAAAACGCCTCAGAGCCTTAGAAAGAGCTCAGTAGCATGAAAACACAAACTGTGTTTGCTGGAGCATGTAAGGCGCTTTGTCTTTTTTTGTGGAAAATTGGCATGATTGTGCACAAGTGTCTATTTTGTAGGAGTAGGGAAAGACAACT(278bp)SEQ ID NO:5.

[0025] The present application aims at the problem of population resource recession of Nibea albiflora caused by overfishing, environmental change and the like, and provides a non-destructive sex identification method based on gender-specific molecular markers. By screening and verifying the sex-related molecular markers, a technical system for accurately identifying the sex at the molecular level is established, and the destructive limitation of traditional dissection-dependent sex identification on individuals is broken through. The present application can provide a convenient and low-damage standardized tool for evaluating the sex ratio of Nibea albiflora in field population dynamic monitoring, and can also analyze the sex determination related genes or regulation mechanism, provide scientific basis for the sex differentiation theory research and resource protection strategy of Nibea genus fish, and finally promote the ecological conservation and sustainable management of the species. As an important bycatch object of fishing set nets and trawl nets and the like, strengthening the management of Nibea albiflora population resources has important ecological and economic value.

[0026] The present application finds the DNA segment with stable difference between female and male by comparing and analyzing the genomic DNA sequences of 32 female and male Nibea albiflora, designs a pair of specific primers (MFS1-F / R) using the female-male difference of the segment and performs PCR amplification, and detects the amplification results by agarose gel electrophoresis, thereby developing a molecular marker that can accurately identify the genetic sex of Nibea albiflora. Through application verification on batches of populations, it is proved that the developed molecular marker has good stability and high identification accuracy. The molecular marker of the present application can conveniently and accurately identify the genetic sex of Nibea albiflora, provides necessary molecular tools for realizing non-destructive sex identification and accurately judging the genetic sex of Nibea albiflora, and also lays a foundation for studying the sex determination mechanism.

[0027] The present application can simply, quickly and stably identify the genetic sex of different individuals of Nibea albiflora. The application of the DNA molecular marker to the management of the wild resources of Nibea albiflora can effectively identify and determine the genetic sex of Nibea albiflora, and help to identify the normal male and normal female of Nibea albiflora. This will further promote the scientific management of the resources of Nibea albiflora, and ultimately promote the ecological conservation and sustainable management of the species, and create greater economic value for the fishing operation of Nibea albiflora. The molecular marker developed in the present application will also be beneficial to the development of scientific researches on the sex determination mechanism of Nibea albiflora and the like. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Figure 2 is a sequence alignment analysis of the stable difference region existing in the gene structure of female and male Nibea albiflora, wherein the specific primer site designed in the box.

[0029] Figure 2 Figure 3 is genetic sex identification of the first batch of Nibea albiflora individuals by using the MFS-1 primer, wherein N is a negative control, and M represents a DNA molecular weight standard DL500.

[0030] Figure 3 Figure 4 is genetic sex identification of the second batch of Nibea albiflora individuals by using the MFS-1 primer, wherein N is a negative control, and M represents a DNA molecular weight standard DL500. DETAILED DESCRIPTION

[0031] Embodiments of the present application are described in detail below, examples of which are shown in the accompanying drawings, wherein the same or similar reference signs represent the same or similar elements or elements having the same or similar functions throughout. The embodiments described below by referring to the drawings are exemplary and are intended to explain the present application, and cannot be understood as a limitation of the present application. If a specific technique or condition is not specified in the embodiments, the technique or condition described in the literature in the art or according to the product instruction is used. If the manufacturer of the reagent or instrument is not specified, it is a conventional product that can be obtained by market purchase.

[0032] Mining of sex-specific molecular marker of Nibea albiflora

[0033] Based on the re-sequencing data of 32 Nibea albiflora, the sex determination key region of about 0.89 Mb (million base pairs) was accurately located and analyzed by integrating genome-wide association study (GWAS), population differentiation index (Fst) analysis and sex dimorphism insertion-deletion mutation distribution analysis. A pair of high-specificity primers was designed and developed based on the difference of female and male specific haplotype in the region, and a molecular marker that can distinguish the genetic sex of N. albiflora was successfully constructed by PCR amplification and agarose gel electrophoresis detection. After multiple batches of verification, it is proved that the developed molecular marker has good stability and high accuracy. This study significantly improves the universality and accuracy of the marker through multi-dimensional genomics strategy, and breaks through the technical bottleneck of traditional morphological identification which depends on adults and is difficult to determine the gender at early developmental stage. This achievement not only provides a core molecular tool for the whole-cycle monosex culture of N. albiflora, but also lays an important foundation for the analysis of sex determination pathway and the genetic regulation of sex-related traits.

[0034] Example 1: Sex identification of different batches of N. albiflora

[0035] Sample source: A total of 71 N. albiflora samples were detected, which were collected from the sea area near Zhoushan, Zhejiang. The samples were collected in two batches, 32 in the first batch and 39 in the second batch. The samples were randomly caught at sea and can be regarded as different populations.

[0036] The fin rays of the N. albiflora to be tested were cut and placed in a 95% alcohol solution for storage at -20°C for genomic DNA extraction and sex identification.

[0037] The genomic DNA was extracted using a commercially available DNA extraction kit, and the obtained genomic DNA was uniformly diluted to 30 ng / μl as a template for standby;

[0038] The sex identification result was determined by the size of the amplified band; the accuracy of the determination result was confirmed by histological observation after dissection. The sex of the samples used in the experiment was determined and confirmed by dissection and histological observation;

[0039] The genomic DNA was extracted using a commercially available DNA extraction kit, and the obtained genomic DNA was uniformly diluted to 30 ng / μl as a template for standby;

[0040] PCR amplification was performed using primers MFS1-F / R:

[0041] (1) PCR reaction system: the total reaction volume was 10 μl, and the specific reaction system was: 5 μl 2 × Pro Taq MasterMix, 1 μl 30 ng / μl DNA, 0.4 μl 10 μM positive and negative primers, and finally ddH2O was added to make up.

[0042] (2) PCR amplification conditions (annealing temperature of primer MFS1-F / R is 62℃): 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 62℃ annealing for 15 s, 72℃ extension for 30 s, 30-35 cycles followed by 72℃ extension for 5 min.

[0043] Agarose gel electrophoresis detection and result analysis:

[0044] The PCR product amplified by the primer MFS1-F / R can be detected by 3% agarose gel electrophoresis, voltage 120V, current 120A, and running time 120 min. The primer combination can amplify two specific bands in the genomic DNA of all genetically male individuals, one about 296bp (SEQ ID NO: 4) and one about 278bp (SEQ ID NO: 5), and only one specific band about 296bp (SEQ ID NO: 4) can be amplified in the genomic DNA of all genetically female individuals, which is completely consistent with the actual situation. The results are shown in Figure 2 and Figure 3 .

[0045] Figure 2 The results of genetic sex identification of the first batch of Nibea albipunctata individuals by using the MFS1 primer are shown in the figure, and two specific bands of different sizes are amplified in all male Nibea albipunctata individuals to be detected, and only one specific band is amplified in the female individuals to be detected.

[0046] Figure 3 The results of genetic sex identification of the second batch of Nibea albipunctata individuals by using the MFS2 primer are shown in the figure, and two specific bands of different sizes are amplified in all male Nibea albipunctata individuals to be detected, and only one specific band is amplified in the female individuals to be detected.

[0047] The above results are all consistent with the actual situation. It is proved that the pair of primers of the present application can accurately identify the genetic sex of Nibea albipunctata from different populations, and the accuracy is 100%.

[0048] Although the embodiments of the present application have been shown and described above, it should be understood that the above embodiments are exemplary and should not be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments without departing from the principles and purposes of the present application within the scope of the present application.

Claims

1. A gender specific molecular marker of Johnius belangerii, characterized in that, The sequence of the molecular marker is shown as SEQ ID NO: 1, which exists on the sex X chromosome of the P. tridentatus and is deleted on the Y chromosome.

2. A primer pair of a molecular marker for identifying the genetic sex of Nibea diacantha, characterized in that, The sequences of the primer pairs are shown as SEQ ID NO: 2 and 3.

3. A method for detecting the molecular marker of claim 1 using the primer pair of claim 2, characterized in that, The PCR amplification of the DNA to be tested is carried out by using the primer pairs of claim 2.

4. A method of identifying the genetic sex of a Trachinotus goodei, the method comprising, The PCR detection of the DNA to be tested is carried out by using the primer pairs of claim 2, and when the primer pairs of SEQ ID NO: 2 and 3 are used, there are two specific bands of different sizes, 296 bp and 278 bp, in the PCR amplification fragment, so that the genetic sex of the P. tridentatus to be tested is judged to be male. The PCR amplification fragment has only one specific band of 296 bp, so that the genetic sex of the P. tridentatus to be tested is judged to be female.

5. The method of claim 4, wherein, The reaction system of the PCR detection is calculated based on the total reaction volume of 10 μl, 5 μl of 2x Pro Taq Master Mix, 1 μl of 30 ng / μl of template DNA, 0.4 μl of 10 μM of forward and reverse primers, and finally ddH2O is added to make up.

6. The method of claim 4, wherein, The amplification conditions of the PCR detection are as follows: after pre-denaturation for several minutes at 90 ℃, denaturation at 95 ℃ for 30 s, annealing at 62 ℃ for 15 s, extension at 72 ℃ for 30 s, 30-35 cycles, and then extension at 72 ℃ for 5-10 min.

7. The method of claim 4, wherein, The DNA to be tested is extracted from part of the tissue or cells of the P. tridentatus to be tested, such as fin strips, scales, blood, and muscles.

8. The method of claim 7, wherein, The tissue or cells taken are fresh P. tridentatus tissue or cells, or frozen tissue or cells, or fixed and preserved tissue or cells.

Images