An RNAi interference fragment targeting donkey Zfy gene, a carrier and a preparation method and application thereof

Abstract

The application discloses a RNAi interference fragment targeting a donkey Zfy gene, a carrier and a preparation method and application thereof, and relates to the technical field of animal molecular genetics, wherein the RNAi interference fragment comprises RNAi-3-F and RNAi-3-R, and the nucleotide sequences are shown in SEQ ID NO:1 and SEQ ID NO:2 respectively. The RNAi interference fragment provided by the application can target and silence Y chromosome sex determination related genes in male donkey Y spermatogenesis stage key reproductive cells, hinder and interfere with the normal development and physiological functions of Y sperm, regulate the key genes of Y sperm development through specific silencing, realize sex regulation before fertilization, greatly improve the proportion of female individuals of offspring donkeys, and the scheme does not damage target sperm cells and does not reduce sperm activity, and meanwhile, the scheme has the advantages of simple operation and low production cost.

Description

Technical Field

[0001] This invention relates to the field of animal molecular genetics, and more particularly to a targeted donkey... Zfy RNAi interference fragments of genes, vectors, their preparation methods and applications. Background Technology

[0002] Under natural conditions, the sex ratio of donkey offspring is close to 1:1, thus achieving uninterrupted and stable reproduction and maintaining ecological balance. For practical livestock production, an ideal sex ratio is of paramount importance. Enterprises producing donkey products such as hide, meat, and bones desire more males, while females are even more advantageous for producing donkey foals, fetuses, and milk. Humans have long been interested in controlling the sex of animal offspring. Currently, sex control is mainly achieved through pre-fertilization and post-fertilization methods. Pre-fertilization involves separating sperm before fertilization, determining the sex of the offspring at fertilization; post-fertilization uses early embryo sex determination to screen embryos for sex control.

[0003] The theory of sex determination in mammals posits that fertilized eggs with XX sex chromosomes develop into females, while those with XY sex chromosomes develop into males. Fundamentally, the ideal method for controlling the sex of livestock is to first separate X and Y sperm before fertilization, thus artificially controlling the sex of offspring. Theoretically, this is the simplest and most economical approach to sex control. Since the 1950s, numerous studies have reported on sperm separation. These studies have attempted to utilize the different physical characteristics (volume, density, charge, motility) of X and Y sperm, employing various methods such as centrifugation, electrophoresis, ion exchange, and cell surface antigen assays to achieve sperm separation. However, they all share a common problem—poor reproducibility. Furthermore, these differences vary with environmental conditions, leading to inconsistent results and even contradictory conclusions, resulting in controversy surrounding certain differences between the two types of sperm. To date, apart from the certainty of differences in DNA content between X and Y sperm, other differences are minimal or even difficult to determine.

[0004] Currently, based on the principle of differences in DNA content between X and Y sperm in mammals, flow cytometry is used to separate X and Y sperm. This method achieves good separation results, with purity exceeding 90%. However, the equipment is expensive, the separation speed is slow, and the number of fertilized sperm is low, with poor motility, which falls far short of meeting the large-scale production demand for sex-controlled semen. In contrast, if the specific mRNA sequences of the X and Y chromosomes, crucial during sperm development or fertilization, or even embryonic development, could be identified, and combined with modern molecular biology techniques using RNA interference (RNAi), it is hoped that sex control in animals can be achieved simply and quickly at a lower cost.

[0005] RNAi is a post-transcriptional gene silencing (PTGS) phenomenon. It involves the specific degradation of homologous mRNA by artificially synthesized or in vivo-generated double-stranded RNA (dsRNA) within cells, thereby interfering with the expression of the target gene and preventing its expression. RNAi can rapidly, easily, effectively, and specifically downregulate the expression of corresponding genes in cells. It is not only a powerful tool for studying gene function but also provides a new technical means for specific gene therapy, with very broad application prospects.

[0006] Studies at the genomic, mRNA, and protein levels have confirmed the differences in gene expression between X and Y sperm. Gene expression assays show that during the pachytene stage of meiosis in spermatogenesis, to prevent certain enzymes from interacting with the sex chromosomes, the two sex chromosomes are highly condensed to form the sex body. The formation of the sex body protects the sex chromosomes, and the expression of specific genes on the sex chromosomes is shut down. Therefore, there is no mRNA transcription in mature mammalian sperm, yet mature mammalian sperm do contain mRNA. This difference stems from transcription during spermatogenesis, with translation lagging far behind transcription. These mRNAs guide the synthesis of essential proteins after sperm maturation, supplement the oocyte mRNA pool after fertilization, or play a crucial role as RNAi in fertility and fetal growth and development.

[0007] Studies by Hendriksen et al. in mice revealed that during meiosis, almost all sex chromosome genes, except for the Xist gene, were not expressed. However, during anaphase I of meiosis, some sex chromosome-specific genes began to be expressed. After meiosis, high mRNA levels of the Ubely and Sry genes were detected on the Y chromosome; high levels of Ubelx gene mRNA expression were also detected in X sperm, along with the expression product of the X chromosome-specific gene Mhr6A. Furthermore, other X and Y chromosome-specific genes have been found to be expressed, such as the X chromosome-specific genes Akap82 (a skeletal protein in the sperm tail) and Nap-X (encoding a nuclear-associated protein), and the Y chromosome-specific genes Zfy-1, Zfy-2, and Y353 / B.

[0008] in Zfx / Zfy The gene is a pair of alleles on the chromosome that encode zinc finger proteins. It is expressed from the beginning of meiosis and is most abundant in round sperm cells. Zfy The gene is a member of the ZFY (zinc finger-Y) gene family, which includes... Zfx , Zfy and Zfa Genes are very similar in molecular structure. Most mammals have... Zfx and Zfy Gene, Zfx Genes are located on the X chromosome and are essential genes present on the X chromosome of both male and female mammals. Zfy The gene is located on the Y chromosome. The two genes are located at the ends of the sex chromosome, but not in the homologous region. Zfy The gene comprises an acidic transcriptional activating region, a nuclear localization sequence, and a DNA linker region, and has 13 C2H2[Cys(2)His(2)] type zinc finger structures. In mammalian cells, the C2H2 zinc finger structure is one of the most common protein structures, and more than 800 proteins with this zinc finger structure have been discovered to date, playing important physiological functions. Zfx / Zfy The encoded protein acts as a transcription factor, in which Zfy The encoded protein plays a key role in spermatogenesis and is closely related to the occurrence, development and maturation of sperm. It is one of the important genes that regulate the development of male germ cells.

[0009] However, no RNAi technology has yet been used to target specific organisms in donkeys. Zfy There are reports on gene-based sex control. Therefore, this invention proposes a targeted donkey... Zfy RNAi interference fragments, vectors, their preparation methods, and applications are explored to address existing problems in the technology. Summary of the Invention

[0010] To address the above problems, the purpose of this invention is to propose a targeted donkey... Zfy RNAi interference fragments, vectors, their preparation methods, and applications; targeting gene fragments on the Y chromosome of animals (especially donkeys) using RNAi interference vectors. Zfy Gene interference can be used to control the sex of animals, thus solving the technical problems of complex operation, high cost and low efficiency in existing sex control technologies.

[0011] To achieve the objectives of this invention, the invention is implemented through the following technical solution: a targeted donkey Zfy An RNAi interference fragment of a gene, the RNAi interference fragment comprising RNAi-3-F and RNAi-3-R, the nucleotide sequence of the RNAi-3-F being shown in SEQ ID NO:1 and the nucleotide sequence of the RNAi-3-R being shown in SEQ ID NO:2; SEQ ID NO: 1: AATTAATTACATAACTTACGGTAAATTCAAGAGATTTACCGTAAGTTATGTAATTTTTTTCTAG; SEQ ID NO:2: GATCAAAAAAAATTACATAACTTACGGTAAATCTCTTGAATTTACCGTAAGTTATGTAATTTTAA; The aforementioned RNAi interference fragment is used to interfere with the Y chromosome of animals. Zfy Gene.

[0012] A further improvement is that the RNAi interference fragment is used to interfere with the Y chromosome of donkeys. Zfy Gene.

[0013] The RNAi interference fragment is a double-stranded RNAi interference fragment formed by annealing RNAi-3-F shown in SEQ ID NO:1 and RNAi-3-R shown in SEQ ID NO:2.

[0014] A type of targeted donkey Zfy Application of RNAi interference fragments in genes, wherein the RNAi interference fragments are used to prepare drugs or kits for controlling the sex of animals.

[0015] A type of targeted donkey Zfy An RNAi interference vector containing an RNAi interference fragment, used to interfere with genes on the Y chromosome of animals. Zfy Gene.

[0016] A further improvement is that the RNAi interference vector is used to interfere with the Y chromosome of donkeys. Zfy Gene.

[0017] A further improvement is that the RNAi interference vector includes a pEGFP-C1 vector, and the pEGFP-C1 vector is linked to an RNAi interference fragment.

[0018] A further improvement is that the pEGFP-C1 vector is linked to the RNAi interference fragment via EcoRI and BamHI restriction sites.

[0019] A type of targeted donkey Zfy The application of RNAi interference vectors for sex control in animals before fertilization.

[0020] A further improvement is that the RNAi interference vector is injected directly into the animal via testicular injection to interfere with the Y chromosome of the animal. Zfy Gene.

[0021] A further improvement is that the RNAi interference vector is injected directly into the male donkey via testicular injection to interfere with the donkey's Y chromosome. Zfy The gene was injected at a dose of 3 mg per male donkey, evenly distributed into both testes, for a total of 3 injections, with each injection spaced 10 days apart.

[0022] A type of targeted donkey Zfy The method for preparing an RNAi interference vector for a gene includes the following steps: S1. The pEGFP-C1 vector was double-digested using EcoRI and BamHI restriction endonucleases. S2. The RNAi interference fragment is ligated to the enzyme-digested pEGFP-C1 vector to obtain the ligation product. The RNAi interference fragment is ligated to the pEGFP-C1 vector through EcoRI and BamHI restriction sites. The forward oligonucleotide chain (SEQ ID NO:1) and reverse oligonucleotide chain (SEQ ID NO:2) of the RNAi interference fragment are synthesized into double-stranded DNA by annealing, and then ligated to the enzyme-digested pEGFP-C1 vector; S3. The ligation product is transformed into competent cells, and positive clones are screened out. The competent cells are E. coli DH5α competent cells. S4. Sequencing and identification of positive clone bacterial cultures, and amplification of bacterial cultures whose sequencing results are completely consistent with the RNAi interference fragment sequence; S5. Extract the RNAi interference vector from the amplified bacterial culture.

[0023] The beneficial effects of this invention are as follows: This invention is the first to successfully design and screen for specific targeting in donkeys. Zfy RNAi interference fragments of genes that can efficiently silence donkey spermatogenic cells Zfy Gene expression was interfered with in vitro at an efficiency of 72%. The RNAi interference vector provided by this invention can be applied to male donkeys via direct testicular injection. The operation is simple, requires no complex equipment, is low in cost, and is suitable for large-scale livestock production. This invention demonstrates through in vivo experiments that the female rate of offspring from male donkeys injected with this RNAi interference vector is as high as 72.62%, which is significantly different from the natural sex ratio. P <0.01), which can effectively control the sex of donkeys; The method of this invention works before fertilization, does not damage sperm cells, does not reduce sperm motility, and has good biocompatibility. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 The donkey spermatogenic cells of this invention Zfy Gene mRNA expression level statistics; Figure 2 This is a statistical chart of the female rate of first-generation donkeys after in vivo injection of the sex-controlling agent of the present invention; Figure 3 This is a schematic diagram of the construction of the pEGFP-C1 vector of the present invention. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] It should be noted that the technical means not described in detail in the embodiments of the present invention can be implemented by conventional means and are not the key points of the invention, so they will not be elaborated upon.

[0028] Example 1 This embodiment uses a donkey ZfyThe design and synthesis of gene RNAi interference fragments are detailed below: According to domestic cattle data provided by GenBank Zfy The mRNA sequence of the gene (GenBank accession number: NM_177491.1) was used to design specific primers for donkeys. Zfy Gene amplification was performed, and a donkey was cloned for the first time. Zfy The gene sequence is 2406 bp long.

[0029] Based on RNAi design principles and BLAST results from NCBI, three siRNA fragments were selected. The target template sequence of siRNA 1 is shown in SEQ ID NO:3, the target template sequence of siRNA 2 is shown in SEQ ID NO:4, and the target template sequence of siRNA 3 is shown in SEQ ID NO:5.

[0030] SEQ ID NO:3:AACCATTGACGTCAATAATGA; SEQ ID NO:4: AAGAACAAGAGTCCACTATTA; SEQ ID NO:5: AATTACATAACTTACGGTAAA.

[0031] EcoRI and BamHI restriction sites were added at 5' and 3' of each siRNA fragment to design and synthesize three pairs of shRNA oligonucleotide sequences, as shown below: The sequence of plasmid 1 forward oligonucleotide chain (plasmid 1 F, i.e. RNAi-1-F) is shown in SEQ ID NO:6; SEQ ID NO: 6: AATTAACCATTGACGTCAATAATGATTCAAGAGATCATTATTGACGTCAATGGTTTTTTTCTAG; The sequence of the reverse oligonucleotide chain of plasmid 1 (plasmid 1 R, i.e. RNAi-1-R) is shown in SEQ ID NO:7; SEQ ID NO:7: GATCAAAAAAACCATTGACGTCAATAATGATCTCTTGAATCATTATTGACGTCAATGGTTTAA.

[0032] The sequence of plasmid 2 forward oligonucleotide chain (plasmid 2 F, i.e. RNAi-2-F) is shown in SEQ ID NO:8; SEQ ID NO:8: AATTAAGAACAAGAGTCCACTATTATTCAAGAGATAATAGTGGACTCTTGTTCTTTTTTCTAG; The sequence of the reverse oligonucleotide chain of plasmid 2 (plasmid 2 R, i.e. RNAi-2-R) is shown in SEQ ID NO:9; SEQ ID NO: 9: GATCAAAAAAAGAACAAGAGTCCACTATTATTCTCTGAATAATAGTGGACTCTTGTTCTTTTAA.

[0033] The sequence of plasmid 3 forward oligonucleotide chain (plasmid 3 F, i.e. RNAi-3-F) is shown in SEQ ID NO:1; SEQ ID NO: 1: AATTAATTACATAACTTACGGTAAATTCAAGAGATTTACCGTAAGTTATGTAATTTTTTTCTAG; The sequence of the reverse oligonucleotide chain of plasmid 3 (plasmid 3 R, i.e. RNAi-3-R) is shown in SEQ ID NO:2; SEQ ID NO: 2: GATCAAAAAAAATTACATAACTTACGGTAAATCTCTTGAATTTACCGTAAGTTATGTAATTTTAA.

[0034] The sense and antisense strands corresponding to the above plasmids were annealed to form double strands and then ligated into the pEGFP-C1 packaging system vector.

[0035] Example 2 This embodiment provides a targeted donkey Zfy The specific construction method of the RNAi interference vector for the gene will be explained using plasmid 3 as an example. The construction methods of plasmid 1 and plasmid 2 are the same.

[0036] Double digestion of S1 and pEGFP-C1 vectors Take the pEGFP-C1 plasmid vector and perform double digestion with EcoRI and BamHI restriction endonucleases. After digestion, recover and purify the linearized pEGFP-C1 vector fragment for later use.

[0037] S2, ligation of RNAi interference fragment with enzyme digestion vector The double-stranded DNA fragment of plasmid 3 (formed by annealing SEQ ID NO:1 and SEQ ID NO:2) formed in Example 1 was ligated with the above-mentioned enzyme-digested pEGFP-C1 vector fragment to obtain the ligation product.

[0038] S3, Transformation and positive clone screening The ligation product was transformed into E. coli DH5α competent cells and plated on LB agar plates containing kanamycin. Single colonies were picked from the plates and inoculated into LB liquid medium containing kanamycin. Plasmid DNA was extracted using a plasmid miniprep kit and identified by double digestion with EcoRI and BamHI to screen for positive clones.

[0039] S4. Sequencing, Identification, and Amplification Positive clone bacterial solutions that passed enzyme digestion were sent to a biotechnology company for sequencing identification. The sequencing results were compared with the designed RNAi interference fragment sequences (SEQ ID NO:1 and SEQ ID NO:2), and positive clone bacterial solutions with completely consistent sequencing results were selected for amplification.

[0040] S5, Extraction of RNAi interference vector The RNAi interference vector (recombinant plasmid 3) was extracted from the amplified bacterial culture and stored at -20℃ for later use.

[0041] In this embodiment, the construction process of the RNAi interference vector (recombinant plasmid 3) is as follows: Figure 3 As shown, specifically: the sequences shown in SEQ ID NO:1 and SEQ ID NO:2 are annealed to form a double-stranded DNA fragment, which is then ligated into the pEGFP-C1 vector via EcoRI and BamHI restriction sites to construct a recombinant plasmid (this embodiment utilizes the specific restriction sites of the pEGFP-C1 plasmid vector). EcoR I and BamH I. To optimize the RNAi interference vector, ensuring only the vector's infection activity and guaranteeing the biosafety of the sex control reagent.

[0042] Using the same method described above, recombinant plasmid 1 and recombinant plasmid 2 were constructed.

[0043] Example 3 This embodiment involves the in vitro culture of donkey spermatogenic cells. Zfy The specific steps for gene RNAi interference assay are as follows: I. Isolation and Culture of Donkey Testicular Spermatogenic Cells One healthy male donkey was selected, and both testes were surgically removed under aseptic conditions. Sertoli cells and spermatogenic cells were separated using a two-step enzymatic digestion method. These separated cells were placed in DMEM / F12 culture medium containing 10% fetal bovine serum, supplemented with HEPES (15 mmol / L), 100 kU / L penicillin, 0.1 g / L streptomycin, 1 μg / mL epidermal growth factor, 100 μL ITS (insulin, transferrin, sodium selenate), insulin (10 μg / mL), transferrin (10 μg / mL), and retinoic acid (3.3 × 10⁻⁶). -7 mol / L), Vitamin A (3.3×10 -7 mol / L), 10 μg / mL Vitamin E, 10 -4 mol / L Vitamin C, 10 -3 mol / L pyruvate, 10 -7 mol / L testosterone, 25 U / L rFSH.

[0044] The separated donkey spermatogenic cells were divided into 1×10 6 Inoculated at a density of cells / cm² in six-well plates and incubated for 24 hours at 37°C, 5% CO2, and 95% humidity.

[0045] II. Cell Transfection Donkey spermatogenic cells cultured for 24 hours were used as transfection reagents with the Liposome 2000 transfection kit to transfect recombinant plasmids 1, 2, and 3 constructed in Example 2 into the spermatogenic cells. A control group was also set up for transfection with an empty vector. Each experiment was repeated in 3 wells.

[0046] III. Total RNA Extraction and RT-PCR Detection Forty-eight hours after transfection, total RNA was extracted from spermatogenic cells in each group and cDNA was synthesized by reverse transcription using the PrimeScript RT reverse transcription kit.

[0047] Using cDNA obtained from reverse transcription as a template, real-time quantitative PCR was performed using the SYBR Premix Ex Taq PCR kit to detect the cDNA. Zfy mRNA expression levels of the target gene and the internal reference gene GAPDH. Zfy The upstream primer sequence is shown in SEQ ID NO:10 ( Zfy- F), the downstream primer sequence is shown in SEQ ID NO:11 ( Zfy-The annealing temperature was 59℃, and the product length was 134bp. The upstream primer sequence for the internal reference gene GAPDH is shown in SEQ ID NO:12 (GAPDH-F), and the downstream primer sequence is shown in SEQ ID NO:13 (GAPDH-R). The annealing temperature was 60℃, and the product length was 80bp. Each sample was prepared in triplicate. Using GAPDH as the internal reference gene, the 2-ΔΔCt method was used to calculate... Zfy The relative expression level of gene mRNA.

[0048] SEQ ID NO:10: TGGTATGACCATGGACGCAG; SEQ ID NO: 11: CCACAATGTCGACAGTCCCA; SEQ ID NO: 12: AAGGCCATCACCATCTTCCA; SEQ ID NO: 13: CCAGCATCACCCACTTGA.

[0049] IV. Results of In Vitro Interference Tests Cells transfected with empty vector served as a blank control group. Zfy The relative expression level of gene mRNA was set to 1. Statistical analysis showed that compared with the control group, plasmid 1 and plasmid 2 groups... Zfy There was no significant difference in gene mRNA expression levels. P >0.05); while plasmid group 3 Zfy The relative expression level of gene mRNA was only 28% of that of the control group, which was highly significant compared with the empty vector control group. P <0.01), for Zfy The gene interference suppression efficiency reached 72% (e.g. Figure 1 As shown), specifically: Figure 1 In this study, plasmids 1, 2, and 3, which were constructed as interference vectors, were transfected into donkey testicular spermatogenic cells cultured in vitro. RT-PCR was then performed using the primer sequences and PCR conditions for real-time fluorescence quantification of the target and internal reference genes, as shown in Table 1. The results were used to detect the effects of RT-PCR on the spermatogenic cells of donkey testes under in vitro conditions. Zfy Gene mRNA expression levels. For example... Figure 1 As shown, compared with the normal control group, the interference vectors plasmid 1, plasmid 2, and plasmid 3 showed different effects. Zfy The mRNA of the gene did not interfere with the inhibitory effect. However, the interference vector plasmid 3 could reduce the inhibition of spermatogenic cells in donkeys. Zfy Gene mRNA expression levels. Specifically, in spermatogenic cells of interferon plasmid 3. Zfy The expression level of gene mRNA decreased by 72%, which was highly significant. P＜ 0.01).

[0050] Table 1 Primer sequences and PCR conditions for real-time quantitative PCR of target and internal reference genes.

[0051] The above results demonstrate that the recombinant plasmid 3, containing the RNAi interference fragments shown in SEQ ID NO:1 and SEQ ID NO:2, designed in this invention, can efficiently and specifically downregulate donkey spermatogenic cells. Zfy Gene expression levels. Plasmid 1 and plasmid 2, due to targeting... Zfy Different regions of the gene did not show obvious interference effects, indicating that the targeting... Zfy The third siRNA target site of the gene (SEQ ID NO:5) has the best gene silencing efficiency, and its corresponding interfering fragment sequence is RNAi-3-F and RNAi-3-R (SEQ ID NO:1 and SEQ ID NO:2) protected by this invention.

[0052] Example 4 This embodiment involves the donkey's body. Zfy The specific steps of the gene interference and sex control experiment are as follows: I. Grouping and Treatment of Experimental Animals This experiment investigates the regulatory effect of recombinant plasmid 3, containing RNAi interference fragments shown in SEQ ID NO:1 and SEQ ID NO:2, on the sex of donkey offspring.

[0053] Twenty healthy adult male donkeys and 240 female donkeys of suitable age with consistent physiological condition and no underlying diseases were selected. The experiment adopted a completely randomized group design, setting up an experimental group and a control group, with 10 male donkeys and 120 female donkeys in each group. The two groups maintained the same feeding environment, feeding management and other conditions to control experimental variables.

[0054] In the experimental group, male donkeys received intratestinal injections of recombinant plasmid 3 prepared in Example 2, diluted with PBS containing both antibiotics. The single dose was 3 mg, administered bilaterally in three equal injections, with a 10-day interval between each injection. Male donkeys in the control group received sterile saline injections of the same volume, frequency, and method.

[0055] II. Natural mating and offspring sex statistics After the intervention, male donkeys were randomly assigned to female donkey pens according to their groups, with 9-14 female donkeys per pen. Natural estrus mating was adopted, and the ear tags of male and female donkeys and the mating date were accurately recorded. After the female donkeys gave birth, the number of sex foals in the two groups was counted, and the female rate of offspring in each group was calculated.

[0056] III. Results of In Vivo Interference Tests The experimental results are as follows: The control group (injected with physiological saline) produced a total of 83 foals, including 42 male donkeys and 41 female donkeys, with a female offspring rate of 49.40%. The experimental group (injected with recombinant plasmid 3) produced a total of 84 foals, including 23 male donkeys and 61 female donkeys, with a female offspring rate of 72.62%, which was significantly different from the control group. P <0.01) (e.g. Figure 2 (As shown). Specifically: The effective recombinant plasmid 3, screened at the cell level under in vitro culture conditions, was used as a sex control reagent and injected into the testes of live donkeys. Natural mating was then performed, and the number of males and females in the first generation was counted. Figure 2 As shown, the control group (injected with saline) had a female rate of 49.40% in the offspring donkeys; the group injected with recombinant plasmid plasmid 3 had a female rate of 72.62% in the offspring donkeys. Compared with the control group, the sex shift was significant and the difference was highly statistically significant. P＜ 0.01).

[0057] The above results demonstrate that injecting the RNAi interference vector containing the RNAi interference fragments shown in SEQ ID NO:1 and SEQ ID NO:2, constructed according to this invention, into male donkeys via direct testicular injection can effectively interfere with the RNAi interference on the donkey's Y chromosome. Zfy Gene expression inhibits the normal development and physiological function of Y sperm, thereby significantly increasing the proportion of female individuals in offspring and achieving effective sex control.

[0058] Example 5 This embodiment confirms the optimal interference vector sequence for sex control in vitro and in vivo. Based on the results of the in vitro cell interference experiment in Example 3 and the in vivo animal sex control experiment in Example 4, plasmid 3 containing the sequences shown in SEQ ID NO:1 and SEQ ID NO:2 is determined to be the optimal sex control interference vector.

[0059] Among them, RNAi-3-F shown in SEQ ID NO:1 and RNAi-3-R shown in SEQ ID NO:2 were annealed to form a double-stranded RNAi interference fragment. This fragment was ligated to the pEGFP-C1 vector via EcoRI and BamHI restriction sites to construct recombinant plasmid 3.

[0060] The optimal interference fragment targets the donkey. Zfy The core target region (SEQ ID NO:5) in the gene mRNA sequence can be used in vitro to... Zfy The gene mRNA expression level was reduced by 72%, which resulted in a female rate of 72.62% in the F1 generation of donkeys in vivo.

[0061] This invention is based on donkey ZfyGene sequences were designed and screened to obtain specific RNAi interference fragments (SEQ ID NO:1 and SEQ ID NO:2). These interference fragments were ligated into the pEGFP-C1 vector via EcoRI and BamHI restriction sites to construct a recombinant RNAi interference vector (recombinant plasmid 3). After direct testicular injection of this recombinant vector into male donkeys (single dose 3 mg, bilaterally divided, 3 times, 10 days apart), the recombinant vector expressed shRNA in spermatogenic cells, specifically recognizing and degrading the Y chromosome. Zfy gene mRNA, silencing Zfy This interference fragment modifies gene expression, thereby disrupting the normal development and physiological function of Y sperm, giving X sperm a competitive advantage during fertilization, and ultimately resulting in a significant shift in the sex ratio of offspring. In vitro cell experiments have confirmed that this interfering fragment can affect spermatogenic cells in donkeys. Zfy Gene mRNA expression was reduced by 72%; in vivo animal experiments confirmed that the female rate of offspring from male donkeys injected with this recombinant vector was as high as 72.62%, which was significantly different from the natural sex ratio (approximately 50%). P <0.01) The RNAi interference fragment, interference vector, preparation method, and application of the present invention have the advantages of simple operation, low cost, and significant effect. They can be widely used in sex control of donkeys and have good market prospects and economic value.

[0062] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A targeted donkey Zfy RNAi interference fragments of genes, characterized by: The RNAi interference fragment comprises RNAi-3-F and RNAi-3-R, the nucleotide sequence of which is shown in SEQ ID NO:1 and the nucleotide sequence of which is shown in SEQ ID NO:2; SEQ ID NO: 1: AATTAATTACATAACTTACGGTAAATTCAAGAGATTTACCGTAAGTTATGTAATTTTTTTCTAG; SEQ ID NO:2: GATCAAAAAAAATTACATAACTTACGGTAAATCTCTTGAATTTACCGTAAGTTATGTAATTTTAA; The aforementioned RNAi interference fragment is used to interfere with the Y chromosome of animals. Zfy Gene.

2. A targeted donkey according to claim 1 Zfy RNAi interference fragments of genes, characterized by: The RNAi interference fragment is used to interfere with the donkey Y chromosome. Zfy Gene.

3. A targeted donkey Zfy The application of RNAi interference fragments in genes is characterized by: The RNAi interference fragment is used to prepare drugs or kits for controlling the sex of animals.

4. A targeted donkey Zfy RNAi interference vector for genes, characterized by: The RNAi interference vector contains an RNAi interference fragment, and the RNAi interference vector is used to interfere with the Y chromosome of animals. Zfy Gene.

5. A targeted donkey according to claim 4 Zfy RNAi interference vector for genes, characterized by: The RNAi interference vector is used to interfere with the donkey Y chromosome. Zfy Gene.

6. A targeted donkey according to claim 4 Zfy RNAi interference vector for genes, characterized by: The RNAi interference vector includes the pEGFP-C1 vector, which is linked to the RNAi interference fragment.

7. A targeted donkey according to claim 6 Zfy RNAi interference vector for genes, characterized by: The pEGFP-C1 vector is linked to the RNAi interference fragment via EcoRI and BamHI restriction sites.

8. A targeted donkey Zfy The application of RNAi interference vectors for genes is characterized by: The RNAi interference vector is used for sex control in animals before fertilization.

9. A targeted donkey according to claim 8 Zfy The application of RNAi interference vectors for genes is characterized by: The RNAi interference vector was injected directly into the animal via testicular injection to interfere with the Y chromosome of the animal. Zfy Gene.

10. A targeted donkey Zfy A method for preparing an RNAi interference vector for a gene, characterized in that, Includes the following steps: S1. The pEGFP-C1 vector was double-digested using EcoRI and BamHI restriction endonucleases. S2. The RNAi interference fragment is ligated to the enzyme-digested pEGFP-C1 vector to obtain the ligation product. The RNAi interference fragment is ligated to the pEGFP-C1 vector through EcoRI and BamHI restriction sites. S3. Transform the ligation product into competent cells and screen for positive clones. S4. Sequencing and identification of positive clone bacterial cultures, and amplification of bacterial cultures whose sequencing results are completely consistent with the RNAi interference fragment sequence; S5. Extract the RNAi interference vector from the amplified bacterial culture.

Images